< 1365984675 515788 :DHeadshot!~DH____@unaffiliated/dh----/x-6288474 JOIN :#esoteric < 1365985072 67322 :augur!~augur@c-68-34-26-189.hsd1.md.comcast.net QUIT :Remote host closed the connection < 1365985242 604425 :SgeoOnLessDenseW!~Sgeo@ool-ad034ea6.dyn.optonline.net NICK :Sgeo < 1365985257 886741 :Sgeo!~Sgeo@ool-ad034ea6.dyn.optonline.net PRIVMSG #esoteric :If a shirt says to machine wash warm, there's no harm in machine wash cold'ing it, is there? < 1365985271 109910 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :correct < 1365985292 765977 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :except that certain stains won't come out as well on cold (but that has nothing to do with the particular fabric type) < 1365985298 840780 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :and other stains will come out better on cold < 1365985327 74757 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :i'm a simple man with simple clothes and I wash them all together on warm and it's working out p. well < 1365985354 780639 :Sgeo!~Sgeo@ool-ad034ea6.dyn.optonline.net PRIVMSG #esoteric :All my shirts except one say machine wash cold < 1365985361 201414 :Sgeo!~Sgeo@ool-ad034ea6.dyn.optonline.net PRIVMSG #esoteric :So I'll go ahead and machine wash cold < 1365985509 449185 :mnoqy!~okay@pool-98-108-206-66.snloca.dsl-w.verizon.net PRIVMSG #esoteric :good judgment call < 1365985817 37356 :tswett!~quassel@unaffiliated/tswett PRIVMSG #esoteric :Huh. About 3/4 of my shirts say warm and 1/4 say cold. < 1365985877 363547 :tswett!~quassel@unaffiliated/tswett PRIVMSG #esoteric :shachaf: I'm trying to figure out what "I,I drop shipping" might mean. < 1365985883 303636 :zzo38!~zzo38@24-207-49-17.eastlink.ca PRIVMSG #esoteric :Then wash it separately. < 1365985904 39058 :tswett!~quassel@unaffiliated/tswett PRIVMSG #esoteric :Is "drop" the verb or the noun? Is "I" the first-person singular pronoun? Is "I,I" an ordered pair? < 1365985949 305199 :tswett!~quassel@unaffiliated/tswett PRIVMSG #esoteric :Is this "shipping" as in the conveyance of goods, or as in the... what do you call it. < 1365985965 256068 :tswett!~quassel@unaffiliated/tswett PRIVMSG #esoteric :The imagination of relationships? < 1365985978 864913 :oerjan!oerjan@sprocket.nvg.ntnu.no PRIVMSG #esoteric :istr being told here recently that I,I means "i have nothing to say, i just like saying" < 1365985993 491302 :oerjan!oerjan@sprocket.nvg.ntnu.no PRIVMSG #esoteric :or thereabouts < 1365985997 108322 :tswett!~quassel@unaffiliated/tswett PRIVMSG #esoteric :"I have nothing to say, I just like saying drop shipping"? < 1365986002 521621 :oerjan!oerjan@sprocket.nvg.ntnu.no PRIVMSG #esoteric :yeah < 1365986011 634409 :tswett!~quassel@unaffiliated/tswett PRIVMSG #esoteric :Like "I just like saying 'drop shipping'"? < 1365986016 768149 :tswett!~quassel@unaffiliated/tswett PRIVMSG #esoteric :Makes sense, I guess. < 1365986022 98740 :oerjan!oerjan@sprocket.nvg.ntnu.no PRIVMSG #esoteric :the "say" possibly was something else. < 1365986029 651184 :oerjan!oerjan@sprocket.nvg.ntnu.no PRIVMSG #esoteric :but not much more meaningful. < 1365986056 529011 :oerjan!oerjan@sprocket.nvg.ntnu.no PRIVMSG #esoteric :tswett: well the louisiana purchase _did_ look a bit like drop shipping < 1365986074 214823 :tswett!~quassel@unaffiliated/tswett PRIVMSG #esoteric :What is drop shipping, anyway? < 1365986079 210566 :tswett!~quassel@unaffiliated/tswett PRIVMSG #esoteric :Is it when you convey goods by dropping them? < 1365986121 794600 :oerjan!oerjan@sprocket.nvg.ntnu.no PRIVMSG #esoteric :"Drop shipping is a supply chain management technique in which the retailer does not keep goods in stock, but instead transfers customer orders and shipment details to either the manufacturer or a wholesaler, who then ships the goods directly to the customer." hth < 1365986215 243756 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :ts ts ts ts ts ts ts ts ts DROP SHIPPING WUBBBBBBBwubwubwubKZZZZZZZkzZWUBWUBWUBwubwubwub < 1365986236 375741 :oerjan!oerjan@sprocket.nvg.ntnu.no PRIVMSG #esoteric :is kmc quoting lyrics again < 1365986244 278181 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :dubstep: a lyric < 1365986966 843081 :Sgeo!~Sgeo@ool-ad034ea6.dyn.optonline.net PRIVMSG #esoteric :I,I I,I < 1365987270 954295 :FreeFull!~freefull@defocus/sausage-lover PRIVMSG #esoteric :forkIO $ join . atomically $ x >>= readTVar >>= \x -> check (x==0) >> return (putStrLn "Is zero.") Either the STM implementation knows to not resume the thread until the TVar changes, or it doesn't check very often < 1365987285 817383 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :it knows < 1365987291 362000 :FreeFull!~freefull@defocus/sausage-lover PRIVMSG #esoteric :Cool < 1365987291 637503 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :that's the essential idea of STM < 1365987302 63182 :variable!root@freebsd/developer/variable NICK :constant < 1365987315 637294 :FreeFull!~freefull@defocus/sausage-lover PRIVMSG #esoteric :Well, the condition is pure < 1365987317 843887 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric ::t atomically < 1365987319 903245 :lambdabot!~lambdabot@li85-105.members.linode.com PRIVMSG #esoteric :Not in scope: `atomically' < 1365987330 918244 :FreeFull!~freefull@defocus/sausage-lover PRIVMSG #esoteric :So there shouldn't be any reason why it shouldn't know < 1365987384 217862 :Sgeo!~Sgeo@ool-ad034ea6.dyn.optonline.net PRIVMSG #esoteric :Doesn't know the specific TVar under question, or does it treat all TVars touched by that time as suspect? < 1365987398 996372 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :well, it doesn't even care about "check". < 1365987404 870846 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :it cares about "readTVar" < 1365987428 448154 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :i don't know that I'd say it's the 'essential idea', but it's p. important < 1365987451 554314 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :i thought the essential idea of STM was the check state -> do transacation -> check consistency thing < 1365987454 557470 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :or something < 1365987457 799241 :oerjan!oerjan@sprocket.nvg.ntnu.no PRIVMSG #esoteric :@hoogle atomically < 1365987458 505084 :lambdabot!~lambdabot@li85-105.members.linode.com PRIVMSG #esoteric :GHC.Conc.Sync atomically :: STM a -> IO a < 1365987458 699570 :lambdabot!~lambdabot@li85-105.members.linode.com PRIVMSG #esoteric :GHC.Conc atomically :: STM a -> IO a < 1365987458 699775 :lambdabot!~lambdabot@li85-105.members.linode.com PRIVMSG #esoteric :Control.Monad.STM atomically :: STM a -> IO a < 1365987459 696110 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :elliott: also why are you still +o don't you know that it raises the Channel Temperature™ < 1365987461 839301 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :well the "essential idea" is composition < 1365987468 240822 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :Bike: it depends on whether you mean the user's or implementor's point of view < 1365987471 307535 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :kmc: oerjan hasn't added me to the access list yet! < 1365987473 950395 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :kmc: oh you think that's dumb too huh < 1365987479 407301 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :need to be prepared for them trolls < 1365987487 368267 :Sgeo!~Sgeo@ool-ad034ea6.dyn.optonline.net PRIVMSG #esoteric ::o) < 1365987487 563657 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :Bike: channel temp? nah, it's probably fine advice < 1365987494 331385 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :o < 1365987521 73725 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :mainly I like it when people aren't +o all the time because then when they give themselves +o it's like WOAH SHIT JUST GOT REAL < 1365987521 806778 :oerjan!oerjan@sprocket.nvg.ntnu.no PRIVMSG #esoteric :elliott: wait i thought you were +o to handle Gregor's voice < 1365987528 305446 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :haha, true < 1365987537 98604 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :i always imagine it as the sound of a pump action shotgun being cocked < 1365987540 598745 :Fiora!~Fiora@ec2-50-17-93-47.compute-1.amazonaws.com PRIVMSG #esoteric :XD < 1365987549 487998 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :motherfucker you'd best step off < 1365987558 590980 :Fiora!~Fiora@ec2-50-17-93-47.compute-1.amazonaws.com PRIVMSG #esoteric :like a sheriff walking out from around the corner, holding his handgun < 1365987560 993516 :Fiora!~Fiora@ec2-50-17-93-47.compute-1.amazonaws.com PRIVMSG #esoteric :"settle down, boys" < 1365987579 761002 :Fiora!~Fiora@ec2-50-17-93-47.compute-1.amazonaws.com PRIVMSG #esoteric :like in a cowboy movie < 1365987637 610962 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :oerjan: yes. < 1365987644 84718 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :oerjan: consider: someone might come in and demand Gregor have an incorrect voice state. < 1365987653 847864 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :that would be rather disruptive < 1365987662 471785 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :yes < 1365987676 425184 :oerjan!oerjan@sprocket.nvg.ntnu.no PRIVMSG #esoteric :i think this is stretching things a bit. < 1365987689 604069 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :no, it's a reasonable concern < 1365987697 454993 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :oerjan: i have special domain-specific knowledge that i bring to this team < 1365987707 395034 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :kmc: i like it most when multiple ops go +o within seconds of each other < 1365987716 318853 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :and then there's the slight tension as they try to predict whether the other one will act first < 1365987719 530270 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :is that like a mexican standoff < 1365987721 749600 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :so it takes a few seconds longer for anything to happen < 1365987748 760970 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :you need less scrupulous ops < 1365987749 407946 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :kmc: it's like a mexican standoff except they're all shooting the sae guy < 1365987754 730362 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :aka a firing squad maybe < 1365987760 502650 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :yeah < 1365987762 39798 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :a nervous firing squad < 1365987795 350865 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :Nervous Firing Squad, kmc's other band < 1365987828 527248 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :kmc has a lot of bands < 1365987871 878699 :oerjan!oerjan@sprocket.nvg.ntnu.no PRIVMSG #esoteric :i recently read that quisling's firing squad had to replace one member who lost his nerves < 1365987979 863596 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :are we talking literal nerves < 1365987983 729664 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :"whoops they fell out" < 1365987994 97329 :oerjan!oerjan@sprocket.nvg.ntnu.no PRIVMSG #esoteric :i do not think so < 1365988004 5664 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :demyelinating diseases are no laughing matter < 1365988046 347566 :oerjan!oerjan@sprocket.nvg.ntnu.no PRIVMSG #esoteric :i do not think they would admit people with such a disease into the police. < 1365988080 177150 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :ableist < 1365988088 584901 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :Bike: what if I laugh in the face of death, generally speaking < 1365988113 904159 :oerjan!oerjan@sprocket.nvg.ntnu.no PRIVMSG #esoteric :and what if he then answers DO SOMETHING ABOUT YOUR HALITOSIS < 1365988696 633123 :Phantom_Hoover!~phantomho@unaffiliated/phantom-hoover/x-3377486 PRIVMSG #esoteric :"In a February 2005 article in The Times, Julie Burchill argued that use of the word is a form of "social racism", and that such "sneering" reveals more about the shortcomings of the "chav-haters" than those of their supposed victims." -- WP:Chav < 1365988700 358919 :Phantom_Hoover!~phantomho@unaffiliated/phantom-hoover/x-3377486 PRIVMSG #esoteric :seriously < 1365988705 411218 :Phantom_Hoover!~phantomho@unaffiliated/phantom-hoover/x-3377486 PRIVMSG #esoteric :is that the level we're at < 1365988713 105863 :Phantom_Hoover!~phantomho@unaffiliated/phantom-hoover/x-3377486 PRIVMSG #esoteric :that we're calling it 'social racism' now < 1365988731 390550 :Phantom_Hoover!~phantomho@unaffiliated/phantom-hoover/x-3377486 PRIVMSG #esoteric :like, by analogy with 'gender racism'? < 1365988733 156314 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :it's like classism, except... < 1365988743 51770 :Gregor!codu@codu.org PRIVMSG #esoteric :NOBODY GETS HURT < 1365988743 691068 :Phantom_Hoover!~phantomho@unaffiliated/phantom-hoover/x-3377486 PRIVMSG #esoteric :and sexual orientation racism? < 1365988786 504273 :Phantom_Hoover!~phantomho@unaffiliated/phantom-hoover/x-3377486 PRIVMSG #esoteric :or race racism < 1365988787 198657 :Gregor!codu@codu.org PRIVMSG #esoteric :"Gay" is the best race. < 1365988800 644270 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :does 'classism' just sound too old-fashioned as a word < 1365988806 94435 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :BBC tells me that Britain has 7 classes now < 1365988808 668845 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :it sounds marxist < 1365988812 648328 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :each classier than the others < 1365988834 874729 :Phantom_Hoover!~phantomho@unaffiliated/phantom-hoover/x-3377486 PRIVMSG #esoteric :istr there was something very stupid in that article but i forget what it was < 1365988836 788198 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :"Actually the whole point of an interpreter was portability and abstraction" talking about programming languages is suffering < 1365988848 18046 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :also I learned that the Daily Mail has a section called "Femail" which is all about condescending to women and is even worse than the regular Daily Mail < 1365988856 370744 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :that's an impressive feat < 1365988861 120356 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :i know, right? < 1365988875 850347 :Phantom_Hoover!~phantomho@unaffiliated/phantom-hoover/x-3377486 PRIVMSG #esoteric :i'm sceptical < 1365988886 653474 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :maybe it's not really worse, because it's more vapid and pointless < 1365988894 111172 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :i dunno < 1365988900 208370 :Phantom_Hoover!~phantomho@unaffiliated/phantom-hoover/x-3377486 PRIVMSG #esoteric :i mean the rest of the daily mail is technically responsible for the ongoing measles epidemic in swansea < 1365988904 624595 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :what < 1365988910 95768 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :well i have to check it out now < 1365988913 91267 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :Phantom_Hoover: oh? < 1365988917 414538 :Phantom_Hoover!~phantomho@unaffiliated/phantom-hoover/x-3377486 PRIVMSG #esoteric :well they were one of the big promulgators of the mmr scare < 1365988922 538198 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :ugh < 1365988927 837069 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :anti-vacciners? < 1365988929 655402 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :mercury vaccines or something else? < 1365988933 562796 :Phantom_Hoover!~phantomho@unaffiliated/phantom-hoover/x-3377486 PRIVMSG #esoteric :no < 1365988940 515676 :Phantom_Hoover!~phantomho@unaffiliated/phantom-hoover/x-3377486 PRIVMSG #esoteric :mercury vaccines is an american thing < 1365988963 609527 :Phantom_Hoover!~phantomho@unaffiliated/phantom-hoover/x-3377486 PRIVMSG #esoteric :the british version is that MMR is what gives your children autism < 1365988967 11575 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :«'I wish IVF had never been invented' It's brought joy to so many. But, as the scientist behind IVF dies, Samantha Brick says it's given her nothing but heartache...» what the heck < 1365988975 472326 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :Phantom_Hoover: that's a big thing in america too < 1365988983 973389 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :they claim the mercury causes autism somehow < 1365988994 955118 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :oh, yeah, wakefield < 1365988996 126450 :Phantom_Hoover!~phantomho@unaffiliated/phantom-hoover/x-3377486 PRIVMSG #esoteric :yes, autism is obviously a popular choice < 1365988998 491262 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :fuck that guy < 1365989018 116948 :Phantom_Hoover!~phantomho@unaffiliated/phantom-hoover/x-3377486 PRIVMSG #esoteric :(not dr wakefield any more, he got banned from doctoring) < 1365989022 286919 :Fiora!~Fiora@ec2-50-17-93-47.compute-1.amazonaws.com PRIVMSG #esoteric :and autism is as bad as hitler and it's worth subjecting your kids to dangerous diseases with a good chance of killing or cripplingn them because /at least it's not autism/ < 1365989030 243334 :Fiora!~Fiora@ec2-50-17-93-47.compute-1.amazonaws.com PRIVMSG #esoteric :
ACTION fume -_-
< 1365989036 799648 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :«'I've only had three boyfriends! I'm not interested in serial dating' says actress Tamsin Egerton despite rumours linking her to Singularity co-star Josh Hartnett» good lord < 1365989048 428917 :FreeFull!~freefull@defocus/sausage-lover PRIVMSG #esoteric :Last thing I heard was that vitamin d deficiency during pregnancy causes autism < 1365989054 520840 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :i guess being a parent of an autistic kid is terrifying and heartbreaking and you'll grasp desparately for anyone to blame or any supposed cure < 1365989094 332978 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :i think autism is "heartbreaking" mainly because most people have no fucking idea what it is < 1365989095 993186 :Phantom_Hoover!~phantomho@unaffiliated/phantom-hoover/x-3377486 PRIVMSG #esoteric :anxiety over autism scares in pregnancy causes autism < 1365989105 530209 :Fiora!~Fiora@ec2-50-17-93-47.compute-1.amazonaws.com PRIVMSG #esoteric :kmc: they definitely should never, like, ask the kids how they feel < 1365989118 950760 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :well at one end of the spectrum you can't right < 1365989122 792393 :Fiora!~Fiora@ec2-50-17-93-47.compute-1.amazonaws.com PRIVMSG #esoteric :because the true victims are the poor parents < 1365989123 97025 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :because the kids never talk, ever < 1365989123 291120 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :"YouTube star who rose to fame after hilarious drunk makeup tutorial now has more than one billion hits and 8.2 million subscribers" < 1365989127 614959 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :Fiora: um i heard autistic kids don't have emotions < 1365989129 489952 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :100% science fact < 1365989144 482957 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :from the institute of official science < 1365989149 446019 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :i mean it's not like 'autistic' means 'kinda socially awkward guy on reddit' < 1365989156 917051 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :He loves impersonal sex, should I worry? < 1365989169 146054 :Phantom_Hoover!~phantomho@unaffiliated/phantom-hoover/x-3377486 PRIVMSG #esoteric :impersonal sex < 1365989174 580289 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :impersonational sex < 1365989176 643977 :Phantom_Hoover!~phantomho@unaffiliated/phantom-hoover/x-3377486 PRIVMSG #esoteric :is that like sheet with a hole sex < 1365989181 25909 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :ghost sex < 1365989182 200403 :Fiora!~Fiora@ec2-50-17-93-47.compute-1.amazonaws.com PRIVMSG #esoteric :sorry, I have feelings about this <_> < 1365989197 521676 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :kmc: well it's disingenuous to imply that "autism" in general refers to extreme cases < 1365989198 481902 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :ok i'm doing it i'm going to read this article < 1365989201 3793 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :or at least look at it. < 1365989215 89119 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :elliott: sure, I think we can agree that it's a spectrum and people are complicated and Blah Blah < 1365989260 720192 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :"My partner of four years often asks me to lie still in bed, as if I’m asleep, while he makes love to me. He is particularly turned on if I’m lying on my tummy. < 1365989261 757323 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :and in general it is widely interpreted as "autistic people cannot X" when what it actually means is "autistic people X differently but my perspective is too blinkered to understand it, isn't it tragic" < 1365989263 726105 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :Read more: http://www.dailymail.co.uk/femail/article-2305384/Rowan-Pellings-sex-advice-column-He-loves-impersonal-sex.html#ixzz2QUW4WnFA < 1365989269 9707 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :elliott: yeah < 1365989274 342212 :Fiora!~Fiora@ec2-50-17-93-47.compute-1.amazonaws.com PRIVMSG #esoteric :it doesn't even mean that < 1365989278 690291 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :all the same nerds focus on the least extreme manifestations, ime < 1365989278 885008 :FreeFull!~freefull@defocus/sausage-lover PRIVMSG #esoteric :I know a couple of guys with aspergers < 1365989282 465531 :Fiora!~Fiora@ec2-50-17-93-47.compute-1.amazonaws.com PRIVMSG #esoteric :it means "some people described as autistic do X differently" < 1365989291 133947 :Fiora!~Fiora@ec2-50-17-93-47.compute-1.amazonaws.com PRIVMSG #esoteric :"autism" is a description, not a disease < 1365989291 995872 :FreeFull!~freefull@defocus/sausage-lover PRIVMSG #esoteric :I think < 1365989303 831479 :FreeFull!~freefull@defocus/sausage-lover PRIVMSG #esoteric :I'm magnetic to people with aspergers for some reason < 1365989315 180901 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :you may already be... an internet user < 1365989316 312300 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :imo most psychiatric 'diseases' are essentially 'descriptions', i'm not sure how you would distinguish them < 1365989320 499419 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :Fiora: yeah, I was generalising (I have a professional™ official™ aspergers diagnosis™) < 1365989322 47010 :FreeFull!~freefull@defocus/sausage-lover PRIVMSG #esoteric :Also, I can't tell they have aspergers unless they tell me < 1365989327 252017 :Fiora!~Fiora@ec2-50-17-93-47.compute-1.amazonaws.com PRIVMSG #esoteric :http://fioraaeterna.tumblr.com/post/47935156276/hedgehoglike-this-post-is-some-personal <-- this is a good post < 1365989330 837562 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :or maybe it was one of the fancier autism diagnoses, I don't actually remember < 1365989337 671569 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :generalising, simplifying, whatever < 1365989338 172735 :Fiora!~Fiora@ec2-50-17-93-47.compute-1.amazonaws.com PRIVMSG #esoteric :elliott: I'm PDD-NOS, yay < 1365989339 248881 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :"same thing" < 1365989340 150653 :Phantom_Hoover!~phantomho@unaffiliated/phantom-hoover/x-3377486 PRIVMSG #esoteric :Fiora, egotist < 1365989343 928899 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :kmc: certainly they're not something you can "cure". < 1365989361 617518 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :especially something developmental, come on people. < 1365989362 663211 :Tod-Autojoined2!~Tod@166-70-93-209.ip.xmission.com NICK :TodPunk < 1365989362 857242 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :it depends, mostly not tho < 1365989376 86923 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :it means development is different. you can't just erase years of that. < 1365989414 889030 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :"The key thing is that you say your boyfriend is a kind, salt-of-the-earth type — not a brooding Marquis de Sade. < 1365989417 894485 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :Read more: http://www.dailymail.co.uk/femail/article-2305384/Rowan-Pellings-sex-advice-column-He-loves-impersonal-sex.html#ixzz2QUWiWiFo < 1365989420 898830 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :ugh fuck < 1365989424 690464 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :what have i done < 1365989436 451553 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :right i'm done now < 1365989439 973016 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :back to the mental < 1365989443 412959 :Phantom_Hoover!~phantomho@unaffiliated/phantom-hoover/x-3377486 PRIVMSG #esoteric :Fiora, i like how ~the autism spectrum~ is, like, a general breakdown of human psychological traits < 1365989455 287432 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :well it is < 1365989467 742716 :Fiora!~Fiora@ec2-50-17-93-47.compute-1.amazonaws.com PRIVMSG #esoteric :Phantom_Hoover: that's because "autism" is a description/pathology of human psychological traits <.< < 1365989499 647121 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :or rather the point of the Pink Floyd diagram is to show how the developmental differences result in different levels for psychological traits < 1365989500 975718 :Phantom_Hoover!~phantomho@unaffiliated/phantom-hoover/x-3377486 PRIVMSG #esoteric :it seems so hopelessly general... < 1365989514 711752 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :mental illness is like that < 1365989532 77946 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :you threaten suicide so they put you on meds that have suicidal ideation as a side effect < 1365989532 613882 :doesthiswork!~Adium@75.87.251.5 PRIVMSG #esoteric :whats cool to me is that some genes reliably result in autism < 1365989535 79940 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :minds are weird < 1365989537 425593 :Sgeo!~Sgeo@ool-ad034ea6.dyn.optonline.net PRIVMSG #esoteric :
ACTION was diagnosed with Asperger's. At least, according to my dad.
< 1365989547 170361 :Sgeo!~Sgeo@ool-ad034ea6.dyn.optonline.net PRIVMSG #esoteric :It was kept a secret from me for a long time. < 1365989550 577061 :Fiora!~Fiora@ec2-50-17-93-47.compute-1.amazonaws.com PRIVMSG #esoteric :I think generally "autism" is diagnosed by some more specific symptoms, rather than generalized things? like stimming and the sensitivities and so on < 1365989557 519034 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :Bike: i like how the daily mail has javascript to make people link to the daily mail when they quote them mockingly < 1365989557 929105 :Phantom_Hoover!~phantomho@unaffiliated/phantom-hoover/x-3377486 PRIVMSG #esoteric :Sgeo, oh my god < 1365989576 346348 :Fiora!~Fiora@ec2-50-17-93-47.compute-1.amazonaws.com PRIVMSG #esoteric :I'm not an expert though or anything < 1365989584 785811 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :elliott: i have contributed a twentieth of a cent to their coffers ;_; < 1365989634 762423 :mnoqy!~okay@pool-98-108-206-66.snloca.dsl-w.verizon.net PRIVMSG #esoteric :Sgeo: ... < 1365989643 583202 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :the major thing to remember about diagnoses i think is that there's a criterion, explicit or implicit (because you wouldn't seek mental help), of "impairs normal function" < 1365989663 997197 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :if you see dancing elephants but still have a fairly normal life you might never walk to the doctor and find out < 1365989691 750531 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :Bike: sort of gets trickier when there are children involved (which i think is the case for the majority of autism diagnoses?) < 1365989693 691158 :Phantom_Hoover!~phantomho@unaffiliated/phantom-hoover/x-3377486 PRIVMSG #esoteric :Bike, there is a rich vein of Sgeo coming to the surface < 1365989713 194958 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :diagnostic criteria aren't some kind of rubric to fulfill, they're basic guidelines for psychiatric professionals to figure out what's good for an individual patient < 1365989720 194082 :Phantom_Hoover!~phantomho@unaffiliated/phantom-hoover/x-3377486 PRIVMSG #esoteric :suggest we focus on this < 1365989721 658109 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :elliott: oh, sure. < 1365989726 875253 :Sgeo!~Sgeo@ool-ad034ea6.dyn.optonline.net PRIVMSG #esoteric :'Autism' was on ... some paperwork, and when I saw it, my parents said something about them lying to the school to make sure I had services. I thought I only had ADHD. I guess they were both lying to the school and to me... < 1365989729 174709 :pikhq_!~pikhq@174-24-19-12.clsp.qwest.net PRIVMSG #esoteric :Autism, by merit of being a developmental disorder, tends to have much greater *impact* when you're younger. < 1365989739 744699 :Phantom_Hoover!~phantomho@unaffiliated/phantom-hoover/x-3377486 PRIVMSG #esoteric :Sgeo..... < 1365989741 714347 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :I'm really not comfortable making fun of Sgeo for being autistic, if that's what you're alluding to. < 1365989748 874593 :Phantom_Hoover!~phantomho@unaffiliated/phantom-hoover/x-3377486 PRIVMSG #esoteric :no, Bike < 1365989754 166906 :Phantom_Hoover!~phantomho@unaffiliated/phantom-hoover/x-3377486 PRIVMSG #esoteric :that... is not what i am alluding to < 1365989757 830087 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :ok < 1365989764 620157 :pikhq_!~pikhq@174-24-19-12.clsp.qwest.net PRIVMSG #esoteric :Like, now I broadly resemble normality for certain definitions thereof. < 1365989772 306295 :pikhq_!~pikhq@174-24-19-12.clsp.qwest.net PRIVMSG #esoteric :But when I was 3 I couldn't speak. At all. < 1365989781 666912 :Fiora!~Fiora@ec2-50-17-93-47.compute-1.amazonaws.com PRIVMSG #esoteric :I didn't speak until I was um... about 3 and a half, I think < 1365989784 658478 :doesthiswork!~Adium@75.87.251.5 PRIVMSG #esoteric :I'm comfortable making fun of Sgeo but I don't know any jokes < 1365989850 289741 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :i like how the world's largest autism charity literally wants to get rid of autistic people < 1365989857 303346 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :THX 4 THA SUPPORT < 1365989861 68283 :Phantom_Hoover!~phantomho@unaffiliated/phantom-hoover/x-3377486 PRIVMSG #esoteric :i think i could talk when i was two but i was, like, raised by a crazy nanny from the highlands < 1365989863 661522 :Fiora!~Fiora@ec2-50-17-93-47.compute-1.amazonaws.com PRIVMSG #esoteric :elliott: yeah ;-; < 1365989867 213675 :pikhq_!~pikhq@174-24-19-12.clsp.qwest.net PRIVMSG #esoteric :Yeah, those guys are assholes. < 1365989877 799617 :conehead!~conehead@unaffiliated/conehead QUIT :Ping timeout: 276 seconds < 1365989878 327772 :Fiora!~Fiora@ec2-50-17-93-47.compute-1.amazonaws.com PRIVMSG #esoteric :and they literally have no autistic people working for them < 1365989887 113446 :pikhq_!~pikhq@174-24-19-12.clsp.qwest.net PRIVMSG #esoteric :As a matter of policy no less. < 1365989895 703714 :doesthiswork!~Adium@75.87.251.5 PRIVMSG #esoteric :wow < 1365989905 19061 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :Fiora: can't have crazies working for your serious charity obvs < 1365989906 311618 :Sgeo!~Sgeo@ool-ad034ea6.dyn.optonline.net PRIVMSG #esoteric :I had an aspy friend who did stuff for them, I think < 1365989920 736932 :doesthiswork!~Adium@75.87.251.5 PRIVMSG #esoteric :and just for the record vaccinations have no relation to autism < 1365989925 615543 :Fiora!~Fiora@ec2-50-17-93-47.compute-1.amazonaws.com PRIVMSG #esoteric :of course not <_> < 1365989928 377761 :Phantom_Hoover!~phantomho@unaffiliated/phantom-hoover/x-3377486 PRIVMSG #esoteric :thanks doesthiswork < 1365989933 228001 :Phantom_Hoover!~phantomho@unaffiliated/phantom-hoover/x-3377486 PRIVMSG #esoteric :i wasn't sure < 1365989951 843230 :pikhq_!~pikhq@174-24-19-12.clsp.qwest.net PRIVMSG #esoteric :doesthiswork: But but thimerosol! < 1365989968 120718 :Phantom_Hoover!~phantomho@unaffiliated/phantom-hoover/x-3377486 PRIVMSG #esoteric :thiomersal you UNEDUCATED FUCK < 1365989973 110375 :Sgeo!~Sgeo@ool-ad034ea6.dyn.optonline.net PRIVMSG #esoteric :Does Autism Speaks actually promote anti-vax garbage? < 1365989979 823299 :pikhq_!~pikhq@174-24-19-12.clsp.qwest.net PRIVMSG #esoteric :Sgeo: No. < 1365989990 329183 :pikhq_!~pikhq@174-24-19-12.clsp.qwest.net PRIVMSG #esoteric :They're assholes, not utterly ignorant assholes. :P < 1365990020 939974 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :pikhq_: http://en.wikipedia.org/wiki/Autism_Speaks#Position_on_vaccines < 1365990022 996649 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :well, http://en.wikipedia.org/wiki/Autism_Speaks#Position_on_vaccines < 1365990029 934133 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :(they're utterly ignorant assholes) < 1365990032 250364 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :wow Bike how dare you < 1365990032 891539 :pikhq_!~pikhq@174-24-19-12.clsp.qwest.net PRIVMSG #esoteric :Oh, never mind. < 1365990034 482800 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :stealing my link < 1365990037 999863 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :fuck off elliott < 1365990038 194303 :doesthiswork!~Adium@75.87.251.5 PRIVMSG #esoteric :Phantom_Hoover: several hundred messages ago is too far to read < 1365990040 914502 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :can i kick you for that (i am asking because i am responsible) < 1365990042 10814 :pikhq_!~pikhq@174-24-19-12.clsp.qwest.net PRIVMSG #esoteric :Well, fuck them. < 1365990050 842962 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :elliott: what's my optimal kicked status < 1365990055 511365 :zzo38!~zzo38@24-207-49-17.eastlink.ca PRIVMSG #esoteric :I read about Autism Speaks somewhere, and someone made up "Neurotypical Speaks". < 1365990063 497635 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :wow, that sounds even worse! < 1365990071 121224 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :Bike: like maybe half kicked? < 1365990072 790041 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :can we achieve that. < 1365990075 963497 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :hm < 1365990077 744667 :Sgeo!~Sgeo@ool-ad034ea6.dyn.optonline.net PRIVMSG #esoteric :There was a parody site called ISN'T somewhere < 1365990078 963561 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :only one way to find out < 1365990140 50061 :Fiora!~Fiora@ec2-50-17-93-47.compute-1.amazonaws.com PRIVMSG #esoteric :Bike: woooow < 1365990143 441936 :Fiora!~Fiora@ec2-50-17-93-47.compute-1.amazonaws.com PRIVMSG #esoteric :they're even worse than I imagined < 1365990162 29058 :Phantom_Hoover!~phantomho@unaffiliated/phantom-hoover/x-3377486 PRIVMSG #esoteric :http://www.sentex.net/~nexus23/naa_03.html here have a large repository of complaining about such things < 1365990164 942641 :mnoqy!~okay@pool-98-108-206-66.snloca.dsl-w.verizon.net PRIVMSG #esoteric :hey guys i havent been paying attention whatd i miss < 1365990176 883710 :pikhq_!~pikhq@174-24-19-12.clsp.qwest.net PRIVMSG #esoteric :Autism and nothing but. < 1365990177 883949 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :shittiness < 1365990197 947476 :Phantom_Hoover!~phantomho@unaffiliated/phantom-hoover/x-3377486 PRIVMSG #esoteric :hey < 1365990201 673411 :Phantom_Hoover!~phantomho@unaffiliated/phantom-hoover/x-3377486 PRIVMSG #esoteric :the daily mail also < 1365990210 966899 :Sgeo!~Sgeo@ool-ad034ea6.dyn.optonline.net PRIVMSG #esoteric :Sounds more like wasting money than spreading the bad idea? < 1365990211 406616 :Phantom_Hoover!~phantomho@unaffiliated/phantom-hoover/x-3377486 PRIVMSG #esoteric :oh wait you were here for that < 1365990213 119571 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :Phantom_Hoover: wow, i've never seen "behaviourism" used in that sense... < 1365990213 611047 :Phantom_Hoover!~phantomho@unaffiliated/phantom-hoover/x-3377486 PRIVMSG #esoteric :n/m < 1365990232 899364 :mnoqy!~okay@pool-98-108-206-66.snloca.dsl-w.verizon.net PRIVMSG #esoteric :pikhq_: sounds miserable < 1365990244 124957 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :Sgeo: as it alludes to, having a big organization taking that shit seriously gives parents more cause to believe that shit. < 1365990244 324221 :pikhq_!~pikhq@174-24-19-12.clsp.qwest.net PRIVMSG #esoteric :Perhaps we should discuss butts instead. < 1365990247 862269 :mnoqy!~okay@pool-98-108-206-66.snloca.dsl-w.verizon.net PRIVMSG #esoteric :even worse < 1365990252 256495 :mnoqy!~okay@pool-98-108-206-66.snloca.dsl-w.verizon.net PRIVMSG #esoteric :let's go back to autism :-) < 1365990260 394120 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :buttism < 1365990273 332769 :Fiora!~Fiora@ec2-50-17-93-47.compute-1.amazonaws.com PRIVMSG #esoteric :maybe the wonderful stereotypes, like how autistic people don't have empathy < 1365990292 820973 :pikhq_!~pikhq@174-24-19-12.clsp.qwest.net PRIVMSG #esoteric :Oh, those are *grand*. < 1365990621 601367 :Jafet!~Jafet@unaffiliated/jafet QUIT :Read error: Connection reset by peer < 1365990651 100454 :Phantom_Hoover!~phantomho@unaffiliated/phantom-hoover/x-3377486 PRIVMSG #esoteric :@ask fizzie is oklopol real < 1365990651 294962 :lambdabot!~lambdabot@li85-105.members.linode.com PRIVMSG #esoteric :Consider it noted. < 1365990704 223230 :Jafet!~Jafet@unaffiliated/jafet JOIN :#esoteric < 1365990783 962264 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :oklofok: hi < 1365990830 794542 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :folk?? < 1365990858 639324 :Phantom_Hoover!~phantomho@unaffiliated/phantom-hoover/x-3377486 PRIVMSG #esoteric :whoah, oklofok backwards is kofolko < 1365990999 880260 :mnoqy!~okay@pool-98-108-206-66.snloca.dsl-w.verizon.net PRIVMSG #esoteric :and oklopol backwards is lopolko! who'dve guessed < 1365991008 950092 :oerjan!oerjan@sprocket.nvg.ntnu.no PRIVMSG #esoteric :folk and polka < 1365991010 242363 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :blowin' my mind here < 1365991019 591947 :FreeFull!~freefull@defocus/sausage-lover PRIVMSG #esoteric :Well, I'm stupid < 1365991033 42729 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :Bike: man have you even been around when oklofok has been active. you're missing out on so much cultural enrichment < 1365991033 520207 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :Unlikely < 1365991038 462899 :FreeFull!~freefull@defocus/sausage-lover PRIVMSG #esoteric :How do I make a LIFO data structure in haskell? < 1365991054 470835 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :...a stack? < 1365991060 482384 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :wait no that's backwards isn't it < 1365991061 302570 :FreeFull!~freefull@defocus/sausage-lover PRIVMSG #esoteric :No, stacks are fifo < 1365991063 995354 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :god i hate the lifo fifo thing < 1365991078 434683 :FreeFull!~freefull@defocus/sausage-lover PRIVMSG #esoteric :You can use lists for fifo < 1365991135 760744 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :http://cvs.haskell.org/Hugs/pages/libraries/base/Data-Sequence.html has enough for queueing, i guess < 1365991170 11736 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :yeah Seq is a fine queue < 1365991176 353422 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :i mean wouldn't it be basically the same as in any language < 1365991177 415653 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :even a fine deque < 1365991199 111059 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :Bike: well in most languages the expectation is that you'd be mutating a structure, not producing a new one < 1365991208 604566 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :yeah but past that. < 1365991219 122777 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :you can make mutating data structures in Haskell, and you can (and should) make persistent immutable data structures in other languages < 1365991223 517717 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :but the default is different < 1365991228 371720 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :Bike: ok bike. i know you're a bicycle < 1365991234 431491 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :hello < 1365991234 697534 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :but if the url has /Hugs/ in it < 1365991236 669691 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :Bike: it's a pretty deep difference < 1365991238 331534 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :you're linking to something from 2006 < 1365991247 40075 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :see Okasaki, _Purely Functional Data Structures_ < 1365991262 220789 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :http://hackage.haskell.org/packages/archive/containers/0.5.2.1/doc/html/Data-Sequence.html < 1365991267 720373 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :elliott: it's two seconds of googling. < 1365991290 626068 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :you should see the number of people that join #haskell and ask about why they can't find a function in some random ancient version of a package's docs :( < 1365991298 299736 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :
ACTION old, weary
< 1365991301 520457 :oerjan!oerjan@sprocket.nvg.ntnu.no PRIVMSG #esoteric : No, stacks are fifo <-- um no you _are_ getting this backwards. < 1365991304 786807 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :if you want amortized time guarantees on persistent data structures then you actually need laziness in order to avoid duplicating work between different 'timelines' < 1365991315 752514 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :it's kind of neat < 1365991336 180886 :FreeFull!~freefull@defocus/sausage-lover PRIVMSG #esoteric :oerjan: If I push something onto a stack < 1365991337 979617 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :elliott: hello, so has glasgow university gone anywhere with that language implementation? < 1365991339 547957 :FreeFull!~freefull@defocus/sausage-lover PRIVMSG #esoteric :And then pop < 1365991344 117564 :FreeFull!~freefull@defocus/sausage-lover PRIVMSG #esoteric :I get exactly what I just pushed < 1365991345 77875 :FreeFull!~freefull@defocus/sausage-lover PRIVMSG #esoteric :FIFO < 1365991351 173009 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :FreeFull: you push 1, you push 2 < 1365991352 242380 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :FreeFull: try pushing two things < 1365991352 982580 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :you pop, you get 2 < 1365991356 649431 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :i heard it was lazy < 1365991358 262208 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :you pop, you get 1 < 1365991366 68605 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :you pushed 1 first and it came out last, hence FILO < 1365991382 420161 :Jafet!~Jafet@unaffiliated/jafet PRIVMSG #esoteric :Bike: they got sold out to microsoft at some point < 1365991384 763811 :FreeFull!~freefull@defocus/sausage-lover PRIVMSG #esoteric :elliott: Oh, right < 1365991386 901850 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :seriously though what's the point of the fifo thing, i learned that in boringclass but i don't think it particularly helped < 1365991388 225079 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :push 1 -> push 2 -> pop (1) -> pop (2) would be FIFO, because you pushed 1 first and got it out first < 1365991390 805213 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :Jafet: micro$oft < 1365991417 495731 :FreeFull!~freefull@defocus/sausage-lover PRIVMSG #esoteric :Bike: FIFOs are for buffers and pipes and stuff < 1365991419 862654 :Jafet!~Jafet@unaffiliated/jafet PRIVMSG #esoteric :Microdollaroft < 1365991446 279856 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :I know the point. I don't know why you'd move out that description from just general data structure everything. < 1365991447 370478 :FreeFull!~freefull@defocus/sausage-lover PRIVMSG #esoteric :And simple caches < 1365991461 644149 :FreeFull!~freefull@defocus/sausage-lover PRIVMSG #esoteric :Ok, so stacks are LIFOs, what's a simple FIFO < 1365991468 186943 :Phantom_Hoover!~phantomho@unaffiliated/phantom-hoover/x-3377486 PRIVMSG #esoteric :a queue < 1365991474 114208 :Phantom_Hoover!~phantomho@unaffiliated/phantom-hoover/x-3377486 PRIVMSG #esoteric :(ue?) < 1365991492 211402 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :qeuue < 1365991496 10480 :Jafet!~Jafet@unaffiliated/jafet PRIVMSG #esoteric :> (++"ue") `iterate` "Q" < 1365991497 923793 :lambdabot!~lambdabot@li85-105.members.linode.com PRIVMSG #esoteric : ["Q","Que","Queue","Queueue","Queueueue","Queueueueue","Queueueueueue","Que... < 1365991499 720446 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :q < 1365991564 98721 :FreeFull!~freefull@defocus/sausage-lover PRIVMSG #esoteric :> iterate (++"ue") "Hue" < 1365991565 948674 :lambdabot!~lambdabot@li85-105.members.linode.com PRIVMSG #esoteric : ["Hue","Hueue","Hueueue","Hueueueue","Hueueueueue","Hueueueueueue","Hueueue... < 1365991579 570668 :augur!~augur@c-68-34-26-189.hsd1.md.comcast.net JOIN :#esoteric < 1365991584 58894 :augur!~augur@c-68-34-26-189.hsd1.md.comcast.net QUIT :Remote host closed the connection < 1365991605 486681 :FreeFull!~freefull@defocus/sausage-lover PRIVMSG #esoteric :I mean, a cons list is a simple LIFO < 1365991624 396887 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :yes < 1365991639 866348 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :a singly linked list is basically a stack < 1365991643 594827 :FreeFull!~freefull@defocus/sausage-lover PRIVMSG #esoteric :But I can't think of how you'd declare a datastructure that'd be a FIFO < 1365991655 627176 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :doubly linked list, keep both ends < 1365991674 550487 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :yeah, you can't make an efficient immutable structure that way though < 1365991678 483082 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :you have to copy the whole thing on each step < 1365991692 502261 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :a classic immutable/persistent queue structure is composed of two lists < 1365991697 797761 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :i haven't used enough queues to care about how to do it immutably :c < 1365991699 192627 :FreeFull!~freefull@defocus/sausage-lover PRIVMSG #esoteric :I don't want to use a list and do two reverses each time or whatever < 1365991723 687464 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :http://stackoverflow.com/questions/69192/how-to-implement-a-queue-using-two-stacks < 1365991739 520028 :doesthiswork!~Adium@75.87.251.5 PRIVMSG #esoteric :or you could fill a circular buffer < 1365991755 693799 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :that basically does an O(n) reverse only once every n operations, so it's amortized O(1) < 1365991776 332794 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :but this doesn't hold up when you're allowed to hang onto an 'old version' of the structure and use it over and over < 1365991780 190783 :oerjan!oerjan@sprocket.nvg.ntnu.no PRIVMSG #esoteric :FreeFull: the finger tree used for immutable (de)que(ues) in Data.Sequence are quite insanely clever, much more complicated than a list. but i've read they're still quite efficient. < 1365991784 797113 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :working around that is basically what Okasaki's book is about < 1365991789 476791 :oerjan!oerjan@sprocket.nvg.ntnu.no PRIVMSG #esoteric :*trees < 1365991794 380782 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :for the double list queue, then for more complicated things < 1365991798 484922 :FreeFull!~freefull@defocus/sausage-lover PRIVMSG #esoteric :Finger trees are crazy < 1365991801 519753 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :edwardk has a good talk about finger trees < 1365991839 567445 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :i think the problem with finger trees is that they are boring < 1365991847 438746 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :they're so easy < 1365991847 971925 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :they are good at everything but they're never excitingly good at anything < 1365991856 193973 :FreeFull!~freefull@defocus/sausage-lover PRIVMSG #esoteric :elliott: Monads are boring and look at all the hype < 1365991864 310476 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric ::/ < 1365991889 907203 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :elliott: dunno I think the annotated ropes in trifecta or whatever are p. exciting < 1365991904 937986 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :well i mean like from an efficiency pov < 1365991909 135711 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :finger tree sequences of big unboxed chunks of text, annotated with source positions and what not < 1365992016 750669 :oerjan!oerjan@sprocket.nvg.ntnu.no PRIVMSG #esoteric :elliott: i was surprised to read that finger trees are more efficient than that pair of lists thing < 1365992046 214322 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :for zippers? < 1365992055 65501 :oerjan!oerjan@sprocket.nvg.ntnu.no PRIVMSG #esoteric :for queues < 1365992062 300701 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :ah < 1365992073 553369 :oerjan!oerjan@sprocket.nvg.ntnu.no PRIVMSG #esoteric :but basically for anything not efficient with a single list < 1365992157 332913 :Jafet!~Jafet@unaffiliated/jafet PRIVMSG #esoteric :elliott just can't stand the numbing genericity < 1365992170 532790 :oerjan!oerjan@sprocket.nvg.ntnu.no PRIVMSG #esoteric :which means that there's basically little reason to avoid Data.Sequence < 1365992219 69823 :oerjan!oerjan@sprocket.nvg.ntnu.no PRIVMSG #esoteric :once a single list doesn't fit < 1365992230 791089 :Sgeo!~Sgeo@ool-ad034ea6.dyn.optonline.net PRIVMSG #esoteric :I should learn what finger trees are < 1365992232 601076 :conehead!~conehead@unaffiliated/conehead JOIN :#esoteric < 1365992279 221728 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :Sgeo: http://apfelmus.nfshost.com/articles/monoid-fingertree.html < 1365992408 224772 :Sgeo!~Sgeo@ool-ad034ea6.dyn.optonline.net PRIVMSG #esoteric :apfelmus is pretty awesome < 1365992415 580877 :Sgeo!~Sgeo@ool-ad034ea6.dyn.optonline.net PRIVMSG #esoteric :I should read more of eir articles < 1365992473 818909 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :what's "apfelmus" mean < 1365992574 290885 :Sgeo!~Sgeo@ool-ad034ea6.dyn.optonline.net PRIVMSG #esoteric :what's "Bike" mean < 1365992584 989196 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :it's an abbreviation for "bicycle" < 1365992591 881772 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :so called because it has two cycling wheels < 1365992605 443118 :Gregor!codu@codu.org PRIVMSG #esoteric :Mother of God... < 1365992607 946160 :Sgeo!~Sgeo@ool-ad034ea6.dyn.optonline.net PRIVMSG #esoteric :what's "monqy" mean < 1365992613 768578 :Sgeo!~Sgeo@ool-ad034ea6.dyn.optonline.net PRIVMSG #esoteric :what's "Sgeo" mean < 1365992621 976448 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :`? monqy < 1365992626 547476 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :dunno about no sgeos, though. < 1365992628 237957 :HackEgo!codu@codu.org PRIVMSG #esoteric :The friendship monqy is an ancient Chinese mystery; ask itidus21 for details. < 1365992638 648557 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :haskell report says 'The results of exceptional conditions (such as overflow or underflow) on the fixed-precision numeric types are undefined; an implementation may choose error (_|_, semantically), a truncated value, or a special value such as infinity, indefinite, etc.' < 1365992643 630405 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :Gregor: did i just blow your mind < 1365992647 756727 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :does this allow actually Undefined Behavior in the C sense < 1365992652 778546 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :kmc: ieee floats are for suckas < 1365992653 432082 :Gregor!codu@codu.org PRIVMSG #esoteric :Bike: Yup. < 1365992660 252821 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :kmc: i think that's just implementation-defined behaviour < 1365992668 48823 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :breaking type safety, preceeding code optimized out, flying monkeys out of ass, etc < 1365992673 952738 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :yeah, I think so too < 1365992679 225387 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :Haskell Report is frustratingly vague sometimes < 1365992681 993229 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :kmc: that is very interesting though -- it means Int32 can contain a value representing infinity < 1365992684 795165 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :kmc: well it has a pretty simple list there though < 1365992686 13116 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :how weird is that < 1365992694 836113 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :truncation, bottom, a special < 1365992701 288704 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :Bike: "etc." < 1365992707 585454 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :"etc" < 1365992711 904569 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :pretty sure that's referring to the special values < 1365992718 265994 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :(language lawyer GO) < 1365992722 497752 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :ianal < 1365992772 424829 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :«(slang) A promiscuous woman; from “the town bike (everybody rides her)”.» btw this is me < 1365992778 704138 :Jafet!~Jafet@unaffiliated/jafet PRIVMSG #esoteric :I, anal < 1365992779 906696 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :^5 < 1365992789 693149 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :«(Scotland, Northern England) A nest of wasps or hornets.» wait no this one < 1365992804 373602 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :a promiscuous nest of wasps < 1365992813 175441 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :yes. that is me. < 1365992814 561442 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :perfect < 1365992817 854128 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :http://orangecounty.craigslist.org/zip/3739834928.html < 1365992819 529362 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :Gregor: what do you feel your optimal voiced status is right now < 1365992838 391500 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :That's weird though, I woulda thought "bike" would come up in that 18th-century Scottish insect biology book i read < 1365992874 64968 :Gregor!codu@codu.org PRIVMSG #esoteric :elliott: +½v < 1365992880 524100 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :Gregor: hmm < 1365992891 346034 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :Gregor: does that mean I should devoice you for a while and then turn it back on? < 1365992910 818362 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :Maybe you could find someone who's like the anti-gregor, but not entirely, and voice that personinstead of Gregor. < 1365992911 13077 :Jafet!~Jafet@unaffiliated/jafet PRIVMSG #esoteric :You could mute hackego < 1365992913 769471 :Phantom_Hoover!~phantomho@unaffiliated/phantom-hoover/x-3377486 PRIVMSG #esoteric :set it up so blah blah blah radioactive devoices him < 1365992924 641706 :Phantom_Hoover!~phantomho@unaffiliated/phantom-hoover/x-3377486 PRIVMSG #esoteric :then don't look at the user list for a while < 1365992931 680830 :conehead_!~conehead@unaffiliated/conehead JOIN :#esoteric < 1365992940 236243 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :kmc: gallons of bees. < 1365993010 215639 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :Bike: wouldn't that be -1v < 1365993019 907827 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :or something < 1365993023 358411 :Gregor!codu@codu.org PRIVMSG #esoteric :elliott: Well, how low-quality microwaves at half power level work is by rapidly toggling between fully on and fully off. < 1365993033 421709 :Koen__!~Koen@vbo91-6-78-245-243-132.fbx.proxad.net QUIT :Quit: The struct held his beloved integer in his strong, protecting arms, his eyes like sapphire orbs staring into her own. "W-will you... Will you union me?" < 1365993036 101674 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :Gregor: right but... we can't go too rapid < 1365993036 670357 :Gregor!codu@codu.org PRIVMSG #esoteric :So I think my +v status should be toggling, say... oh, fifty times a second? < 1365993037 124597 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :elliott: no he's not /entirely/ anti gregor < 1365993039 303561 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :it would be a bit spammy! < 1365993044 196406 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :wait i guess you'd need to keep gregor voiced too < 1365993046 739979 :Phantom_Hoover!~phantomho@unaffiliated/phantom-hoover/x-3377486 PRIVMSG #esoteric :voice someone who is half like gregor < 1365993048 530723 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :gosh this is hard < 1365993054 914867 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :hm < 1365993057 723894 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :who is kind of like gregor < 1365993059 625187 :conehead!~conehead@unaffiliated/conehead QUIT :Ping timeout: 252 seconds < 1365993060 134745 :conehead_!~conehead@unaffiliated/conehead NICK :conehead < 1365993062 761515 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :pikhq? < 1365993064 169930 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :conehead < 1365993071 289793 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :kmc < 1365993073 561040 :oerjan!oerjan@sprocket.nvg.ntnu.no PRIVMSG #esoteric : what's "apfelmus" mean <-- mashed apples hth < 1365993074 703246 :conehead!~conehead@unaffiliated/conehead PRIVMSG #esoteric :? < 1365993090 782429 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :pikhq works sure < 1365993095 226657 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :who's not at all like gregor < 1365993097 599124 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :how do you feel about being voiced, conehead < 1365993111 841292 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :elliott: listofoptions < 1365993115 970228 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :(wow, /names is weird) < 1365993122 634711 :conehead!~conehead@unaffiliated/conehead PRIVMSG #esoteric :I would find it incredibly strange < 1365993126 739577 :Gregor!codu@codu.org PRIVMSG #esoteric :I suggest jix. < 1365993126 934323 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :hm < 1365993130 522968 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :oh good idea < 1365993132 113427 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :elliott, Phantom_Hoover: here's case law regarding employers testing for 'intelligence': http://en.wikipedia.org/wiki/Griggs_v._Duke_Power_Co. < 1365993133 821650 :elliott!elliott@unaffiliated/elliott MODE #esoteric +v :jix > 1365993133 844846 NAMES :#esoteric < 1365993158 36470 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :yes, i feel peace and balance < 1365993169 781149 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :we can all breathe easy < 1365993172 464165 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :kmc: lol that quote. < 1365993188 250177 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :looks like it's a pretty narrow prohibition, only for 'artificial, arbitrary, and unnecessary barriers to employment when the barriers operate invidiously to discriminate on the basis of racial or other impermissible classification' < 1365993205 578481 :mnoqy!~okay@pool-98-108-206-66.snloca.dsl-w.verizon.net PRIVMSG #esoteric :`seen jix < 1365993208 624227 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :@wn invidiously < 1365993209 711866 :lambdabot!~lambdabot@li85-105.members.linode.com PRIVMSG #esoteric :*** "invidiously" wn "WordNet (r) 3.0 (2006)" < 1365993209 906760 :lambdabot!~lambdabot@li85-105.members.linode.com PRIVMSG #esoteric :invidiously < 1365993209 906935 :lambdabot!~lambdabot@li85-105.members.linode.com PRIVMSG #esoteric : adv 1: in a manner arousing resentment < 1365993211 590302 :HackEgo!codu@codu.org PRIVMSG #esoteric :not lately; try `seen jix ever < 1365993214 857195 :mnoqy!~okay@pool-98-108-206-66.snloca.dsl-w.verizon.net PRIVMSG #esoteric :`seen jix ever < 1365993226 346851 :HackEgo!codu@codu.org PRIVMSG #esoteric :2012-06-29 15:54:12: zzo38: but if you keep the addition and comparision instructions (maybe with an annotation to mark them as belonging together (if llvm does support this)) you wouldn't break existing passes < 1365993237 927685 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :kmc: probably it's not that common to bother administrating IQ tests < 1365993261 413826 :mnoqy!~okay@pool-98-108-206-66.snloca.dsl-w.verizon.net PRIVMSG #esoteric :2012? that's pretty long time ago. < 1365993290 297139 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :kmc: i actually like that majority opinion quite a bit < 1365993296 997936 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :it would be pretty amusing for someone to claim that e.g. algorithms / puzzle questions in programmer interviews are "artificial, arbitrary, and unnecessary" < 1365993320 188227 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :Arousing Resentment is definitely going to be the name of my next band < 1365993324 88333 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :«good intent or absence of discriminatory intent does not redeem employment procedures or testing mechanisms that operate as "built-in headwinds" for minority groups and are unrelated to measuring job capability» < 1365993324 773354 :Phantom_Hoover!~phantomho@unaffiliated/phantom-hoover/x-3377486 PRIVMSG #esoteric :but are they invidious < 1365993372 388582 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :i do think the traditional programming interview is hostile to some underrepresented groups < 1365993376 404982 :mnoqy!~okay@pool-98-108-206-66.snloca.dsl-w.verizon.net PRIVMSG #esoteric :how do you measure arbitrary < 1365993381 433151 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :not sure if a legal injunction is the right remedy < 1365993389 755749 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :mnoqy: in milliarbitrons < 1365993397 765677 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :probably a culture change < 1365993404 113146 :mnoqy!~okay@pool-98-108-206-66.snloca.dsl-w.verizon.net PRIVMSG #esoteric :probably a programming interview is hard with no hands or mouth < 1365993405 692021 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :maybe just get employers out of their own asses? < 1365993437 387842 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :iunno i'm unemployed why would i talk about this < 1365993462 513160 :Sgeo!~Sgeo@ool-ad034ea6.dyn.optonline.net PRIVMSG #esoteric :
ACTION thinks that "it's not what you know it's who you know" should really be fixed
< 1365993471 592866 :mnoqy!~okay@pool-98-108-206-66.snloca.dsl-w.verizon.net PRIVMSG #esoteric :is that a thing < 1365993476 924622 :mnoqy!~okay@pool-98-108-206-66.snloca.dsl-w.verizon.net PRIVMSG #esoteric :you're like a job expert now right < 1365993482 492317 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :it is < 1365993506 438158 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :oh it's definitely a thing. < 1365993510 358338 :Sgeo!~Sgeo@ool-ad034ea6.dyn.optonline.net PRIVMSG #esoteric :How many problems would go away if job interviews were conducted over a chat medium? < 1365993517 909195 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :why do you think you need to provide references? < 1365993519 479315 :Sgeo!~Sgeo@ool-ad034ea6.dyn.optonline.net PRIVMSG #esoteric :With no name but instead an identifier code < 1365993526 663900 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :i would like to proffer the controversial opinion that all of the ills of the world should be corrected, esp. as pertaining to globalised capitalism < 1365993531 573334 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :often some level is, but you really need to know if you can work with this person in person < 1365993537 804964 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :don't hate me for having unpopular opinions!!! < 1365993552 776711 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :elliott: do you have a newsletter i can subscribe to < 1365993565 794849 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :Bike: irc://irc.freenode.net/esoteric < 1365993574 294252 :mnoqy!~okay@pool-98-108-206-66.snloca.dsl-w.verizon.net PRIVMSG #esoteric :do you have a radio program < 1365993581 81314 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :Sgeo: of course that wouldn't fix the proble of people from some backgrounds not applying at all < 1365993603 356416 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :i considered making another connection to freenode but that would be a shitty joke. < 1365993605 150611 :Sgeo!~Sgeo@ool-ad034ea6.dyn.optonline.net PRIVMSG #esoteric :
ACTION ... has never thought of that
< 1365993614 229347 :mnoqy!~okay@pool-98-108-206-66.snloca.dsl-w.verizon.net PRIVMSG #esoteric :advertize it as being a fun time for everyone? see everything has a solution < 1365993621 750963 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :Sgeo: i bet CableVision doesn't get a lot of nicaraguan applicants, you know? < 1365993626 816834 :mnoqy!~okay@pool-98-108-206-66.snloca.dsl-w.verizon.net PRIVMSG #esoteric :you can make, like, a mural < 1365993630 850275 :Sgeo!~Sgeo@ool-ad034ea6.dyn.optonline.net PRIVMSG #esoteric :Just of eliminating subconsious discrimination during the interview process < 1365993633 34023 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :chat is also not necessarily better for everyone < 1365993633 746590 :mnoqy!~okay@pool-98-108-206-66.snloca.dsl-w.verizon.net PRIVMSG #esoteric :representing people of every minority group < 1365993646 936711 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :just as in-person interviews with a white board are not necessarily good for everyone < 1365993650 280668 :mnoqy!~okay@pool-98-108-206-66.snloca.dsl-w.verizon.net PRIVMSG #esoteric :and in rainbow letters you can say < 1365993650 900010 :mnoqy!~okay@pool-98-108-206-66.snloca.dsl-w.verizon.net PRIVMSG #esoteric :like < 1365993654 95449 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :`rainbow DIVERSITY < 1365993667 32017 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :i have no idea how hackego works. srry < 1365993668 734079 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :Bike: re hostile to some groups, I think one problem is that programming jobs are typically advertised as "ARE YOU THE BADDEST MOTHERFUCKING HAXOR OF ALL TIME?!? WELL PROVE IT!" and this is a huge turn-off to anyone who's already dealing with impostor syndrome due to membership in a underrepresented group < 1365993678 92650 :mnoqy!~okay@pool-98-108-206-66.snloca.dsl-w.verizon.net PRIVMSG #esoteric :"it doesn't matter if you're weird. we love everyone." < 1365993682 29547 :Sgeo!~Sgeo@ool-ad034ea6.dyn.optonline.net PRIVMSG #esoteric :elliott, hmm. Was thinkng too that maybe some sort of intermediary. So that broken English, if it is still understandable, is not discriminated against < 1365993685 37811 :HackEgo!codu@codu.org PRIVMSG #esoteric :No output. < 1365993690 797069 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :kmc: ha, ha, twenty somethings? < 1365993700 29068 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :`run echo diversity | rainbow < 1365993701 957804 :HackEgo!codu@codu.org PRIVMSG #esoteric :​1303d04i13v07e12r12s12i04t02y07 < 1365993706 818245 :mnoqy!~okay@pool-98-108-206-66.snloca.dsl-w.verizon.net PRIVMSG #esoteric :peopl;e can type perfectly broken just look at anyone ever who types broken < 1365993711 78283 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :that's pretty blue, hackego. < 1365993715 666949 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :Sgeo: do you have a perfectly spherical cow to go with your unbiased, incorruptible intermediary :P < 1365993717 371791 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :so the remedy there is both fixing the culture to remove this dumb marketing, but also fixing the educational pipeline so that confidence is more fairly distributed < 1365993751 521705 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :Sgeo: i hope you don't need to be told how negative non-prestige English can be seen, no matter how understandable < 1365993757 83191 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :kmc: i'm the baddest motherfucking haxor of all time. god damn i am bad at hacking. please hire me for sucking < 1365993782 232228 :Sgeo!~Sgeo@ool-ad034ea6.dyn.optonline.net PRIVMSG #esoteric :Bike, hence a person in between who fixes non-prestige English into prestige English < 1365993790 110490 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :that < 1365993790 305687 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :"fixes" < 1365993792 476778 :Phantom_Hoover!~phantomho@unaffiliated/phantom-hoover/x-3377486 PRIVMSG #esoteric :i feel like impostor system is symptomatic of a bunch of broader cultural factors than just general equality < 1365993793 330845 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :this is one reason why i <3 OpenHatch, they organize a lot of events that are about helping new people contribute to open source, in a super welcoming environment < 1365993794 180588 :mnoqy!~okay@pool-98-108-206-66.snloca.dsl-w.verizon.net PRIVMSG #esoteric :but if it's not marketed for rockstars & ninjas who will we get off on making fun of < 1365993798 127950 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :https://openhatch.org/ < 1365993799 829586 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :good people < 1365993802 882724 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :wow that's just a weird thing there, i don't even know how to respond to that. < 1365993806 576023 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :anyway i repeat my previous line < 1365993807 163813 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :you should all donate and get the baby penguin shirt < 1365993811 976266 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :mnoqy: imo The Masses < 1365993829 158615 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :(fuckers the lot) < 1365993832 860771 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :shachaf: you should send Sgeo that story < 1365993834 6096 :mnoqy!~okay@pool-98-108-206-66.snloca.dsl-w.verizon.net PRIVMSG #esoteric :hm, you may be onto something < 1365993834 395392 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :a perfectly impartial white-person-ifier to go in the middle is... not what i would call a solution < 1365993850 164299 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :especially since it's not as if all problems are going to magically go away post-interview < 1365993852 93833 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :imo just wear whiteface to job interviews, problem solved right < 1365993881 96111 :mnoqy!~okay@pool-98-108-206-66.snloca.dsl-w.verizon.net PRIVMSG #esoteric :send in a robot to interview for you. robots can sound white right < 1365993891 461691 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :wow that would be depressing. also i suppose it's sort of the norm, for certain values of "whiteface" < 1365993894 559504 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :stuff white robots like < 1365993905 642370 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :(btw stuff white people like is super racist, which sucks because it's funny :/) < 1365993918 178318 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :there's this tumblr blog "nasty shit white people eat" < 1365993928 326462 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :and i've seen at least four posts that are native Mexican or whatever < 1365993945 13013 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :fighting the good fight < 1365993962 374339 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :(i'm not sure if i'd eat burritos with mashed potatoes in them unprompted, though) < 1365993975 960877 :mnoqy!~okay@pool-98-108-206-66.snloca.dsl-w.verizon.net PRIVMSG #esoteric :internet wars about whether racism against whites is racism are pretty pathetic, imo < 1365993999 634247 :Sgeo!~Sgeo@ool-ad034ea6.dyn.optonline.net PRIVMSG #esoteric :kmc, what story? < 1365994009 827657 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :i don't have the link < 1365994016 891155 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :mnoqy: it's not that it's racist against whites < 1365994029 570185 :mnoqy!~okay@pool-98-108-206-66.snloca.dsl-w.verizon.net PRIVMSG #esoteric :racism against everyone else too < 1365994031 380989 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :it's that it's implicitly racist against non-whites by claiming that reading and culture and such are white things < 1365994034 10382 :mnoqy!~okay@pool-98-108-206-66.snloca.dsl-w.verizon.net PRIVMSG #esoteric :racism in the large < 1365994046 129724 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :kmc: oh my. < 1365994048 725112 :mnoqy!~okay@pool-98-108-206-66.snloca.dsl-w.verizon.net PRIVMSG #esoteric :oh is it one of those blogs < 1365994054 668038 :mnoqy!~okay@pool-98-108-206-66.snloca.dsl-w.verizon.net PRIVMSG #esoteric :see i was expecting it to be like < 1365994062 657148 :mnoqy!~okay@pool-98-108-206-66.snloca.dsl-w.verizon.net PRIVMSG #esoteric :(stuff white people like) picture of idk something gross < 1365994083 618400 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :its a "arent we white people so funny" thing < 1365994084 866462 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :it's really "stuff upper middle class urbanites like" < 1365994090 934239 :mnoqy!~okay@pool-98-108-206-66.snloca.dsl-w.verizon.net PRIVMSG #esoteric :ah < 1365994099 928804 :mnoqy!~okay@pool-98-108-206-66.snloca.dsl-w.verizon.net PRIVMSG #esoteric :isn't that "classist" though < 1365994103 775057 :mnoqy!~okay@pool-98-108-206-66.snloca.dsl-w.verizon.net PRIVMSG #esoteric :heh heh words < 1365994104 882534 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :prolly < 1365994109 598174 :Phantom_Hoover!~phantomho@unaffiliated/phantom-hoover/x-3377486 PRIVMSG #esoteric :no mnoqy < 1365994112 664648 :Phantom_Hoover!~phantomho@unaffiliated/phantom-hoover/x-3377486 PRIVMSG #esoteric :it's social racist < 1365994112 858821 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :can't it just be shitty. it's shitty how about that < 1365994116 347343 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :lol. < 1365994123 257168 :Sgeo!~Sgeo@ool-ad034ea6.dyn.optonline.net PRIVMSG #esoteric :Short of... some sort of panel doing interviews instead of a single person... actually, maybe that's a good idea? < 1365994127 545342 :Phantom_Hoover!~phantomho@unaffiliated/phantom-hoover/x-3377486 QUIT :Remote host closed the connection < 1365994136 529286 :doesthiswork!~Adium@75.87.251.5 PRIVMSG #esoteric :does anyone know why white people smell like dogs when they get wet? google doesn't help me here < 1365994136 723353 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :Sgeo: i believe that's the procedure for grad school < 1365994139 868820 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :"that works well, right" < 1365994153 916305 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :Sgeo: i don't really get this sole focus on the interview process < 1365994154 444324 :mnoqy!~okay@pool-98-108-206-66.snloca.dsl-w.verizon.net PRIVMSG #esoteric :doesthiswork: chemistry and also biology, probably < 1365994183 447538 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :doesthiswork: it's an adaptation of our savannah ancestors to drive off predators < 1365994187 446711 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :Gregor: maybe de-voice jix by now? do you think it's been long enough < 1365994200 890015 :doesthiswork!~Adium@75.87.251.5 PRIVMSG #esoteric :Bike: thank you, now I know < 1365994214 467717 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :anyway the culture thing reminds me that the "[x] people lack history" is probably the racist thing that most infuriates me (as a white person this is an important opinion to have etc etc) < 1365994226 832438 :FreeFull!~freefull@defocus/sausage-lover PRIVMSG #esoteric :Seems TChan was what I wanted all along anyway < 1365994238 653929 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :FreeFull: good choice < 1365994244 390664 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :if you want a mutable channel for use inside STM < 1365994259 303889 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :if you're not using STM then there's plain Chan < 1365994279 281815 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :if you find that every line is (atomically $ somePrimitiveTChanOperation) then consider using plain Chan < 1365994280 166150 :FreeFull!~freefull@defocus/sausage-lover PRIVMSG #esoteric :I am using STM < 1365994283 296357 :mnoqy!~okay@pool-98-108-206-66.snloca.dsl-w.verizon.net PRIVMSG #esoteric :Bike: do people say that < 1365994284 735705 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :ok cool beans < 1365994321 752750 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :mnoqy: back in the colonial days it was pretty common of europeans to claim that africa had been basically the same for thousands of years and had had nothing worth writing down < 1365994330 985871 :doesthiswork!~Adium@75.87.251.5 PRIVMSG #esoteric :I'm sure I'm not the first to say this but sinfest just isn't funny anymore < 1365994337 293274 :mnoqy!~okay@pool-98-108-206-66.snloca.dsl-w.verizon.net PRIVMSG #esoteric :what's sinfest < 1365994359 273897 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :A webcomic about a webcomic author struggling to deal with his past transgressions < 1365994360 593457 :doesthiswork!~Adium@75.87.251.5 PRIVMSG #esoteric :http://www.sinfest.net/archive_page.php?comicID=1] < 1365994370 612614 :doesthiswork!~Adium@75.87.251.5 PRIVMSG #esoteric :http://www.sinfest.net/archive_page.php?comicID=1 < 1365994398 893676 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :thanks for... offering your opinion < 1365994402 846066 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :i think? < 1365994403 40373 :mnoqy!~okay@pool-98-108-206-66.snloca.dsl-w.verizon.net PRIVMSG #esoteric :when does it get funny < 1365994410 756681 :FreeFull!~freefull@defocus/sausage-lover PRIVMSG #esoteric :doesthiswork: When was sinfest funny? < 1365994418 962042 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :mnoqy: 17 < 1365994419 577172 :mnoqy!~okay@pool-98-108-206-66.snloca.dsl-w.verizon.net PRIVMSG #esoteric :where does "sinfest" appear < 1365994422 56146 :doesthiswork!~Adium@75.87.251.5 PRIVMSG #esoteric :the first few are pretty funny < 1365994422 723437 :mnoqy!~okay@pool-98-108-206-66.snloca.dsl-w.verizon.net PRIVMSG #esoteric :Bike: thanks < 1365994459 868905 :mnoqy!~okay@pool-98-108-206-66.snloca.dsl-w.verizon.net PRIVMSG #esoteric :Bike: that wasn't funny < 1365994467 636930 :mnoqy!~okay@pool-98-108-206-66.snloca.dsl-w.verizon.net PRIVMSG #esoteric :were you pulling a joke on me < 1365994474 500520 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :Yes. < 1365994476 844842 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :LOL < 1365994479 945861 :mnoqy!~okay@pool-98-108-206-66.snloca.dsl-w.verizon.net PRIVMSG #esoteric :dang it!!! < 1365994494 373155 :doesthiswork!~Adium@75.87.251.5 PRIVMSG #esoteric :bike: achebe reported an anecdote indicating that the english people still don't think africa has history. < 1365994522 739030 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :doesthiswork: yeah it's definitely still around, it was just more explicit back then (as usual with racism, i guess) < 1365994530 244176 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :as Bike pointed out, many wikipedia history articles are like "natives lived here for thousands of years AND THEN WHITE PEOPLE SHOWED UP " < 1365994532 287918 :mnoqy!~okay@pool-98-108-206-66.snloca.dsl-w.verizon.net PRIVMSG #esoteric :so are we racisting about "these people are racist" now < 1365994550 237446 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :what < 1365994551 932205 :mnoqy!~okay@pool-98-108-206-66.snloca.dsl-w.verizon.net PRIVMSG #esoteric :"we" as a humanity < 1365994560 70601 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :racisting all night long, baby. < 1365994567 247014 :doesthiswork!~Adium@75.87.251.5 PRIVMSG #esoteric :I've always been racist about those people < 1365994579 697736 :mnoqy!~okay@pool-98-108-206-66.snloca.dsl-w.verizon.net PRIVMSG #esoteric :and "people" as in like singular of "peoples" < 1365994599 446549 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :yeah i have no idea what you're saying monqy, srry < 1365994608 263548 :mnoqy!~okay@pool-98-108-206-66.snloca.dsl-w.verizon.net PRIVMSG #esoteric ::(' < 1365994649 644108 :doesthiswork!~Adium@75.87.251.5 PRIVMSG #esoteric :according the strunk the proper plural of person is persons < 1365994654 184686 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :@tell taneb you like english right http://25.media.tumblr.com/341dfc90a788592e8634c9942b186d42/tumblr_ml9yj4I2aA1qhcj5zo1_500.gif < 1365994654 612733 :lambdabot!~lambdabot@li85-105.members.linode.com PRIVMSG #esoteric :Consider it noted. < 1365994684 572456 :mnoqy!~okay@pool-98-108-206-66.snloca.dsl-w.verizon.net PRIVMSG #esoteric :what does that have to do with english < 1365994693 186333 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :his name is english. < 1365994693 806448 :doesthiswork!~Adium@75.87.251.5 PRIVMSG #esoteric :lord english maybe? < 1365994695 356993 :mnoqy!~okay@pool-98-108-206-66.snloca.dsl-w.verizon.net PRIVMSG #esoteric :cute wiggle though < 1365994738 813833 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :"Rollership/ The revolutionary way/ evolution/ magazine empire /pirate radio/ television channel/ gallery/ encyclopedia/ library/ The Utopians Guide to the Galaxy/ encyclopedia kosmica/ sonic screwdriver of knowledge...about 10,700entries." < 1365994762 940999 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :put down the bong Bike < 1365994791 434680 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :holy shit this blog has a hit counter < 1365994809 600224 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric : holy shit this bong has a hit counter < 1365994821 409659 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :it's so high < 1365994853 33235 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :https://twitter.com/OTPGlobal/status/266077784974163968/photo/1/large i've hit the jackpot here < 1365994869 474858 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :i wrote a quick post about some leaked diplomatic cables from ulaanbaatar and now i am stoned as hell < 1365994898 178940 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :what < 1365994906 19963 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :stupid future < 1365994924 351253 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :they're even against water fluoridation < 1365994927 692026 :mnoqy!~okay@pool-98-108-206-66.snloca.dsl-w.verizon.net PRIVMSG #esoteric :Bike: what a picture < 1365994942 588529 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :http://25.media.tumblr.com/b60cae94c4bd65d1f61e7b8a21e60915/tumblr_ml8tlzyv3D1qkwdrko1_1280.jpg wake up sheeple < 1365995081 912736 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :i like how the swastika is on top of hitler < 1365995091 253010 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :thus combining the potent comparisons of nazism, and nazism < 1365995121 58618 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :well what if you didn't recognize him. it could be any old guy. but nope with this it's BAM nazifella < 1365995142 838501 :mnoqy!~okay@pool-98-108-206-66.snloca.dsl-w.verizon.net PRIVMSG #esoteric :double nazism just to be sure < 1365995192 840959 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :oh yeah the anti-flouride person who posted to the noisebridge list claimed that ALCOA was a subsidiary of I.G. Farben < 1365995201 47557 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :which would be... remarkable < 1365995218 720598 :Sgeo!~Sgeo@ool-ad034ea6.dyn.optonline.net PRIVMSG #esoteric :I don't know what either of those things is < 1365995225 134543 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :me neither < 1365995236 758417 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :Alcoa is a big aluminum company in the US < 1365995250 146471 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :this person had another post that said that now your potatoes could be handled by people wearing protective gear whether you like it or not which obviously tops anything else so i stopped < 1365995256 14123 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :do americans really pronounce aluminium as aloominum < 1365995266 100401 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :like i know they do in bugs bunny cartoons < 1365995269 141050 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :but like in real life? < 1365995275 702569 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :we do. < 1365995285 158555 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :goddamn. < 1365995286 145237 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :well, i do, and i am america < 1365995286 339900 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :I.G. Farben was a German chemical conglomorate that was involved in numerous crimes against humanity during the Third Reich and was disbanded by the allied occupation govt (we used their big headquarters building as the occupation hq) < 1365995302 96190 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :but i spell it "aluminium" because that's the IUPAC recommendation < 1365995307 292070 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :i'm just a shitfucker, i think < 1365995316 743429 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :kmc: i like the idea that they were disbanded just so the building could be used < 1365995319 825700 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :"alright, out" < 1365995323 936984 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :they had a bunch of chemical plants using slave labour (one down the road from Auschwitz-Birkenau) < 1365995347 248471 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :also they manufactured zyklon b < 1365995384 964931 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :I think it's "interesting" how there are like japanese health companies founded by unit 731 members, though < 1365995390 86920 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :;_; < 1365995429 252329 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :also some of the Americans who testified at the Nuremberg Trials ended up running parts of MKULTRA and other unethical human experimentation programs < 1365995472 152983 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :victors' justice :/ < 1365995564 929670 :Sgeo!~Sgeo@ool-ad034ea6.dyn.optonline.net PRIVMSG #esoteric :https://soundcloud.com/eutechnik/dialup < 1365995603 784198 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :Sgeo: http://windytan.blogspot.com/2012/11/the-sound-of-dialup-pictured.html < 1365995634 835878 :Sgeo!~Sgeo@ool-ad034ea6.dyn.optonline.net PRIVMSG #esoteric :Listen to my link anyway >.> < 1365995638 306152 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :i did < 1365995728 527052 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :dyuu dyuuty, NRRRRRRR < 1365995778 598311 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :but i don't want to do my duty bike < 1365995805 180503 :FreeFull!~freefull@defocus/sausage-lover PRIVMSG #esoteric :If I have a transaction where I have modifyTVar count (subtract 1) followed by a blocking call, and other transactions depend on count being larger than 0, should I block before the modifyTVar or will I not get in trouble and the transaction will retry? < 1365995829 496505 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :the whole transaction happens atomically < 1365995839 820950 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :it's impossible for code outside that transaction to observe the intermediate state < 1365995849 765325 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :what do you mean by 'blocking call' though < 1365995851 384978 :FreeFull!~freefull@defocus/sausage-lover PRIVMSG #esoteric :The blocking only occurs if count is 0 < 1365995878 993507 :FreeFull!~freefull@defocus/sausage-lover PRIVMSG #esoteric :kmc: The thread stops doing anything until something is put in a TChan < 1365995889 457982 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :that's fine though < 1365995890 468256 :FreeFull!~freefull@defocus/sausage-lover PRIVMSG #esoteric :And count is incremented too < 1365995905 361876 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :like i said, other code can't observe the intermediate state < 1365995918 693545 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :you can think of it like, if it reaches that point and finds the TChan is empty, it aborts the transaction and retries from the beginning < 1365995920 360946 :copumpkin!~copumpkin@unaffiliated/copumpkin PRIVMSG #esoteric :kmc: think you'll ever come back to haskell-land? < 1365995924 421535 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :except it's more efficient than that < 1365995928 305297 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :copumpkin: dunno < 1365995950 992529 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :FreeFull: and I'm not sure if this kind of operational thinking is useful, or if one should just take the guarantees of 'atomically' as given < 1365995952 290253 :Sgeo!~Sgeo@ool-ad034ea6.dyn.optonline.net PRIVMSG #esoteric :Why, what is kmc doing? < 1365995962 22351 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :Sgeo: I haven't done much haskelly stuff lately < 1365995963 666164 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :talking about haskell outside of #haskell? < 1365995970 460592 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :i'm probably not returning to #haskell unless it's changed a lot < 1365995971 660331 :FreeFull!~freefull@defocus/sausage-lover PRIVMSG #esoteric :kmc: Ah, so it retries once the TChan has something, assuming another transaction doesn't make the TChan empty again < 1365995991 508801 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :not that it's necessarily horrible and nobody should go there, but, i've put in my time :) < 1365996009 575680 :FreeFull!~freefull@defocus/sausage-lover PRIVMSG #esoteric :So I should just learn not to worry < 1365996027 652629 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :yeah, the beauty of STM :) < 1365996030 923071 :FreeFull!~freefull@defocus/sausage-lover PRIVMSG #esoteric :and check (c > 0) is unnecessary < 1365996038 325671 :FreeFull!~freefull@defocus/sausage-lover PRIVMSG #esoteric :I mean count < 1365996051 762318 :Sgeo!~Sgeo@ool-ad034ea6.dyn.optonline.net PRIVMSG #esoteric :kmc, what do you think about School of Haskell> < 1365996052 925775 :Sgeo!~Sgeo@ool-ad034ea6.dyn.optonline.net PRIVMSG #esoteric :? < 1365996054 982429 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :kmc: i think #haskell is on the road to recovery a bit < 1365996069 274297 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :FreeFull: if it helps you can look at the implementation of TChan in terms of TVars: http://lambda.haskell.org/hp-tmp/docs/2011.2.0.0/packages/stm-2.2.0.1/doc/html/src/Control-Concurrent-STM-TChan.html < 1365996069 468377 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :or at least I'd like to think it is and try to make it so < 1365996073 622813 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :'might not help tho' < 1365996075 175822 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :elliott: how so? < 1365996123 632455 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :well, my impression is that some of the common problems are recognised better and that there are people sick enough of them to try and shut them down when they appear. also, there are more active ops now < 1365996130 742290 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :cool < 1365996136 733022 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :it can still be pretty awful mind :P < 1365996136 927437 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :also you're an op < 1365996146 179808 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :yes, as I said, it can still be pretty awful < 1365996150 465762 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :elliott rules with an iron fist < 1365996169 791080 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :/cs clear users < 1365996173 847445 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :i've restrained myself from kicking like five people!! < 1365996176 356046 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :i am a zen master < 1365996186 982562 :mnoqy!~okay@pool-98-108-206-66.snloca.dsl-w.verizon.net PRIVMSG #esoteric :how many of them are cheater < 1365996206 190910 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :i said people, not nicks < 1365996233 346773 :mnoqy!~okay@pool-98-108-206-66.snloca.dsl-w.verizon.net PRIVMSG #esoteric :how many of them are the people behind cheater < 1365996237 35992 :FreeFull!~freefull@defocus/sausage-lover PRIVMSG #esoteric :kmc: Hmm, I didn't expect TVarList < 1365996281 167444 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :it's the same deal as plain chan I think: http://lambda.haskell.org/hp-tmp/docs/2011.2.0.0/ghc-doc/libraries/base-4.3.1.0/src/Control-Concurrent-Chan.html < 1365996294 228306 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :two 'pointers' into a linked list of vars < 1365996302 139340 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :one for reading, one for writing < 1365996345 577666 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :by 'linked list of vars' i mean data ChItem a = ChItem a (MVar (ChItem a)) < 1365996395 833029 :FreeFull!~freefull@defocus/sausage-lover PRIVMSG #esoteric :I guess it's more efficient < 1365996412 928005 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :than what? < 1365996435 766363 :FreeFull!~freefull@defocus/sausage-lover PRIVMSG #esoteric :two TVars of normal lists < 1365996451 799988 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :mm < 1365996456 959722 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :and it gives you the blocking behavior you need < 1365996462 141125 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :where reads from an empty queue block < 1365996493 565290 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :it's not always more efficient though... I know Simon Marlow profiled a bunch of different data structures for the GHC IO manager and found that an IORef holding a pure data structure was best < 1365996506 829026 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :partly due to the fact that atomicModifyIORef is a lockless pointer swap < 1365996522 517185 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :that's also why you can't really have a strict atomicModifyIORef < 1365996581 376233 :FreeFull!~freefull@defocus/sausage-lover PRIVMSG #esoteric :You could make the blocking behaviour explicit in readTChan anyway < 1365996586 53636 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :probably, yeah < 1365996601 713578 :FreeFull!~freefull@defocus/sausage-lover PRIVMSG #esoteric :It does have TNil -> retry < 1365996603 190715 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :it's easy in STM because you can just 'retry' whenever < 1365996604 702477 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :yeah < 1365996608 94300 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :it's harder for plain Chan i think < 1365996615 346281 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :is today americans doing their taxes day < 1365996619 40489 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :yep < 1365996620 425072 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :there seems to be a lot of that going on < 1365996628 464860 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :what's a tax. what's a taxes < 1365996638 544486 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :it has to be in the mail by the end of Monday < 1365996641 723628 :Fiora!~Fiora@ec2-50-17-93-47.compute-1.amazonaws.com PRIVMSG #esoteric :I finished my taxes today yay < 1365996647 585541 :Fiora!~Fiora@ec2-50-17-93-47.compute-1.amazonaws.com PRIVMSG #esoteric :I am an adult < 1365996649 152306 :Fiora!~Fiora@ec2-50-17-93-47.compute-1.amazonaws.com PRIVMSG #esoteric :I swear < 1365996659 187624 :FreeFull!~freefull@defocus/sausage-lover PRIVMSG #esoteric :kmc: Don't MVars have blocking behaviour too < 1365996671 642370 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :yes < 1365996675 713060 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :Fiora++ < 1365996690 375385 :FreeFull!~freefull@defocus/sausage-lover PRIVMSG #esoteric :Seems to be what Chan relies on < 1365996719 546375 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :i don't even know what doing taxes entails < 1365996724 823601 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :except for lots of forms and presumably being bored < 1365996729 323172 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :i am innocent and pure < 1365996736 920457 :FreeFull!~freefull@defocus/sausage-lover PRIVMSG #esoteric :I think I actually finished writing the code a while ago < 1365996741 885156 :FreeFull!~freefull@defocus/sausage-lover PRIVMSG #esoteric :Let's see what ghci thinks < 1365996793 407720 :FreeFull!~freefull@defocus/sausage-lover PRIVMSG #esoteric :Had one error < 1365996859 535706 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :elliott: it involves ticking a lot of boxes for random crap < 1365996860 892280 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :No, I did not renovate a septic system last year. No, I did not invent any medical devices. No, I did not donate more than 30% of my adjusted gross income to a cemetery. < 1365996872 132375 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :man I did ALL those things < 1365996896 748246 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :come to america then < 1365996898 497600 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :we like your kind < 1365996916 339700 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :imo i don't like your kind < 1365996925 410669 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric ::< < 1365996936 107286 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :@elliott < 1365996936 312720 :lambdabot!~lambdabot@li85-105.members.linode.com PRIVMSG #esoteric :Unknown command, try @list < 1365996938 223095 :Sgeo!~Sgeo@ool-ad034ea6.dyn.optonline.net PRIVMSG #esoteric :* sucks, * -> * is better < 1365996963 885899 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :oh i get it < 1365996965 966377 :FreeFull!~freefull@defocus/sausage-lover PRIVMSG #esoteric :Making new TChans and stuff somehow makes me uneasy inside, despite knowing the garbage collector will get rid of anything once it's inaccessible < 1365996969 348715 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :by your kind i mean generalised america i think < 1365996972 249223 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :MAKING A STATEMENT < 1365996973 769687 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :imo ?? < 1365996980 658854 :FreeFull!~freefull@defocus/sausage-lover PRIVMSG #esoteric :I blame being used to C memory alloc =P < 1365997017 166746 :FreeFull!~freefull@defocus/sausage-lover PRIVMSG #esoteric :My brain just goes "Ooh, I'm making a new thing, gotta free it once I'm done" < 1365997023 994882 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :yeah :/ < 1365997094 115311 :FreeFull!~freefull@defocus/sausage-lover PRIVMSG #esoteric :Ok, hit only one problem =P < 1365997097 372408 :FreeFull!~freefull@defocus/sausage-lover PRIVMSG #esoteric :Forgot to increment count < 1365997127 28300 :FreeFull!~freefull@defocus/sausage-lover PRIVMSG #esoteric :Testing code always a good idea < 1365997128 427042 :oerjan!oerjan@sprocket.nvg.ntnu.no PRIVMSG #esoteric :you need to put count in the type system hth < 1365997137 202625 :oerjan!oerjan@sprocket.nvg.ntnu.no PRIVMSG #esoteric :
ACTION runs away
< 1365997144 556607 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :Fiora: just got confirmation that the carry flag is used in the sbcl runtime for marking multiple values < 1365997159 81090 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :Bike talked to the sbcl officials < 1365997174 648727 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :oerjan: how will gregor's voice be maintained if my connection drops???? < 1365997190 658606 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :just talked to the "wtf is going on" officials < 1365997194 521088 :oerjan!oerjan@sprocket.nvg.ntnu.no PRIVMSG #esoteric :elliott: poorly. < 1365997197 304164 :FreeFull!~freefull@defocus/sausage-lover PRIVMSG #esoteric :Perfect, now it works < 1365997203 728270 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :oerjan: IMO this is unacceptable < 1365997236 244299 :FreeFull!~freefull@defocus/sausage-lover PRIVMSG #esoteric :oerjan: I wonder how a type system would interact with STM < 1365997244 1196 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :I'm forced to agree with elliott, the voice status of that greg guy is fucking paramount < 1365997256 298916 :FreeFull!~freefull@defocus/sausage-lover PRIVMSG #esoteric :Anyway, my code works now < 1365997330 815459 :oerjan!oerjan@sprocket.nvg.ntnu.no PRIVMSG #esoteric :FreeFull: it was hafajoke, although i'm not sure it's impossible < 1365997338 773725 :coppro!raedford@taurine.csclub.uwaterloo.ca PRIVMSG #esoteric :who is greg < 1365997341 592729 :coppro!raedford@taurine.csclub.uwaterloo.ca PRIVMSG #esoteric :and why doesn't he have voice < 1365997350 348025 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :THE PEOPLE WANT TO KNOW OERJAN < 1365997353 303216 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :http://i.minus.com/ikfmGW73AeBn0.gif this is greg < 1365997354 208173 :FreeFull!~freefull@defocus/sausage-lover PRIVMSG #esoteric :oerjan: I would try it if I was working in idris right now < 1365997363 933295 :FreeFull!~freefull@defocus/sausage-lover PRIVMSG #esoteric :http://dpaste.org/myaGO/ What I was working on < 1365997374 121491 :FreeFull!~freefull@defocus/sausage-lover PRIVMSG #esoteric :Exercise from some pdf on the web < 1365997417 903757 :ChanServ!ChanServ@services. MODE #esoteric -o :elliott > 1365997417 925813 NAMES :#esoteric < 1365997458 735845 :oerjan!oerjan@sprocket.nvg.ntnu.no PRIVMSG #esoteric :elliott: FIXED < 1365997545 418865 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :oerjan: no, this is awful. i was trying to maintain +½v harmony. < 1365997552 348182 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :now the lack of oscillation capability results in +2v. < 1365997561 801607 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :this solution was approved by Gregor himself < 1365997564 963418 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :no i like this < 1365997569 148601 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :jix should just be voiced forever < 1365997578 565174 :oerjan!oerjan@sprocket.nvg.ntnu.no PRIVMSG #esoteric :elliott: /msg chanserv access list #esoteric hth < 1365997597 436484 :oerjan!oerjan@sprocket.nvg.ntnu.no PRIVMSG #esoteric :(without the hth) < 1365997599 898907 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :oh man < 1365997604 370209 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :your beautiful < 1365997607 113226 :ChanServ!ChanServ@services. MODE #esoteric -v :jix > 1365997607 135049 NAMES :#esoteric < 1365997627 97003 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :what < 1365997629 369837 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :elliott no < 1365997630 373398 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :NO < 1365997637 527512 :ChanServ!ChanServ@services. MODE #esoteric +v :Bike > 1365997637 549918 NAMES :#esoteric < 1365997647 208456 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :fuck < 1365997655 658841 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :oerjan: i find this method of enforcing universal balance worryingly indirect. i may have to take drastic measures and make you a wiki admin. < 1365997687 236443 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :man i love places with different power distributions in related places < 1365997714 248324 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :that is a strangely abstract statement < 1365997723 699846 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :well < 1365997736 402470 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :are you referring to the fact that the Northeast Corridor uses 60 Hz power north of the Hell Gate Bridge and 25 Hz power south of it? < 1365997739 731897 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :like on another channel i've been forbidden from ever having ops, but i have mod status on a channel site < 1365997744 681995 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :yes that's what i meant < 1365997748 57542 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :wtf is Hell Gate. < 1365997754 381629 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :http://en.wikipedia.org/wiki/Hell_Gate_Bridge < 1365997756 906179 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :it's a gate < 1365997757 669211 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :to hell < 1365997766 943541 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :it's a narrow tidal strait in the East River in New York City in the United States < 1365997772 434986 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :uh it says bridge right there < 1365997776 396631 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :oh, is it shitty to navigate? < 1365997779 420581 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :yeah < 1365997786 565613 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :'The name "Hell Gate" is a corruption of the Dutch phrase Hellegat, which could mean either "hell's hole" or "bright gate/passage"' < 1365997794 328296 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :slightly ambiguous < 1365997795 372181 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :i love dutch. < 1365997817 152758 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :The bridge would be the last New York City bridge to collapse if humans disappeared, taking at least a millennium to do so, according to the February 2005 issue of Discover magazine. Most other bridges would fall in about 300 years.[6] < 1365997824 519224 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :In 1851 the U.S. Army Corps of Engineers began to clear obstacles from the strait with explosives; the process would last seventy years < 1365997827 872950 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :that must be fun to watch < 1365997842 43484 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :weakass bridges < 1365997915 239259 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :[.. CSX ..] < 1365997921 904860 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :hm what do you do if you want to set a temporary ban for join/quit spam < 1365997926 509884 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :but are afraid you'll forget to remove it < 1365997936 7618 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :use a client that doesn't suck hth < 1365997941 853304 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :i use irssi < 1365997943 165620 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :sorry i failed < 1365997983 11400 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :elliott: /knockout? < 1365998010 323927 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :whoah. < 1365998023 267435 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :is there a way to do it without the kick < 1365998026 420368 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :kicks are so hostile. < 1365998046 565672 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :uhhhhh probably but i don't know it < 1365998058 782694 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :refer to previous comment about being forbbiden from ops < 1365998101 960891 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :knockout gas < 1365998113 169939 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :okay well i just set it. < 1365998114 441272 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :imo VX < 1365998122 340836 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :Bike, remind me to remove it in like half an hour. < 1365998127 137387 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :alright got it < 1365998133 127518 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :i will be your irssi < 1365998133 797337 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :fentanyl gas < 1365998268 930126 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :fentanyl gas in your ass < 1365998303 584303 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :Bike: why were you forbidden from ops < 1365998318 975315 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :i want to find out. oerjan op Bike < 1365998321 206212 :FreeFull!~freefull@defocus/sausage-lover PRIVMSG #esoteric :Should I try to get an hour of sleep? < 1365998338 275382 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :elliott: i think i may be "the elliott" in this other channel, so to speak < 1365998362 789060 :oerjan!oerjan@sprocket.nvg.ntnu.no PRIVMSG #esoteric :shocking < 1365998368 317825 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :wow excuse me < 1365998375 351161 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :"the elliott" is a positive phrase denoting coolness & affability < 1365998381 105798 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :yes i'm those < 1365998385 944207 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :& running yer fuckin wiki for you ungrateful assholes < 1365998387 520104 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :but also inexplicably banned from ops by "the oerjan" < 1365998388 4424 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric ::( < 1365998397 146958 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :i wish you could have seen the wiki before i got my hands on it, Bike!! < 1365998402 416596 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :the recent changes was like < 1365998404 324204 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :when was that? < 1365998406 648872 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :literally filled with spam deletions < 1365998408 6066 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :like < 1365998412 591683 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :it was all deleted by ais523 who is a workaholic < 1365998416 840914 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :i mean i've read esolang articles for years < 1365998423 65346 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :but the actual deletion logs clogged out everything < 1365998444 8232 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :and nobody else offered to take it over but elliott, saviour & defender of all that is good < 1365998444 576521 :oerjan!oerjan@sprocket.nvg.ntnu.no PRIVMSG #esoteric :elliott: so pretty much like now, right? < 1365998472 770361 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :oerjan: that's it. < 1365998477 309368 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :oerjan: you know what's going to happen now, don't you. < 1365998482 606604 :oerjan!oerjan@sprocket.nvg.ntnu.no PRIVMSG #esoteric :i'm afraid so. < 1365998487 563258 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :even i know what's going to happen now and i'm high < 1365998494 153671 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :on flouride < 1365998499 962974 :coppro!raedford@taurine.csclub.uwaterloo.ca PRIVMSG #esoteric :I don't know < 1365998501 580664 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :oerjan: is this your secret plan to get wiki adminship < 1365998507 535791 :coppro!raedford@taurine.csclub.uwaterloo.ca PRIVMSG #esoteric :what's going to happen :( < 1365998513 444658 :oerjan!oerjan@sprocket.nvg.ntnu.no PRIVMSG #esoteric :but i'm afraid i cannot really help against the block logs clogging recent changes. < 1365998514 72412 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :i'm seeing through the meta-layers here, oerjan < 1365998538 76585 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :coppro: the goat will release the fourth seal < 1365998548 608543 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :Bike: btw February 2012 apparently < 1365998550 328845 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :is when I took over < 1365998557 58389 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :mount g will erupt with the screams of demons, who will cover the earth like locusts < 1365998577 62477 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :a third of Man will die in unimaginable pain in the ensuing war < 1365998605 248201 :oerjan!oerjan@sprocket.nvg.ntnu.no PRIVMSG #esoteric :Bike: i suggest not reading revelations hth < 1365998619 82139 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :oerjan: actually i know what's going to happen. you're going to op me and i am going to kick you for that insult < 1365998643 158166 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :oerjan i bet that would h more if you were a wiki admin < 1365998653 852994 :FreeFull!~freefull@defocus/sausage-lover PRIVMSG #esoteric :I like STM so far < 1365998658 201796 :FreeFull!~freefull@defocus/sausage-lover PRIVMSG #esoteric :No funny in-between states < 1365998664 997666 :oerjan!oerjan@sprocket.nvg.ntnu.no PRIVMSG #esoteric :Bike: but only elliott can upgrade the wiki hth < 1365998702 577718 :ChanServ!ChanServ@services. MODE #esoteric +v :oerjan > 1365998702 591239 NAMES :#esoteric < 1365998704 933438 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :take that. < 1365998730 121722 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :
ACTION master of rebellion
< 1365998739 934628 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :oh damn! daaaaamn! daaaaaaaaaaaaaaamn < 1365998749 696473 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :when ops is outlawed only outlaws will have ops < 1365998773 217123 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :kmc: i believe that's the premise of ircnet < 1365998854 31118 :FreeFull!~freefull@defocus/sausage-lover PRIVMSG #esoteric :ChanServ is the worst outlaw < 1365999204 455553 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :Bike: has it been half an hour yet < 1365999223 884595 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :no < 1365999249 618646 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :doesn't it undermine the point of me being your irssi if you have to check < 1365999274 473907 :zzo38!~zzo38@24-207-49-17.eastlink.ca PRIVMSG #esoteric :On channel names starting with + no modes (including ops) are allowed. < 1365999332 686777 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :Bike: i'm anxious!!!!!!!!! < 1365999342 750828 :zzo38!~zzo38@24-207-49-17.eastlink.ca PRIVMSG #esoteric :There are also channel types ! meaning that the servers add a hidden prefix to disallow takeovers due to server splits, and & meaning that the channel is local to one server and is not repeated. < 1365999388 537078 :zzo38!~zzo38@24-207-49-17.eastlink.ca PRIVMSG #esoteric :Channel type # might be vulnerable to takeovers due to netsplits, but !&+ are all immune to that problem, for different reasons. < 1365999791 687461 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :elliott: ok go for it quick!! < 1366000034 893545 :zzo38!~zzo38@24-207-49-17.eastlink.ca PRIVMSG #esoteric :Maybe HTTP code 418 should be defined as a more generalized than "I'm a teapot"? < 1366000051 45147 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :Bike: sorry, i'm going by whenever copumpkin removes it in -blah now < 1366000052 690408 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :you were usurped < 1366000059 367176 :copumpkin!~copumpkin@unaffiliated/copumpkin PRIVMSG #esoteric :? < 1366000075 281888 :copumpkin!~copumpkin@unaffiliated/copumpkin PRIVMSG #esoteric :supdawg < 1366000088 262166 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric ::( < 1366000093 190078 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PART :#esoteric < 1366000111 173534 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :copumpkin: i was using bike as an egg timer to remove that joinquit spam ban in #haskell < 1366000120 709685 :copumpkin!~copumpkin@unaffiliated/copumpkin PRIVMSG #esoteric :oh < 1366000124 11524 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :my slaves all serve me!! < 1366000260 5832 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :itt zzo38 is a teapot < 1366001556 51182 :pikhq_!~pikhq@174-24-19-12.clsp.qwest.net PRIVMSG #esoteric :zzo38: Nah, it should be more specific. < 1366001564 597173 :pikhq_!~pikhq@174-24-19-12.clsp.qwest.net PRIVMSG #esoteric :"I'm a little teapot". < 1366001566 418668 :pikhq_!~pikhq@174-24-19-12.clsp.qwest.net PRIVMSG #esoteric :Clearly. < 1366001572 148362 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :kmc: What story? < 1366001689 788701 :Bike!~Glossina@174-25-37-88.ptld.qwest.net JOIN :#esoteric < 1366001778 737329 :Fiora!~Fiora@ec2-50-17-93-47.compute-1.amazonaws.com PRIVMSG #esoteric :Bike: that is so cool < 1366001780 575347 :TeruFSX!~TeruFSX@65-128-179-240.mpls.qwest.net QUIT :Ping timeout: 256 seconds < 1366001824 93364 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :yeah < 1366001825 578065 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :elliott: How come you're not an op? < 1366001837 377495 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :it's also pretty obvious from looking at disassemblies of trivial functions < 1366001842 21194 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :so, i'm dumb, etc < 1366001844 618773 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :shachaf: ask oerjan. < 1366001865 86201 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :Is it because you were abusing op powers and also giving the wrong people voice? < 1366001865 280638 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :Fiora: Bike: ok what are you talking about < 1366001872 744514 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :hi copumpkin < 1366001873 750332 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :shachaf: i still have voice powers < 1366001875 46335 :Fiora!~Fiora@ec2-50-17-93-47.compute-1.amazonaws.com PRIVMSG #esoteric :um. an sbcl thing < 1366001876 186318 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :a lisp implementaton < 1366001877 906488 :copumpkin!~copumpkin@unaffiliated/copumpkin PRIVMSG #esoteric :hi < 1366001879 19790 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :oh that < 1366001882 526555 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :nothing interesting to you! < 1366001888 524330 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :hey i don't hate sbcl! < 1366001892 685524 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :maybe kmc means i should send Sgeo a link to that story < 1366001895 240053 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :don't paint me as some kind of extremist! < 1366001899 124055 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :but you haven't even read it yet < 1366001916 68435 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :some kind of sbclist < 1366001931 993240 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :hm this leads to a question < 1366001938 844825 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :is the ghc source comprehensible by mortals < 1366001942 804158 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :sure < 1366001946 868083 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :it's pretty short < 1366001952 45305 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :right i thought so < 1366001954 990578 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :the typechecker is just a few thousand lines of code or whatever < 1366001966 123817 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :the whole thing including all the ridiculous OS support twiddles and so on is 100k lines I think? < 1366001980 436930 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :but the part that does the actual compiling isn't quite as scary. < 1366001981 200545 :pikhq_!~pikhq@174-24-19-12.clsp.qwest.net PRIVMSG #esoteric :That's rather a lot better than GCC. < 1366001982 207169 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :Is that including the RTS? < 1366001988 109892 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :shachaf: I think so, yeah < 1366001990 827319 :pikhq_!~pikhq@174-24-19-12.clsp.qwest.net PRIVMSG #esoteric :I'd be surprised if its C++ parser is that size. < 1366001991 451662 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :maybe includes base too < 1366001994 335230 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :Bike: http://www.aosabook.org/en/ghc.html < 1366002009 332066 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :hm i forgot how to get line counts of directories, i suck at unix < 1366002015 683009 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :oh huh < 1366002018 998492 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :elliott: according to that it was 140,000 compiler and 50,000 rts < 1366002020 785211 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :shachaf: i still haven't read that book :( < 1366002028 718753 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :okay fair enough < 1366002034 115875 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :but a lot of that is the code generator backends < 1366002047 520977 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :well did those even "exist in 200111" < 1366002055 170845 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :the actual "haskell" parts are like 4k+4k+24k+7k < 1366002071 67896 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :so like 39k. < 1366002073 847518 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :let's say: 40k. < 1366002082 778589 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :in the grim darkness of glasgow < 1366002094 941868 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :"GHC has a complex build system, which today comprises about 6,000 lines of GNU make code." < 1366002100 526982 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :lol < 1366002101 693763 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :more like wrong-cambridge < 1366002113 328756 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :does anyone actually understand makefiles anymore < 1366002124 760668 :augur!~augur@208.58.5.87 JOIN :#esoteric < 1366002142 868469 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :anyway i asked because sbcl's source code is basically incomprehensible. parts of it are older than me, it's a weird feeling < 1366002148 680696 :pikhq_!~pikhq@174-24-19-12.clsp.qwest.net PRIVMSG #esoteric :Bike: I speak Make. < 1366002156 736131 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :ok but ur a freek < 1366002225 344891 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :Bike: well parts of GHC might be older than you. < 1366002226 438763 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :how old are you < 1366002252 759156 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :GHC is from, like, 1990. < 1366002253 684510 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :younger than i am : " ( < 1366002254 92959 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :oh ghc is like 1990 too < 1366002259 647956 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :god everything is old < 1366002265 198357 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :i should use something hip and new < 1366002265 847539 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :"Peyton Jones, as well as Simon Marlow, later moved to Microsoft Research in Cambridge, England, where they continue to be primarily responsible for developing GHC." < 1366002268 905995 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :Bike: ur old !!!!!! ! < 1366002269 763809 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :wikipedia is out of date!!!!!! < 1366002290 464652 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :elliott: smarlow is retired and he's still primarily responsible for developing ghc < 1366002291 874526 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :peyton is a weird name < 1366002312 357824 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :marlow well he should write plays < 1366002343 314343 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :hey who wants to know the "full name" of spj < 1366002350 488423 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :simon phaskell jones < 1366002353 382804 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :simon "phat" jones < 1366002361 811825 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :ps it's actually slpj < 1366002387 27951 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :answer? < 1366002387 876372 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :Simon Loftus Peyton Jones < 1366002396 242883 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :peyton is still weirdest < 1366002404 94531 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :you're weirder hth < 1366002415 427737 :oerjan!oerjan@sprocket.nvg.ntnu.no PRIVMSG #esoteric :a lofty name < 1366002428 256583 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :oerjan: devoice thyself < 1366002452 539674 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :devoerjan < 1366002453 614924 :ChanServ!ChanServ@services. MODE #esoteric -v :oerjan > 1366002453 728190 NAMES :#esoteric < 1366002465 53854 :oerjan!oerjan@sprocket.nvg.ntnu.no PRIVMSG #esoteric :YESSIR < 1366002477 685653 :ChanServ!ChanServ@services. MODE #esoteric +v :oerjan > 1366002477 706640 NAMES :#esoteric < 1366002481 823689 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :oh no. there are gremlins. < 1366002491 596525 :oerjan!oerjan@sprocket.nvg.ntnu.no PRIVMSG #esoteric :gremliotts < 1366002510 967415 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :oerjan: you know, all I need is +ARfiorst. < 1366002511 619100 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :oerjan n o < 1366002520 131469 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :mnoqy: do you need +ARfiorst < 1366002524 904753 :oerjan!oerjan@sprocket.nvg.ntnu.no PRIVMSG #esoteric :shachaf: btw i didn't really intend to deop elliott but chanserv did it automatically when i gave him the +v flag < 1366002526 821563 :mnoqy!~okay@pool-98-108-206-66.snloca.dsl-w.verizon.net PRIVMSG #esoteric : >???? ??? < 1366002538 641856 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :oerjan: i can think of a fine way to make up for that mistake!!! < 1366002541 133988 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :mnoqy: you're the best < 1366002550 620545 :mnoqy!~okay@pool-98-108-206-66.snloca.dsl-w.verizon.net PRIVMSG #esoteric :?????? ? < 1366002564 826266 :shachaf!~shachaf@unaffiliated/shachaf TOPIC #esoteric :everyone's caught on to everything you do | is mnoqy rye? 'course he is! | Underhanded C Contest: http://underhanded.xcott.com/?page_id=5 | http://codu.org/logs/_esoteric/ < 1366002594 443454 :mnoqy!~okay@pool-98-108-206-66.snloca.dsl-w.verizon.net PRIVMSG #esoteric :rye? < 1366002597 170114 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :rye < 1366002631 925915 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :does the mn in mnoqy stand for minnesota < 1366002635 874272 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :+RfiorAst < 1366002637 659715 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :minnesota oqy < 1366002648 970063 :mnoqy!~okay@pool-98-108-206-66.snloca.dsl-w.verizon.net PRIVMSG #esoteric :no < 1366002680 787502 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :oqay < 1366002685 450409 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :hey have you considered that < 1366002690 294745 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :/nick monqay < 1366002694 846935 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :/nick mnoqay < 1366002708 73376 :mnoqy!~okay@pool-98-108-206-66.snloca.dsl-w.verizon.net PRIVMSG #esoteric :m "no" qy < 1366002708 348773 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :maybe it needs to be sorted < 1366002722 180114 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :mnoqy: very good mr mister! very good < 1366002769 758339 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :elliøtt < 1366002776 338582 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :`? ørjan < 1366002778 206672 :HackEgo!codu@codu.org PRIVMSG #esoteric :​Ørjan is oerjan's good twin. He's banned in the IRC RFC for being an invalid character. Sometimes he publishes papers. < 1366002797 373639 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :oerjan: Where does Ørjan live? < 1366002832 675164 :oerjan!oerjan@sprocket.nvg.ntnu.no PRIVMSG #esoteric :i do not know < 1366002864 332676 :oerjan!oerjan@sprocket.nvg.ntnu.no PRIVMSG #esoteric :he keeps moving to escape my assassins, the impolite scoundrel < 1366002951 438380 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :Well, there's norway he's in the same country as you. < 1366002988 865291 :fizzie!fis@unaffiliated/fizzie PRIVMSG #esoteric :Presumably the good Ørjan lives either in the North or South, while the wicked oerjan lives in the West or East. < 1366002989 100355 :lambdabot!~lambdabot@li85-105.members.linode.com PRIVMSG #esoteric :fizzie: You have 1 new message. '/msg lambdabot @messages' to read it. < 1366003091 415835 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :or both? < 1366003102 172816 :fizzie!fis@unaffiliated/fizzie PRIVMSG #esoteric :@tell Phantom_Hoover oklopol is real if you just believe. < 1366003102 367108 :lambdabot!~lambdabot@li85-105.members.linode.com PRIVMSG #esoteric :Consider it noted. < 1366003117 940920 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :fizzie: i have been stripped of my rightful Gregor-neutralising powers < 1366003133 685566 :fizzie!fis@unaffiliated/fizzie PRIVMSG #esoteric :Terrible. < 1366003152 926429 :ChanServ!ChanServ@services. MODE #esoteric +v :fizzie > 1366003152 948523 NAMES :#esoteric < 1366003158 119618 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :it truly is. < 1366003172 140574 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :thankfully, oerjan = sqrt(fizzie) + Gregor / i. < 1366003177 304299 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :so balance is temporarily kept. < 1366003187 671363 :fizzie!fis@unaffiliated/fizzie PRIVMSG #esoteric :ChanServ: Why do you keep DOING it. < 1366003190 348864 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :(this is the mathematics of universal balance.) < 1366003202 963251 :coppro!raedford@taurine.csclub.uwaterloo.ca PRIVMSG #esoteric :whoa < 1366003205 130779 :coppro!raedford@taurine.csclub.uwaterloo.ca PRIVMSG #esoteric :that equation is deep < 1366003223 349328 :coppro!raedford@taurine.csclub.uwaterloo.ca PRIVMSG #esoteric :euler's formula has nothing on that < 1366003226 724495 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :
ACTION counts on his fingers
< 1366003231 592272 :coppro!raedford@taurine.csclub.uwaterloo.ca PRIVMSG #esoteric :elliott, what should I call that wonderful formula? < 1366003241 409708 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :that means like... what does that mean < 1366003244 362914 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :i think there's a one < 1366003253 811459 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :coppro: the truth < 1366003258 629997 :coppro!raedford@taurine.csclub.uwaterloo.ca PRIVMSG #esoteric :elliott: deep, man < 1366003653 7430 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :Hmm, people actually say "god bless you" when you sneeze? < 1366003665 161684 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :I don't know that I've heard the three-word version before. < 1366003690 120728 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :saint francis of assissi bless you < 1366004222 502923 :oerjan!oerjan@sprocket.nvg.ntnu.no PRIVMSG #esoteric :fizzie: happy birthday! < 1366004241 769144 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :It's fizzie++ ? < 1366004246 699131 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :is fizzie 30 now < 1366004265 345670 :oerjan!oerjan@sprocket.nvg.ntnu.no PRIVMSG #esoteric :assuming he didn't lie in the logs yesterday < 1366004300 511184 :oerjan!oerjan@sprocket.nvg.ntnu.no PRIVMSG #esoteric :and everyone knows fizzie never lies < 1366004390 724924 :doesthiswork!~Adium@75.87.251.5 PART :#esoteric < 1366004409 38483 :oerjan!oerjan@sprocket.nvg.ntnu.no PRIVMSG #esoteric :i don't know how many years he is, though < 1366004495 32767 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :i shall celebrate by making oerjan a wiki admin < 1366004516 998175 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :how about celebrating by making me a wiki dictator < 1366004615 529650 :oerjan!oerjan@sprocket.nvg.ntnu.no QUIT :Quit: Wikiwiki < 1366004892 970777 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :@wiki oerjan < 1366004893 433098 :lambdabot!~lambdabot@li85-105.members.linode.com PRIVMSG #esoteric :http://www.haskell.org/haskellwiki/oerjan < 1366004914 249584 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :so wikipedia's favicon changed. < 1366004921 963220 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :the fucking apocalypse < 1366004942 997404 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :Bike: wait, is *that* how the world ends? < 1366004953 621296 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :i thought i heard something about fire and/or ice < 1366004997 796469 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :not with a bang but with a favicon < 1366005049 183329 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :haha < 1366005083 997175 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :http://www.marxists.org/favicon.ico < 1366005103 950777 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :is it bad that i'm used to that one < 1366005161 893231 :Sgeo!~Sgeo@ool-ad034ea6.dyn.optonline.net PRIVMSG #esoteric :What's the deal with everyone using .ico format? < 1366005167 620259 :Sgeo!~Sgeo@ool-ad034ea6.dyn.optonline.net PRIVMSG #esoteric :I thought that was a Windows thing < 1366005187 271969 :zzo38!~zzo38@24-207-49-17.eastlink.ca PRIVMSG #esoteric :I never use favicons so I won't care < 1366005189 990228 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :some browsers (cough cough IE) only accept .ico format for favicons < 1366005208 69365 :zzo38!~zzo38@24-207-49-17.eastlink.ca PRIVMSG #esoteric :But yes .ico is mainly Windows < 1366005209 155870 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :even ie v. 9 < 1366005214 130233 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :?? < 1366005216 88869 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :Sgeo: and originally you could only specify one by putting it at /favicon.ico < 1366005224 940009 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :?? ?? ?? ?? ?? ?? ?where quonochrom < 1366005225 776389 :lambdabot!~lambdabot@li85-105.members.linode.com PRIVMSG #esoteric : monochrom says: There are truths, damn truths, and Kripke structures. < 1366005227 817919 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :but now there's a tag for it, and you can use any format with most browsers < 1366005242 273149 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :kmc: are you going to icfp 2013 < 1366005250 253739 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :?where quonochrom < 1366005250 592911 :lambdabot!~lambdabot@li85-105.members.linode.com PRIVMSG #esoteric :?quote monochrom < 1366005251 423563 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :nah < 1366005257 323395 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :@where quonochrom < 1366005257 770514 :lambdabot!~lambdabot@li85-105.members.linode.com PRIVMSG #esoteric :?quote monochrom < 1366005259 760322 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :disappointed. < 1366005277 831458 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :are you doing icfpcontest 2013 < 1366005302 603057 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :prob not < 1366005307 741081 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :i haven't done one yet < 1366005338 625566 :FreeFull!~freefull@defocus/sausage-lover QUIT :Quit: Cya later < 1366005367 898620 :Bike!~Glossina@174-25-37-88.ptld.qwest.net QUIT :Ping timeout: 256 seconds < 1366005377 100566 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :~freefull@defocus/sausage-lover < 1366005388 817299 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :the sausage king of Chicago < 1366005452 251449 :Bike!~Glossina@174-25-37-88.ptld.qwest.net JOIN :#esoteric < 1366005479 670711 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :http://www.teapartyinspace.org/ y'all ready for this < 1366005576 831082 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :god dammit Bike < 1366005580 970325 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :i am trying to go to sleep < 1366005622 844216 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :maybe you should have told me to tell you to sleep first < 1366005633 443407 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :instead of that how would you like to read comments of the worst commenter on reddit < 1366005647 357763 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :that's a pretty bad commenter < 1366005650 587623 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :(the sad part is that he's not the worst commenter on reddit) < 1366005651 698303 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :i'm actually curious < 1366005654 16047 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :oh < 1366005668 82065 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :ok Part Two is this a programming/haskell thing or more broad, badcommenter-wise < 1366005679 773517 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :yes and yes < 1366005694 402411 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :how ambiguous. < 1366005770 33110 :Bike_!~Glossina@174-25-37-88.ptld.qwest.net JOIN :#esoteric < 1366005966 211359 :Bike!~Glossina@174-25-37-88.ptld.qwest.net QUIT :Ping timeout: 264 seconds < 1366006402 109571 :Bike_!~Glossina@174-25-37-88.ptld.qwest.net NICK :Bike < 1366006478 426423 :fizzie!fis@unaffiliated/fizzie PRIVMSG #esoteric :@tell oerjan TANK U < 1366006478 621510 :lambdabot!~lambdabot@li85-105.members.linode.com PRIVMSG #esoteric :Consider it noted. < 1366006486 569322 :fizzie!fis@unaffiliated/fizzie PRIVMSG #esoteric :(And 30 is right.) < 1366006526 53615 :fizzie!fis@unaffiliated/fizzie PRIVMSG #esoteric :(Maybe "right" is not the right word. "Correct.") < 1366006544 317705 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :@hug fizzie < 1366006544 865138 :lambdabot!~lambdabot@li85-105.members.linode.com PRIVMSG #esoteric :http://hackage.haskell.org/trac/ghc/newticket?type=bug < 1366006567 21071 :fizzie!fis@unaffiliated/fizzie PRIVMSG #esoteric :Nice command. < 1366006570 723835 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :fizzie: you know what makes you feel youthful? making other people ops. science fact. < 1366006594 940180 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :fizzie: Happy fizzie++ ! < 1366006680 517665 :fizzie!fis@unaffiliated/fizzie PRIVMSG #esoteric :Yay! < 1366006689 715276 :Fiora!~Fiora@ec2-50-17-93-47.compute-1.amazonaws.com PRIVMSG #esoteric :oh, it's your birthday? :o < 1366006691 219341 :Fiora!~Fiora@ec2-50-17-93-47.compute-1.amazonaws.com PRIVMSG #esoteric :happy birthday! < 1366006706 761376 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :fizzie: i have an alternate request: make it not quarter past seven. < 1366006712 589198 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :fizzie: choose whichever you prefer < 1366006715 483184 :fizzie!fis@unaffiliated/fizzie PRIVMSG #esoteric :Fiora: It's why I started looking at all those birth-date coincidencies in the first place. < 1366006727 610699 :fizzie!fis@unaffiliated/fizzie PRIVMSG #esoteric :elliott: Okay, it's now quarter past nine. (Here.) < 1366006731 902556 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :happy fizzie day < 1366006732 725932 :Fiora!~Fiora@ec2-50-17-93-47.compute-1.amazonaws.com PRIVMSG #esoteric :ohhhhh! < 1366006734 767228 :Fiora!~Fiora@ec2-50-17-93-47.compute-1.amazonaws.com PRIVMSG #esoteric :happy fizzie day :3 < 1366006760 277466 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :fizzie: THAT IS THE WRONG WAY < 1366006762 948341 :fizzie!fis@unaffiliated/fizzie PRIVMSG #esoteric :I know there's all kind of crisises supposed to happen at even years, does 30 have one of them? < 1366006783 254362 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :prolly < 1366006813 711145 :fizzie!fis@unaffiliated/fizzie PRIVMSG #esoteric :I don't know what the signs are, though. < 1366006824 636739 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :crisis: you discover you are a speech recognition researcher < 1366006836 43365 :fizzie!fis@unaffiliated/fizzie PRIVMSG #esoteric :Well, "check." < 1366006845 798808 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :oh no speech recognition < 1366006849 375138 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :`quote speech recognition < 1366006851 783001 :HackEgo!codu@codu.org PRIVMSG #esoteric :672) fizzie: What kind of speech recognition do you do? If you only need to recognize famous speeches, like Churchill or something, it should be pretty easy. < 1366006883 443939 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :that made me laugh a lot, weirdly < 1366006893 548924 :fizzie!fis@unaffiliated/fizzie PRIVMSG #esoteric :I'm going to celebrate fizzie day by having an old man put scissors in my mouth, it sounds like the best. (They're removing some stitches.) < 1366006895 907378 :mnoqy!~okay@pool-98-108-206-66.snloca.dsl-w.verizon.net PRIVMSG #esoteric :thanks shachaf, for the good times & laughter < 1366006905 944178 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :`run quote monqy | shuf < 1366006907 831508 :HackEgo!codu@codu.org PRIVMSG #esoteric :427) itidus20: i saw a dancing cgi skeleton named malaria. i danced and played with him. \ 508) monqy: help how do I use lambdabot to send messages to people. [...around half an hour later...] @messages quicksilver said 1y 2m 18d 19h 54m 29s ago: you use @tell \ 385) it was a wonderful dream < 1366006917 39011 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :`run quote shachaf | shuf < 1366006918 646337 :HackEgo!codu@codu.org PRIVMSG #esoteric :697) elliott: Anyway, if you wrote a Haskell book, I would read it and possibly provide classical criticism. That is to say, non-constructive. \ 942) shachaf: LC_ALL=de_DE.utf-8 errno -l Veraltete NFS-Dateizugriffsnummer Eingabe-/Ausgabefehler "Unterbrechung während des Betriebssystemaufrufs" i thin < 1366006930 864861 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :? < 1366006932 385033 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :`quote 942 < 1366006933 951199 :HackEgo!codu@codu.org PRIVMSG #esoteric :942) shachaf: LC_ALL=de_DE.utf-8 errno -l Veraltete NFS-Dateizugriffsnummer Eingabe-/Ausgabefehler "Unterbrechung während des Betriebssystemaufrufs" i think that was in the Ring Cycle < 1366006947 35850 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :Oh, it has "shachaf:" < 1366006949 23949 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :for some reason it reminds me of this book of Famous Speeches at biztown < 1366006955 829262 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :`run quote shachaf | shuf < 1366006957 423006 :HackEgo!codu@codu.org PRIVMSG #esoteric :628) You should get kmc in this channel. kmc has good quotes. `quote kmc 686) COCKS [...] truly cocks Well, in theory. \ 889) shachaf: contrary to common belief, #esoteric is not really "a channel for crazy people", but has (ostensibly) a topic... is beaky from finland? \ 865) G < 1366006968 907579 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :`run quote Bike | shuf < 1366006969 972096 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :shufchaf < 1366006970 963605 :HackEgo!codu@codu.org PRIVMSG #esoteric :857) "damn, my port of ghc to php isn't properly taking javascript booleans into account" \ 1006) Bike: I think you're ready to learn about lens. oh god fiora help somebody help anybody \ 917) Taneb: STOP TRYING TO GET LENS INTO EVERYTHING Bike: You should use lens! NEVER _< < 1366007206 400147 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :i would like to go on the record as not caring whether people are sorry < 1366007236 434621 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :`run echo ' i would like to go on the record as not caring whether people are sorry' >> record < 1366007240 822581 :HackEgo!codu@codu.org PRIVMSG #esoteric :No output. < 1366007245 43338 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :`rm record < 1366007247 838571 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :it's an imaginary record < 1366007248 520627 :HackEgo!codu@codu.org PRIVMSG #esoteric :No output. < 1366007254 55895 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :like the kind you put music on < 1366007261 208652 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :um those aren't imaginary < 1366007264 825308 :Fiora!~Fiora@ec2-50-17-93-47.compute-1.amazonaws.com PRIVMSG #esoteric :I guess you could say it's now a broken record < 1366007294 102519 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :that was so bad I think it broke my kidneys. < 1366007297 814290 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :who knew they were so sensitive to jokes < 1366007344 317597 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :my kidneys for one are all about jokes. < 1366007416 637624 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :fiora just apologized for something someone else did, elsewhere < 1366007421 314795 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :you're dropping the ball here fiora < 1366007426 367099 :Fiora!~Fiora@ec2-50-17-93-47.compute-1.amazonaws.com PRIVMSG #esoteric :I'm sorryyyyy < 1366007433 854343 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :Fiora................................................. < 1366007444 942416 :Fiora!~Fiora@ec2-50-17-93-47.compute-1.amazonaws.com PRIVMSG #esoteric :what >_< < 1366007445 136569 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :also didn't you read the no compete when you joined this channel < 1366007448 596872 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :you can't be in any other channel < 1366007457 60652 :Fiora!~Fiora@ec2-50-17-93-47.compute-1.amazonaws.com PRIVMSG #esoteric :s-sorry... < 1366007457 255232 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :dropping the very apologetic ball < 1366007466 806696 :Fiora!~Fiora@ec2-50-17-93-47.compute-1.amazonaws.com PRIVMSG #esoteric :I guess I can leave if it bothers you... < 1366007480 426582 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :no, you have to stay. < 1366007488 393577 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :you gotta stay < 1366007495 799067 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :this channel is now about you < 1366007498 848316 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :it's the rules. < 1366007505 178433 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :eeeek < 1366007505 452074 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :without you it would collapse around itself < 1366007510 759861 :Fiora!~Fiora@ec2-50-17-93-47.compute-1.amazonaws.com PRIVMSG #esoteric :I don't understand... < 1366007516 78259 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :in which #esoteric becomes a bad trip < 1366007523 800828 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :don't scare off Fiora............. < 1366007528 501969 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :Fiora: basically it's cool < 1366007533 787768 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :you're cool. it's all good. < 1366007537 280962 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :Fiora: sorry, sorry < 1366007538 873751 :ChanServ!ChanServ@services. MODE #esoteric +v :kmc > 1366007538 896105 NAMES :#esoteric < 1366007539 517998 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :don't leave < 1366007541 335880 :Fiora!~Fiora@ec2-50-17-93-47.compute-1.amazonaws.com PRIVMSG #esoteric :um. ??? < 1366007560 833348 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :why am i voiced < 1366007568 518742 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :kmc: see window 1 for explanation < 1366007572 277518 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :kmc: nobody knows < 1366007580 759336 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :it just happens without explanation. < 1366007594 465720 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :elliott's gone made with power < 1366007596 421934 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :next thing you know clog will be voiced. < 1366007601 514830 :ChanServ!ChanServ@services. MODE #esoteric +v :glogbot > 1366007601 537102 NAMES :#esoteric < 1366007635 844283 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :Bike: would you say he's a made man < 1366007646 628515 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :i uh, i don't get it. < 1366007651 464318 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :so i probably would not say that. < 1366007656 386413 :Jafet!~Jafet@unaffiliated/jafet PRIVMSG #esoteric :Does clog log clog < 1366007666 999247 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :Bike: the joke is that you said made < 1366007675 614558 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :oh hey i did < 1366007675 917474 :coppro!raedford@taurine.csclub.uwaterloo.ca PRIVMSG #esoteric :Jafet: I believe it clogs the clog log < 1366007678 807293 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :wow i'm good at typing < 1366007714 93609 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :http://24.media.tumblr.com/5d10cd5263f612c74b6a3d974f031091/tumblr_ml98evQd7s1r4kgqlo2_1280.png < 1366007739 84260 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :welp < 1366007741 872057 :fizzie!fis@unaffiliated/fizzie PRIVMSG #esoteric :Soon, everyone is voiced, after which being unvoiced will probably start being the cool thing. < 1366007763 32152 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :fizzie: no. being opped will be the cool thing < 1366007765 178403 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :fizzie: hey i read a book about that < 1366007766 437622 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :or maybe....... < 1366007767 913214 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :being a wiki admin < 1366007773 720405 :ion!ion@heh.fi PRIVMSG #esoteric :Being unvoiced was always cooler than being voiced. < 1366007783 493460 :ChanServ!ChanServ@services. MODE #esoteric +v :ion > 1366007783 527460 NAMES :#esoteric < 1366007786 96522 :ion!ion@heh.fi PRIVMSG #esoteric :A number of channels use +v as the idiot flag. < 1366007787 135367 :fizzie!fis@unaffiliated/fizzie PRIVMSG #esoteric :HA HA < 1366007789 655510 :ion!ion@heh.fi PRIVMSG #esoteric ::-) < 1366007797 379975 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :anyway one of the authors of this paper is named "Rafal Czajkowski" holy shit < 1366007804 183382 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :czajkowski people < 1366007806 947919 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :elliott: hey got any "wisecracks" for us < 1366007812 174687 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :i don't know how poland ever had problems with names like that < 1366007817 434161 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :i didn't even voice ion < 1366007818 720094 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :it's spreading < 1366007820 886435 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :is that a polish name i don't even know < 1366007822 719379 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :fizzie: imo op me < 1366007840 58662 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :Wait, elliott has chanserv mode +v now? < 1366007843 918488 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :wow it really is polish < 1366007844 417131 :fizzie!fis@unaffiliated/fizzie PRIVMSG #esoteric :elliott: Sorry, that's more of an oerjan thing. :/ < 1366007845 363763 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :What does that mean? < 1366007861 712262 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :fizzie: no no. oerjan just ops me *temporarily*. I didn't mean anything like that. < 1366007871 306210 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :shachaf: it means he's gone made with voice-/devoice- related power. < 1366007873 142985 :fizzie!fis@unaffiliated/fizzie PRIVMSG #esoteric :shachaf: It means one can /chanserv voice/devoice #esoteric dude, I think. < 1366007883 120619 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :wow that wasn't even intentional that time < 1366007897 586747 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :it wasn't the first time either, but i mean, still < 1366007907 761130 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :" Zbigniew Czajkowski, Polish fencing master; known as "father of the Polish School of Fencing" and coach of champions" < 1366007999 601748 :fizzie!fis@unaffiliated/fizzie PRIVMSG #esoteric :Any relation with Rafal? < 1366008000 530760 :mnoqy!~okay@pool-98-108-206-66.snloca.dsl-w.verizon.net PRIVMSG #esoteric :coach of champions, what a title < 1366008026 558242 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :coach of coaches of champions < 1366008032 88992 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :is copolishness a relation < 1366008039 551624 :fizzie!fis@unaffiliated/fizzie PRIVMSG #esoteric :The Couch of Champions. < 1366008042 145978 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :what about reverse polishness < 1366008069 329960 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :'inverse polish' is probably illegal < 1366008146 540348 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :fizzie: consider this: when lament comes a-knocking and the kids are asleep, who will re-ban dbelange...?????? < 1366008153 551154 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :who will make sure Gregor stays voiced < 1366008164 981612 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :imagine the national catastrophe (natastrophe) that could occur < 1366008167 746275 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :who the hell is lament and: why < 1366008171 527865 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :Gregor doesn't need voice < 1366008214 571794 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :Bike: well do you remember lmt < 1366008217 517736 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :from a few weeks ago or whatever < 1366008218 910919 :ion!ion@heh.fi PRIVMSG #esoteric :ENOTSUP 95 Operation not supported < 1366008220 705500 :ion!ion@heh.fi PRIVMSG #esoteric :SUP? < 1366008249 51721 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :um... a bit < 1366008271 546745 :Jafet!~Jafet@unaffiliated/jafet PRIVMSG #esoteric :`quote lament < 1366008273 70925 :HackEgo!codu@codu.org PRIVMSG #esoteric :66) Where's the link to the log? THERE'S NO LOG. YOUR REQUEST IS SUSPICIOUS AND HAS BEEN LOGGED. \ 276) elliott: well what i would do if i were omniscient and omnipotent would be to create an immortal woman with perfect tits and bang her for the rest of eternity < 1366008292 394732 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :Bike: he unbanned dbelange and then invited him. and also was generally lament < 1366008299 966965 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :oh! i talked with that person about salvia < 1366008301 864167 :zzo38!~zzo38@24-207-49-17.eastlink.ca PRIVMSG #esoteric :This is the message of 'pataprogramming (linked from Wikipedia): http://www.illposed.com/philosophy/pataprogramming.html < 1366008302 740409 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :right yes < 1366008306 172331 :mnoqy!~okay@pool-98-108-206-66.snloca.dsl-w.verizon.net PRIVMSG #esoteric :mmmm lots of new user accounts on thew iki today(its still the 14th....:]) < 1366008308 515639 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :he is an old channel op who has spent the past years hating #esoteric and only coming back to kick a lot of people and stuff < 1366008314 626974 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :p great < 1366008336 904246 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :awesome < 1366008337 604999 :fizzie!fis@unaffiliated/fizzie PRIVMSG #esoteric :ion: EL2HLT 51 Learn to halt, man < 1366008338 849730 :mnoqy!~okay@pool-98-108-206-66.snloca.dsl-w.verizon.net PRIVMSG #esoteric :plenty of accounts yesterday too < 1366008339 647815 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :i love history.. < 1366008344 13870 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :.... < 1366008364 166326 :ChanServ!ChanServ@services. MODE #esoteric +v :Bike > 1366008364 205978 NAMES :#esoteric < 1366008365 129712 :mnoqy!~okay@pool-98-108-206-66.snloca.dsl-w.verizon.net PRIVMSG #esoteric :whoa, someone made a brainfuck derivative derivative < 1366008373 334756 :mnoqy!~okay@pool-98-108-206-66.snloca.dsl-w.verizon.net PRIVMSG #esoteric :is that a record < 1366008378 378581 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :mnoqy: is "derivative" contravariant........................ < 1366008382 678464 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :is it a good one? < 1366008388 255613 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :haha j/k but seriously i wanna see it. < 1366008396 277470 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :mnoqy: arguably almost every bf derivative is a derivative of the original bf derivative . . . . . . . . < 1366008404 588976 :mnoqy!~okay@pool-98-108-206-66.snloca.dsl-w.verizon.net PRIVMSG #esoteric :http://esolangs.org/wiki/Noodle_Soup < 1366008419 928122 :carado!~carado@2a01:e35:8b61:e430:221:63ff:fe9a:3747 JOIN :#esoteric < 1366008422 437062 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :good old transitive property. < 1366008434 278033 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :transitive property of derivatives < 1366008436 76952 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :jesus fucking christ it's almost 8 am < 1366008450 408269 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :that's... not what multiprogramming means, is it < 1366008461 885546 :Jafet!~Jafet@unaffiliated/jafet PRIVMSG #esoteric :That Jesus F. Christ < 1366008464 866276 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :hey someone should make a "bf derivative" as in bf options or something < 1366008484 673459 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :i guess multiple interpretations of the same code could be kind of interesting if it wasn't dum < 1366008487 602977 :Fiora!~Fiora@ec2-50-17-93-47.compute-1.amazonaws.com PRIVMSG #esoteric :
ACTION buys bf call options
< 1366008493 138830 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :or as in differentiation but i don't know how to differentiate a language < 1366008499 562836 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :ok the wiki says that is what multiprogramming means. < 1366008502 606479 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :shachaf: parser combinators < 1366008505 851246 :ion!ion@heh.fi PRIVMSG #esoteric :EDOTDOT 73 http://youtu.be/4Z2Z23SAFVA < 1366008511 675976 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :Fiora: why are they called call option instead of buying-options < 1366008524 54857 :Fiora!~Fiora@ec2-50-17-93-47.compute-1.amazonaws.com PRIVMSG #esoteric :ummmm maybe ask wikipedia < 1366008555 154719 :pikhq_!~pikhq@174-24-19-12.clsp.qwest.net PRIVMSG #esoteric :shachaf: Tricky. Main problem is, derivatives are continuous while languages are discrete. < 1366008561 950008 :mnoqy!~okay@pool-98-108-206-66.snloca.dsl-w.verizon.net PRIVMSG #esoteric :http://esolangs.org/wiki/Revolution_9 why does this exist < 1366008569 159171 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :pikhq_: um, derivatives don't have to be continuous......... < 1366008576 416485 :Jafet!~Jafet@unaffiliated/jafet PRIVMSG #esoteric :Noodle Soup looks like a derivative of ROP < 1366008577 145993 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :pikhq_: like derivatives of types!! < 1366008588 871634 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :pikhq_: https://en.wikipedia.org/wiki/Derivation_(abstract_algebra) < 1366008591 568499 :Jafet!~Jafet@unaffiliated/jafet PRIVMSG #esoteric :Languages don't have to be discrete < 1366008617 631866 :pikhq_!~pikhq@174-24-19-12.clsp.qwest.net PRIVMSG #esoteric :shachaf: I wasassuming you meant "as per the calculus of derivatives and integrals"; excuse me. < 1366008621 268092 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :Fiora: okay from now on i'm calling them buying-options and selling-options < 1366008634 667787 :mnoqy!~okay@pool-98-108-206-66.snloca.dsl-w.verizon.net PRIVMSG #esoteric :elliott: you're a wiki admin right. -> http://esolangs.org/wiki/Revolution_9 <- check it < 1366008641 854833 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :pikhq_: as usual in math it's pretty common to make shit up notice it's pretty similar and call it the same thing < 1366008647 696319 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :the same fucking thing < 1366008650 392233 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :mnoqy: already chequed it < 1366008659 60444 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :turn me on, dead man < 1366008680 774018 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :elliott elliott "ur being overly british" "its written check even in britainland.." < 1366008698 102965 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :office of the exchecker < 1366008699 265160 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :you gotta watch those biritihisihims < 1366008731 528633 :mnoqy!~okay@pool-98-108-206-66.snloca.dsl-w.verizon.net PRIVMSG #esoteric :who remembers http://esolangs.org/wiki/FiM%2B%2B from october < 1366008735 922650 :mnoqy!~okay@pool-98-108-206-66.snloca.dsl-w.verizon.net PRIVMSG #esoteric :apparently it has its own wiki now < 1366008782 412709 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :wh- oh, tv show < 1366008795 580525 :mnoqy!~okay@pool-98-108-206-66.snloca.dsl-w.verizon.net PRIVMSG #esoteric :i hear people like it? < 1366008796 629332 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :after being unable to find pre-existing programming language based on My Little Pony. < 1366008802 195580 :mnoqy!~okay@pool-98-108-206-66.snloca.dsl-w.verizon.net PRIVMSG #esoteric :never seen it, myself < 1366008845 519146 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :mnoqy can i have your autograph < 1366008848 942469 :mnoqy!~okay@pool-98-108-206-66.snloca.dsl-w.verizon.net PRIVMSG #esoteric :um < 1366008870 801784 :mnoqy!~okay@pool-98-108-206-66.snloca.dsl-w.verizon.net PRIVMSG #esoteric :how--oh i guess i have a tablet i can just plug it in -untangle- < 1366008878 740037 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :hang on hang on < 1366008890 519269 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :if you're plugging in your tablet i want a self portrait of something < 1366008913 915873 :mnoqy!~okay@pool-98-108-206-66.snloca.dsl-w.verizon.net PRIVMSG #esoteric :ok uhh < 1366008922 608289 :mnoqy!~okay@pool-98-108-206-66.snloca.dsl-w.verizon.net PRIVMSG #esoteric :how about one for bike < 1366008928 227595 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :ooh good one < 1366008933 412936 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :draw a self portrait of Bike < 1366008942 596859 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :draw me an op campaign poster please < 1366008945 413844 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :Bike: You're in for a treat. < 1366008952 197529 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :elliott: no be quiet it's self self portrait time < 1366008959 393135 :mnoqy!~okay@pool-98-108-206-66.snloca.dsl-w.verizon.net PRIVMSG #esoteric :bike's never seen a self-portrait has he < 1366008970 588831 :mnoqy!~okay@pool-98-108-206-66.snloca.dsl-w.verizon.net PRIVMSG #esoteric :i can draw a self-portrait of elliott's op campaign < 1366008971 462916 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :well, i have < 1366008975 381759 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :er wait < 1366008980 792388 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :am i monqy? < 1366008986 958009 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :mnoqy: no don't do that < 1366008993 439487 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :mnoqy: elliott must never become op < 1366009001 922255 :mnoqy!~okay@pool-98-108-206-66.snloca.dsl-w.verizon.net PRIVMSG #esoteric :ok < 1366009004 535774 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :Bike: i hope not < 1366009023 53913 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :yeah me too, he's cooler than I. < 1366009043 736795 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :mnoqy is the terminal object in the poset category of coolness < 1366009045 600252 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :mnoqy: i want that self portrait < 1366009050 596142 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :i don't care what shachaf says < 1366009247 900488 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :monqy ARE WE GETTING THAT SELF PORTRAIT OR NOT < 1366009261 18925 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :sorry for shouting and/or yelling < 1366009263 827629 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :im so anxious < 1366009270 334604 :mnoqy!~okay@pool-98-108-206-66.snloca.dsl-w.verizon.net PRIVMSG #esoteric :sorry sorry gimp's just being awful < 1366009275 580574 :mnoqy!~okay@pool-98-108-206-66.snloca.dsl-w.verizon.net PRIVMSG #esoteric :it used to be so much less bad! < 1366009289 77458 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :gimp was always gimp was always bad < 1366009313 175235 :ion!ion@heh.fi PRIVMSG #esoteric :mnoqy: Your nick reminds me of the scroll labeled MNOSOI SHIT i got in crawl once. < 1366009313 968829 :mnoqy!~okay@pool-98-108-206-66.snloca.dsl-w.verizon.net PRIVMSG #esoteric :well have you seen it's new pen and pencil tools it's impossible to get them working right all the options are funky < 1366009345 670623 :mnoqy!~okay@pool-98-108-206-66.snloca.dsl-w.verizon.net PRIVMSG #esoteric :ion: thanks < 1366009365 279168 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :mnoqy: i believe in you < 1366009367 164191 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :that one is in ``fuk da sac'' right < 1366009372 559671 :ion!ion@heh.fi PRIVMSG #esoteric :elliott: yeah < 1366009389 430472 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :mnoqy: you can do anything if you put your mind to it!! < 1366009456 337053 :ion!ion@heh.fi PRIVMSG #esoteric :elliott: I disapprove of your choice of quotation characters. < 1366009465 605956 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :it encodes a specific meaning < 1366009483 124301 :mnoqy!~okay@pool-98-108-206-66.snloca.dsl-w.verizon.net PRIVMSG #esoteric :ion: you‘re the “stupid quotes„ guy right < 1366009557 254205 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :coughs < 1366009567 785135 :ChanServ!ChanServ@services. MODE #esoteric -v :Bike > 1366009568 48539 NAMES :#esoteric < 1366009597 504740 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :mnoqy: hey do you still have that self portrait of me < 1366009612 522601 :mnoqy!~okay@pool-98-108-206-66.snloca.dsl-w.verizon.net PRIVMSG #esoteric :yeah i have all of them i'll rev the links up < 1366009622 959558 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :oh here it is < 1366009624 480597 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :no stop i'm trying to sleep < 1366009624 883360 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :http://dl.dropboxusercontent.com/u/13786158/shachaf.png < 1366009654 912853 :mnoqy!~okay@pool-98-108-206-66.snloca.dsl-w.verizon.net PRIVMSG #esoteric :oh nuts i dont have them all in a directory i have to fix that < 1366009660 636951 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :http://dl.dropboxusercontent.com/u/13786158/monqy.png < 1366009678 532729 :mnoqy!~okay@pool-98-108-206-66.snloca.dsl-w.verizon.net PRIVMSG #esoteric :dont forget http://dl.dropboxusercontent.com/u/13786158/eliot.png < 1366009695 217359 :FireFly!~firefly@oftn/member/FireFly PRIVMSG #esoteric :shəchef < 1366009703 847998 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :need to revise monqy.png to be misspelled now < 1366009735 587872 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :these are good. < 1366009759 516619 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :elliott: um shachaf.png isn't misspelled < 1366009763 118607 :mnoqy!~okay@pool-98-108-206-66.snloca.dsl-w.verizon.net PRIVMSG #esoteric :ive moved all of them into the portraits directory < 1366009764 505812 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :so why should monqy.png be < 1366009783 597241 :mnoqy!~okay@pool-98-108-206-66.snloca.dsl-w.verizon.net PRIVMSG #esoteric :e.g. https://dl.dropboxusercontent.com/u/13786158/portraits/monqy.png < 1366009793 21473 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :e.g. http://dl.dropboxusercontent.com/u/13786158/portraits/shachaf.png < 1366009796 249196 :mnoqy!~okay@pool-98-108-206-66.snloca.dsl-w.verizon.net PRIVMSG #esoteric :"now organized" < 1366009806 275213 :mnoqy!~okay@pool-98-108-206-66.snloca.dsl-w.verizon.net PRIVMSG #esoteric :and i got a good "dynamics" set up in gimp < 1366009814 163178 :mnoqy!~okay@pool-98-108-206-66.snloca.dsl-w.verizon.net PRIVMSG #esoteric :now i just have to remember how to draw < 1366009928 715829 :fizzie!fis@unaffiliated/fizzie PRIVMSG #esoteric :Do you have a “workflow”? < 1366009938 854523 :mnoqy!~okay@pool-98-108-206-66.snloca.dsl-w.verizon.net PRIVMSG #esoteric :totes < 1366009939 792809 :fizzie!fis@unaffiliated/fizzie PRIVMSG #esoteric :(Those are some amazing portraits.) < 1366010045 808959 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :fizzie: doesn't eliot.png look like the face of someone you can trust < 1366010064 886103 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :someone i can trust to ruin the channel hth < 1366010080 512009 :fizzie!fis@unaffiliated/fizzie PRIVMSG #esoteric :elliott: Well, yes, but I don't trust myself to make sensible decisions. < 1366010098 554442 :fizzie!fis@unaffiliated/fizzie PRIVMSG #esoteric :(What sort of email reply subject line prefix is "AW:" supposed to be?) < 1366010102 346840 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :fizzie: I do! I believe in you. < 1366010108 610289 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :fizzie: believe that you can believe in me. < 1366010125 186901 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :fizzie: You should op me. < 1366010152 75444 :fizzie!fis@unaffiliated/fizzie PRIVMSG #esoteric :Oh, "Antwort". < 1366010160 705176 :impomatic!~digital_w@87.115.210.249 PRIVMSG #esoteric :German? < 1366010163 603357 :fizzie!fis@unaffiliated/fizzie PRIVMSG #esoteric :Yes. < 1366010176 835261 :fizzie!fis@unaffiliated/fizzie PRIVMSG #esoteric :Well, it was from Switzerland, but they do a kind of German there. < 1366010208 455282 :impomatic!~digital_w@87.115.210.249 PRIVMSG #esoteric :I thought proper German? < 1366010239 238090 :impomatic!~digital_w@87.115.210.249 PRIVMSG #esoteric :The big three are called DACH or something for Germany, Austria and Switzerland < 1366010289 959591 :fizzie!fis@unaffiliated/fizzie PRIVMSG #esoteric :I am under the impression that "Swiss German" is somewhat dialecty. < 1366010317 128017 :ChanServ!ChanServ@services. MODE #esoteric -v :glogbot > 1366010317 150678 NAMES :#esoteric < 1366010319 688323 :ChanServ!ChanServ@services. MODE #esoteric -v :ion > 1366010319 698137 NAMES :#esoteric < 1366010320 877045 :ChanServ!ChanServ@services. MODE #esoteric -v :kmc > 1366010320 901623 NAMES :#esoteric < 1366010323 979014 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :it is time for austerity. < 1366010337 908548 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :the swiss are all about the dialectic < 1366010383 753120 :fizzie!fis@unaffiliated/fizzie PRIVMSG #esoteric :The Swiss are very dielectric. (It's all that mountain air.) < 1366010384 478223 :impomatic!~digital_w@87.115.210.249 PRIVMSG #esoteric :
ACTION has a website in German. Unfortunately I only speak a bit of German. Fine for email, not so good when people phone :-(
< 1366010834 112022 :epicmonkey!~epicmonke@188.134.41.112 JOIN :#esoteric < 1366010872 931187 :mnoqy!~okay@pool-98-108-206-66.snloca.dsl-w.verizon.net PRIVMSG #esoteric :https://dl.dropboxusercontent.com/u/13786158/portraits/bike.png < 1366010907 637660 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :i shall treasure it < 1366010910 807577 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :thank you very much < 1366010919 805578 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :@hug mnoqy < 1366010920 399020 :lambdabot!~lambdabot@li85-105.members.linode.com PRIVMSG #esoteric :http://hackage.haskell.org/trac/ghc/newticket?type=bug < 1366010927 899984 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :mnoqy: you are the best < 1366011215 861788 :impomatic!~digital_w@87.115.210.249 PRIVMSG #esoteric :Isn't that a Trike? < 1366011226 702741 :mnoqy!~okay@pool-98-108-206-66.snloca.dsl-w.verizon.net PRIVMSG #esoteric :isn;t that what Bike is < 1366011228 949022 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :(1) no (2) don't ruin the moment < 1366011234 722951 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :==Bike < 1366011262 321295 :impomatic!~digital_w@87.115.210.249 PRIVMSG #esoteric :Sorry, my mistake. Definitely a Bike :-) < 1366011263 478480 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :that circle on the left isn't even connected how could it be a wheel < 1366011643 648637 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :Fiora: ? < 1366011804 465874 :mnoqy!~okay@pool-98-108-206-66.snloca.dsl-w.verizon.net PRIVMSG #esoteric :elliott: https://dl.dropboxusercontent.com/u/13786158/portraits/el-op.png < 1366011835 934197 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :mnoqy++ < 1366011903 166714 :Bike!~Glossina@174-25-37-88.ptld.qwest.net PRIVMSG #esoteric :elliott's op campaign is a talented artist < 1366011914 932519 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :elliott for nethack player < 1366011917 880905 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :and/or crawl player < 1366012122 591413 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :`welcome FireFly < 1366012127 696791 :HackEgo!codu@codu.org PRIVMSG #esoteric :FireFly: Welcome to the international hub for esoteric programming language design and deployment! For more information, check out our wiki: http://esolangs.org/wiki/Main_Page. (For the other kind of esoterica, try #esoteric on irc.dal.net.) < 1366012145 18725 :FireFly!~firefly@oftn/member/FireFly PRIVMSG #esoteric :wrong channel.... < 1366012150 126729 :epicmonkey!~epicmonke@188.134.41.112 QUIT :Ping timeout: 245 seconds < 1366012162 514573 :FireFly!~firefly@oftn/member/FireFly PRIVMSG #esoteric :but thanks < 1366012163 662695 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :Well, this is the channel with the `welcome bot. < 1366012169 245038 :FireFly!~firefly@oftn/member/FireFly PRIVMSG #esoteric :Fair < 1366012405 672544 :mnoqy!~okay@pool-98-108-206-66.snloca.dsl-w.verizon.net QUIT :Quit: hello < 1366013774 882555 :doesthiswork!~Adium@75.87.251.5 QUIT :Quit: Leaving. < 1366015462 985870 :DHeadshot!~DH____@unaffiliated/dh----/x-6288474 QUIT :Ping timeout: 258 seconds < 1366015808 78340 :Bike!~Glossina@174-25-37-88.ptld.qwest.net QUIT :Ping timeout: 260 seconds < 1366015850 364260 :Koen_!~Koen@vbo91-6-78-245-243-132.fbx.proxad.net JOIN :#esoteric < 1366016226 82251 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :ion: hion < 1366016261 728115 :ion!ion@heh.fi PRIVMSG #esoteric :shachaf: hachaf < 1366016272 269803 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :Isn't #-blah bad? < 1366016298 537963 :ion!ion@heh.fi PRIVMSG #esoteric :#-badh < 1366016710 942296 :hogeyui!~hogeyuiVP@vps.usamimi.biz QUIT :Quit: Tiarra 0.1+svn-36726: SIGTERM received; exit < 1366016885 871696 :epicmonkey!~epicmonke@host-224-58.dataart.net JOIN :#esoteric < 1366016919 687489 :hogeyui!~hogeyuiVP@vps.usamimi.biz JOIN :#esoteric < 1366016950 162580 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :ion ion ion ion < 1366017028 290564 :ion!ion@heh.fi PRIVMSG #esoteric :(unwords . replicate 4) "shachaf" < 1366017053 369828 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :> replicateM 4 "ion" < 1366017055 474628 :lambdabot!~lambdabot@li85-105.members.linode.com PRIVMSG #esoteric : ["iiii","iiio","iiin","iioi","iioo","iion","iini","iino","iinn","ioii","ioi... < 1366017747 840297 :fizzie!fis@unaffiliated/fizzie PRIVMSG #esoteric :fi:ioni == en:ion. < 1366017768 304818 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :fizzie: how about you op me for a little bit < 1366017862 244637 :fizzie!fis@unaffiliated/fizzie PRIVMSG #esoteric :You'd just kickban everyone, make the topic a link of your for-profit porn site, set up a ritual sacrifice altar in the middle of the channel, I know that. < 1366017866 534506 :fizzie!fis@unaffiliated/fizzie PRIVMSG #esoteric :(As opposed to your non-profit porn site.) < 1366018460 383661 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :No, I already said what I'd do. < 1366018464 92853 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :Op me and see! < 1366018512 89927 :fizzie!fis@unaffiliated/fizzie PRIVMSG #esoteric :I did not read that, I'm on a laggy mobile internet. < 1366018552 947786 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :It was yesterday. < 1366018686 435023 :fizzie!fis@unaffiliated/fizzie PRIVMSG #esoteric :Still, opping all kinds of random "plebs" is more of an oerjan thing, isn't it? < 1366018689 876788 :fizzie!fis@unaffiliated/fizzie PRIVMSG #esoteric :I get a bad rash if I touch the privilege controls. < 1366018723 820314 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :Don't worry, I'd deop myself within a minute. < 1366018842 909124 :fizzie!fis@unaffiliated/fizzie PRIVMSG #esoteric :Could you recap (in ten words or so) what you were going to do, first? I forgot what it was, if ever I knew. < 1366018856 891796 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :I was going to: deop myself (but first deop elliott) < 1366018915 483199 :fizzie!fis@unaffiliated/fizzie PRIVMSG #esoteric :Well, I guess that's safe enough, and pointless enough to be accepted by the Spirit of #esoteric. < 1366018919 702687 :ChanServ!ChanServ@services. MODE #esoteric +o :shachaf > 1366018919 724391 NAMES :#esoteric < 1366018925 997299 :shachaf!~shachaf@unaffiliated/shachaf MODE #esoteric -o :elliott > 1366018926 19343 NAMES :#esoteric < 1366018927 998901 :shachaf!~shachaf@unaffiliated/shachaf MODE #esoteric -o :shachaf > 1366018928 20362 NAMES :#esoteric < 1366018932 858636 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :Thanks. < 1366019085 929073 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :Hmm,I should've done it in one go. < 1366019094 570784 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :-oo elliott shachaf < 1366019097 199723 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :Oh well. < 1366019732 77003 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :fizzie: Did you hear the new name of this channel? < 1366019736 483276 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :esoteirc < 1366019743 46033 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :Because it's esoteric, but it's irc. < 1366019762 873873 :fizzie!fis@unaffiliated/fizzie PRIVMSG #esoteric :That I heard. < 1366019787 311196 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :fizzie: How should I learn Finnish? < 1366019833 639099 :fizzie!fis@unaffiliated/fizzie PRIVMSG #esoteric :I've heard there's a tutorial-kind of book called "Learn You a Finnish for Great Good!", it's got an elephant on the cover. (I may be mixing things up.) < 1366019867 87664 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :Hmm. I think you are. < 1366019877 653560 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :But have no fears. We may still be able to get something useful out of this. < 1366019878 790637 :hagb4rd2!~perdito@koln-4db40826.pool.mediaWays.net QUIT :Ping timeout: 258 seconds < 1366019881 457841 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :fizzie: How should I learn Haskell? < 1366019976 92461 :zzo38!~zzo38@24-207-49-17.eastlink.ca PRIVMSG #esoteric :Learn Haskell by practice; that is best way. < 1366019985 86617 :fizzie!fis@unaffiliated/fizzie PRIVMSG #esoteric :shachaf: Well, I've heard one way is to go live among native Haskell speakers for a while, but that's of course kind of boring. My (Finnish) friend's Chinese wife goes to some sort of daily Haskell course. But I don't really know these things. < 1366019988 717155 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :zzo38: (Shh. I actually want to learn Finnish.) < 1366020014 544286 :zzo38!~zzo38@24-207-49-17.eastlink.ca PRIVMSG #esoteric :Maybe you should also learn Finnish by practice too, then. < 1366020064 166772 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :`run ls wisdom | grep oe < 1366020066 359810 :HackEgo!codu@codu.org PRIVMSG #esoteric :No output. < 1366020077 820880 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :`run ls wisdom | grep '' < 1366020079 204049 :HackEgo!codu@codu.org PRIVMSG #esoteric :As the wisdom directory contains many files named after nicks, listing it in public annoys people. Try `pastewisdom instead. < 1366020092 860950 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :`run /bin/ls wisdom | grep oe < 1366020094 373460 :HackEgo!codu@codu.org PRIVMSG #esoteric :doesthiswork \ oerjan < 1366020101 827745 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :`? doesthiswork < 1366020103 678439 :HackEgo!codu@codu.org PRIVMSG #esoteric :no < 1366020117 176312 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :`run echo yes > wisdom/døsthiswork < 1366020120 872513 :HackEgo!codu@codu.org PRIVMSG #esoteric :No output. < 1366020137 417522 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :`? oerjan < 1366020139 351953 :HackEgo!codu@codu.org PRIVMSG #esoteric :Your evil overlord oerjan is a lazy expert in future computation. Also a lying Norwegian who hates Roald Dahl. < 1366020140 746913 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :`? Ørjan < 1366020142 598723 :HackEgo!codu@codu.org PRIVMSG #esoteric :​Ørjan is oerjan's good twin. He's banned in the IRC RFC for being an invalid character. Sometimes he publishes papers. < 1366020210 102624 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :`? groups < 1366020211 721713 :HackEgo!codu@codu.org PRIVMSG #esoteric :groups? ¯\(°_o)/¯ < 1366020214 454298 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :`? group < 1366020216 298825 :HackEgo!codu@codu.org PRIVMSG #esoteric :group? ¯\(°_o)/¯ < 1366020231 11871 :hagb4rd!~perdito@koln-4d0b6797.pool.mediaWays.net JOIN :#esoteric < 1366020317 650371 :conehead!~conehead@unaffiliated/conehead QUIT :Quit: Computer has gone to sleep. < 1366020357 192102 :fizzie!fis@unaffiliated/fizzie PRIVMSG #esoteric :Grüp theory. < 1366020458 732579 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :`? œrjan < 1366020460 543332 :HackEgo!codu@codu.org PRIVMSG #esoteric :​œrjan? ¯\(°_o)/¯ < 1366020603 480388 :fizzie!fis@unaffiliated/fizzie PRIVMSG #esoteric :`run echo 'oerjan øerjan œrjan' | iconv -t ascii//translit < 1366020605 170986 :HackEgo!codu@codu.org PRIVMSG #esoteric :oerjan ?erjan oerjan < 1366020607 691604 :fizzie!fis@unaffiliated/fizzie PRIVMSG #esoteric :Aw. < 1366020626 823649 :fizzie!fis@unaffiliated/fizzie PRIVMSG #esoteric :(Also, "øerjan"...) < 1366021488 747372 :ais523!~ais523@unaffiliated/ais523 JOIN :#esoteric < 1366021500 953624 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :@messages? < 1366021501 147283 :lambdabot!~lambdabot@li85-105.members.linode.com PRIVMSG #esoteric :Sorry, no messages today. < 1366021509 613184 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :checking for messages helps keep them away < 1366021720 427246 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :hi ais523 < 1366021723 654998 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :Any exciting news? < 1366021739 702443 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :hmm < 1366021744 507342 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :does it have to be recent news? < 1366021753 117979 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :I suppose not. < 1366021757 934192 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :I'm sure things have happened, and some people consider them exciting < 1366021765 210374 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :Answer as you see fit. < 1366021777 349968 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :the further back you go, the more likely you are to find things that are very exciting, to a lot of people < 1366021781 719194 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :I will allow you to use your good judgment. < 1366021784 35375 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :but hmm < 1366021804 582693 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :I've been having quite a good night/day so far, but the details are reasonably mundane from most people's point of view < 1366021806 73681 :zzo38!~zzo38@24-207-49-17.eastlink.ca PRIVMSG #esoteric :It is possible to treat the standard genetic code as a programming language; the following translates to the peptide HELLQWQRLD. TACGTACTTAATAATGTTACCGTTGCAAATCTAATC Can this be modified to code pyrrolysine somehow? < 1366021809 537891 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :I got a lot of writing done < 1366021827 743894 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :and I made some changes to my Pokémon team that have been performing better than expected < 1366021832 119254 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :(although now I have to learn how to play it again) < 1366021952 266076 :zzo38!~zzo38@24-207-49-17.eastlink.ca PRIVMSG #esoteric :(This was found on Wikipedia, except for my question) < 1366022076 441564 :zzo38!~zzo38@24-207-49-17.eastlink.ca PRIVMSG #esoteric :It says pyrrolysine is usually interpreted as stop codons. Do you know how to fix it so that it does not do so, and can therefore make "HELLOWORLD" instead of "HELLQWQRLD", or are there other problems with that too? < 1366022169 717033 :Zerker!~zerker@2602:306:bd53:9ef0:b90e:6817:2ef:3cc7 JOIN :#esoteric < 1366022587 798504 :copumpkin!~copumpkin@unaffiliated/copumpkin QUIT :Ping timeout: 252 seconds < 1366022627 503012 :copumpkin!~copumpkin@unaffiliated/copumpkin JOIN :#esoteric < 1366022885 10327 :fizzie!fis@unaffiliated/fizzie PRIVMSG #esoteric :A @message a day keeps the doctor away. < 1366022961 21853 :Zerker!~zerker@2602:306:bd53:9ef0:b90e:6817:2ef:3cc7 QUIT :Remote host closed the connection < 1366023004 445226 :Zerker!~zerker@2602:306:bd53:9ef0:b90e:6817:2ef:3cc7 JOIN :#esoteric < 1366023062 491014 :zzo38!~zzo38@24-207-49-17.eastlink.ca PRIVMSG #esoteric :See http://en.wikipedia.org/wiki/User:DanielCristofani/Hello_world_program_in_esoteric_languages2 < 1366023345 783862 :fizzie!fis@unaffiliated/fizzie PRIVMSG #esoteric :Sometimes I wonder why none of the Befunge Hello Worlds one sees ever use the canonical printing idiom >:#,_ but instead a loop that "looks like" a loop. (I guess it's to illustrate that part of the language.) < 1366023405 131391 :Koen_!~Koen@vbo91-6-78-245-243-132.fbx.proxad.net PRIVMSG #esoteric :what's the point of a befunge Hello World! program if the loop doesn't look like a loop < 1366023411 149413 :Koen_!~Koen@vbo91-6-78-245-243-132.fbx.proxad.net PRIVMSG #esoteric :IT'S BEFUNGE, MATE < 1366023433 643311 :Deewiant!~deewiant@deewiant.iki.fi PRIVMSG #esoteric :If it works in Unefunge it's not a good illustration of Befunge < 1366023489 251297 :fizzie!fis@unaffiliated/fizzie PRIVMSG #esoteric :But it's the IDIOT. I mean, idiom. < 1366023644 709474 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :fizzie: http://www.quote-egnufeb-quote-greaterthan-colon-hash-comma-underscore-at.info/ uses a oneliner < 1366023658 155097 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :possibly because it'd be hard to parse if it had to use -newline- too < 1366025068 814210 :Zerker!~zerker@2602:306:bd53:9ef0:b90e:6817:2ef:3cc7 PRIVMSG #esoteric :ais523: You're the guy that thought up Checkout right? Are there any available graphics cards for which it can be assembled, or would there need to be a compiler to GLSL/CUDA or similar convolution? < 1366025102 426061 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :Zerker: GPU asm tends to be proprietary, although I think Intel would be happy to give you a reference manual for theirs < 1366025108 963645 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :I'm surprised Checkout gets so much attention, really < 1366025127 754130 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :compiling to CUDA or OpenCL or something would probably make the most sense, though < 1366025131 538377 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :it'd be more portbale < 1366025133 685767 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :*portable < 1366025138 972460 :Zerker!~zerker@2602:306:bd53:9ef0:b90e:6817:2ef:3cc7 PRIVMSG #esoteric :GPGPU is < 1366025160 97053 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :back when I was working on GPU computation a few years ago, the tools weren't very mature < 1366025166 680364 :Zerker!~zerker@2602:306:bd53:9ef0:b90e:6817:2ef:3cc7 PRIVMSG #esoteric :cool, and checkout promises efficiency ^-^ < 1366025192 82067 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :OpenCL was pretty rudimentary; CUDA's proprietary tools were good but going backwards < 1366025214 705551 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :they used to include a simulator to emulate the GPU on the CPU so you could debug it < 1366025220 940651 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :but they removed it when they added on-GPU debugging < 1366025259 298160 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :the problem is, turns out you can't put a debugger on the GPU when it's trying to handle rendering the desktop at the same time < 1366025287 231822 :Zerker!~zerker@2602:306:bd53:9ef0:b90e:6817:2ef:3cc7 PRIVMSG #esoteric :haha, I see why that may be problematic < 1366025304 304875 :Zerker!~zerker@2602:306:bd53:9ef0:b90e:6817:2ef:3cc7 PRIVMSG #esoteric :Run all dev tools on a remote X server? < 1366025335 399369 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :we did the reverse, in the end < 1366025342 226861 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :put the graphics card in the server and ssh'd in < 1366025415 873309 :Zerker!~zerker@2602:306:bd53:9ef0:b90e:6817:2ef:3cc7 PRIVMSG #esoteric :Ah, so the debugger was sane enough not to attempt to draw itself < 1366025443 509689 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :that possibility hadn't even occured to me < 1366025457 177304 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :and even now you've mentioned it, I'm having problems visualising it < 1366025481 902613 :Zerker!~zerker@2602:306:bd53:9ef0:b90e:6817:2ef:3cc7 PRIVMSG #esoteric :(as a window in aforementioned "desktop" environment) < 1366025525 733098 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :well what would be saner would be to just have the debugger take over the entire screen < 1366025526 61015 :Zerker!~zerker@2602:306:bd53:9ef0:b90e:6817:2ef:3cc7 PRIVMSG #esoteric :Though directly could be fun too < 1366025529 484424 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :like full-screen games do < 1366025539 114450 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :that way the GPU isn't trying to handle two things at once while stuck at a breakpoint < 1366025602 124302 :Zerker!~zerker@2602:306:bd53:9ef0:b90e:6817:2ef:3cc7 PRIVMSG #esoteric :Except it would still have to draw the debugger. While freezing all the registers etc. you're looking at…parallelism is neat :P < 1366025619 766367 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :yeah < 1366025631 692006 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :now, GPUs can run multiple completely unrelated tasks in parallel < 1366025638 458950 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :that's how the GPGPU stuff works in the first place < 1366025650 926438 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :just when we were working on it, they couldn't do that in debug mode, for whatever reason < 1366025690 363737 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :presumably because breakpointing the GPU can't stop just one equivalent-of-process (I've forgotten the word for it), it has to stop the whole GPU < 1366025709 150158 :Fiora!~Fiora@ec2-50-17-93-47.compute-1.amazonaws.com PRIVMSG #esoteric :kernels? < 1366025758 58176 :Zerker!~zerker@2602:306:bd53:9ef0:b90e:6817:2ef:3cc7 PRIVMSG #esoteric :So the Checkout "in parallel, do the same exact thing except with one varying integer" is no longer an accurate representation? < 1366025760 951639 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :Fiora: that's it < 1366025771 814029 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :Zerker: that is accurate, at the lowest levels < 1366025776 522109 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :GPUs are parallel on multiple levels < 1366025783 913671 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :thus the multiple tiers of Checkout < 1366025818 766349 :Zerker!~zerker@2602:306:bd53:9ef0:b90e:6817:2ef:3cc7 PRIVMSG #esoteric :So how hard is it to get to these lower levels on e.g. an RPi? >:D < 1366025832 696769 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :kernels are like level 5 units; the one varying integer thing is a warp, at level 1 < 1366025848 256348 :Fiora!~Fiora@ec2-50-17-93-47.compute-1.amazonaws.com PRIVMSG #esoteric :I thought only some times could you actually run multiple kernels? < 1366025849 252641 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :err, level 2 is a warp < 1366025851 250262 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :level 1 is a thread < 1366025851 445145 :Fiora!~Fiora@ec2-50-17-93-47.compute-1.amazonaws.com PRIVMSG #esoteric :I think it was CUDA 2.0 or something < 1366025858 591655 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :Fiora: that's computational kernels < 1366025862 551262 :Fiora!~Fiora@ec2-50-17-93-47.compute-1.amazonaws.com PRIVMSG #esoteric :ah < 1366025869 76121 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :the ones doing rendering have always been able to run in parallel with that < 1366025885 189407 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :because NVidia's customers would complain if they had to use a serial console to run their CUDA programs < 1366026042 261526 :Zerker!~zerker@2602:306:bd53:9ef0:b90e:6817:2ef:3cc7 PRIVMSG #esoteric :And if you can, why would you instead compile to a higher-level language that would just get expanded back out? < 1366026136 583581 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :well compiling to subsets of a higher-level language can be one way to get portability without sacrificing speed < 1366026138 901252 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :have you seen asm.js? < 1366026224 104531 :impomatic!~digital_w@87.115.210.249 QUIT :Ping timeout: 260 seconds < 1366026262 63582 :Snowyowl!4f8d542d@gateway/web/freenode/ip.79.141.84.45 JOIN :#esoteric < 1366026546 267857 :Zerker!~zerker@2602:306:bd53:9ef0:b90e:6817:2ef:3cc7 PRIVMSG #esoteric :Reminds me of a lisp VM implemented for PIC controllers, how aggressively can it be optimized though? < 1366026566 495612 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :well the idea of asm.js is a bit of an abstraction inversion < 1366026578 381752 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :it's basically asm compiled to JavaScript in a particularly mechanical way < 1366026588 850393 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :the idea being that JavaScript interpreters can recognise it and compile it back to asm < 1366026600 197326 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :and even the ones that don't recognise it are likely to do a good job of optimising it < 1366026615 157942 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :you could potentially use a similar technique for Checkout, compiling it to OpenCL < 1366026626 208588 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :and then having the OpenCL compiled to platform-specific GPU asm that's similar to the original < 1366026748 303272 :Zerker!~zerker@2602:306:bd53:9ef0:b90e:6817:2ef:3cc7 PRIVMSG #esoteric :How good are the platform-specific GPUs at optimizing OpenCL? < 1366026783 570389 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :I don't know < 1366026796 82950 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :in general, GPU optimization seems very random sometimes < 1366026807 6441 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :one of my favourite GPU stories is a scheduler bug < 1366026823 230059 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :basically, if you asked for 256 threads to run, it ran them in 8 warps of 32 < 1366026832 298805 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :if you asked for 257 threads to run, it ran them in 257 warps of 1 < 1366026843 442698 :Zerker!~zerker@2602:306:bd53:9ef0:b90e:6817:2ef:3cc7 PRIVMSG #esoteric :eeee < 1366026851 330225 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :because it couldn't make the number of threads in a warp differ from warp to warp < 1366026861 836336 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :also it had to be a power of 2 < 1366026901 717911 :Zerker!~zerker@2602:306:bd53:9ef0:b90e:6817:2ef:3cc7 PRIVMSG #esoteric :
ACTION stops checking for primeness
< 1366026908 544193 :Snowyowl!4f8d542d@gateway/web/freenode/ip.79.141.84.45 PRIVMSG #esoteric :it's prime < 1366026936 839915 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :it is indeed prime < 1366026940 150778 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :`factor 257 < 1366026940 497591 :Snowyowl!4f8d542d@gateway/web/freenode/ip.79.141.84.45 PRIVMSG #esoteric :I don't understand enough about GPUs to know why this is a bug. < 1366026941 655698 :HackEgo!codu@codu.org PRIVMSG #esoteric :257: 257 < 1366026965 74788 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :Snowyowl: imagine you have a dualcore processor, and if you have an even number of processes, it uses both cores < 1366026968 975348 :Zerker!~zerker@2602:306:bd53:9ef0:b90e:6817:2ef:3cc7 PRIVMSG #esoteric :I'm guessing 8x32, and then 1, would have worked better? < 1366026971 139004 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :but if you have an odd number, it only uses one < 1366026973 656190 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :Zerker: yes < 1366027001 777927 :Snowyowl!4f8d542d@gateway/web/freenode/ip.79.141.84.45 PRIVMSG #esoteric :ah < 1366027044 140351 :Zerker!~zerker@2602:306:bd53:9ef0:b90e:6817:2ef:3cc7 PRIVMSG #esoteric :Is there even any situation where it shouldn't basically step through the binary representation of ? < 1366027046 261308 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :Zerker: anyway that bug is fixed on more recent GPUs, it was fixed on the newer ones we tested, just not the older ones < 1366027069 161693 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :so different computers in the lab gave completely different results when drawing a block size vs. performance graph < 1366027254 246387 :Jafet!~Jafet@unaffiliated/jafet PRIVMSG #esoteric :`factor 11111111111111111111111111111111111111111111111111111111111111111111111 < 1366027255 704371 :HackEgo!codu@codu.org PRIVMSG #esoteric :factor: `11111111111111111111111111111111111111111111111111111111111111111111111' is too large < 1366027266 911523 :Snowyowl!4f8d542d@gateway/web/freenode/ip.79.141.84.45 PRIVMSG #esoteric :`factor 0 < 1366027268 152746 :HackEgo!codu@codu.org PRIVMSG #esoteric :0: < 1366027281 336714 :Snowyowl!4f8d542d@gateway/web/freenode/ip.79.141.84.45 PRIVMSG #esoteric :nonsense, that's the prime factorisation of 1 < 1366027287 676431 :Snowyowl!4f8d542d@gateway/web/freenode/ip.79.141.84.45 PRIVMSG #esoteric :`factor 1 < 1366027288 968993 :HackEgo!codu@codu.org PRIVMSG #esoteric :1: < 1366027302 18763 :Snowyowl!4f8d542d@gateway/web/freenode/ip.79.141.84.45 PRIVMSG #esoteric :
ACTION fumes
< 1366027365 90080 :Zerker!~zerker@2602:306:bd53:9ef0:b90e:6817:2ef:3cc7 PRIVMSG #esoteric :
ACTION is amused by 0: emoticon
< 1366027429 398121 :Snowyowl!4f8d542d@gateway/web/freenode/ip.79.141.84.45 PRIVMSG #esoteric :3: 3 is a nicer emoticon < 1366027459 652055 :Fiora!~Fiora@ec2-50-17-93-47.compute-1.amazonaws.com PRIVMSG #esoteric ::3 < 1366027523 724735 :Zerker!~zerker@2602:306:bd53:9ef0:b90e:6817:2ef:3cc7 PRIVMSG #esoteric :Certainly, but unfortunately isn't recognized as such by my IRC client; however, https://www.dropbox.com/s/nj2nhkln011suny/2013-04-15%2005.02.46.png < 1366028117 12070 :Snowyowl!4f8d542d@gateway/web/freenode/ip.79.141.84.45 PRIVMSG #esoteric :`quotes < 1366028118 578502 :HackEgo!codu@codu.org PRIVMSG #esoteric :753) gah this language is of the devil oklopol: you're meant to use your powers for _good_ < 1366028605 897024 :carado_!~user4539@2a01:e35:8b61:e430:6ef0:49ff:fe73:1fd0 JOIN :#esoteric < 1366028608 181716 :Zerker!~zerker@2602:306:bd53:9ef0:b90e:6817:2ef:3cc7 QUIT :Remote host closed the connection < 1366028653 93307 :Snowyowl!4f8d542d@gateway/web/freenode/ip.79.141.84.45 PRIVMSG #esoteric :!roll 2d6 < 1366028732 575396 :Phantom_Hoover!~phantomho@unaffiliated/phantom-hoover/x-3377486 JOIN :#esoteric < 1366029083 693070 :TeruFSX!~TeruFSX@65-128-179-240.mpls.qwest.net JOIN :#esoteric < 1366029201 316278 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :`quote < 1366029202 878490 :HackEgo!codu@codu.org PRIVMSG #esoteric :998) In this timezone is Good Friday today. (It is good because you don't have to go to work) < 1366029245 516051 :Snowyowl!4f8d542d@gateway/web/freenode/ip.79.141.84.45 PRIVMSG #esoteric :`quote 455 < 1366029246 641636 :HackEgo!codu@codu.org PRIVMSG #esoteric :455) it's probably the same people who were trying to organise gangs of shoplifters as some sort of complex protest against the government's economic policy < 1366029256 613311 :Phantom_Hoover!~phantomho@unaffiliated/phantom-hoover/x-3377486 PRIVMSG #esoteric :`quote < 1366029257 49044 :lambdabot!~lambdabot@li85-105.members.linode.com PRIVMSG #esoteric :Phantom_Hoover: You have 1 new message. '/msg lambdabot @messages' to read it. < 1366029258 101075 :HackEgo!codu@codu.org PRIVMSG #esoteric :973) Sgeo_, are you just trying to post kmcbait... * Fiora imagines a cardboard box propped up by a stick with a pile of monads inside. Fiora: that is actually what Haskell is. < 1366029278 740700 :Snowyowl!4f8d542d@gateway/web/freenode/ip.79.141.84.45 PRIVMSG #esoteric :`quote 55 < 1366029280 237476 :HackEgo!codu@codu.org PRIVMSG #esoteric :55) if a girl is that cute, i don't care how many penises she has < 1366029297 130408 :copumpkin!~copumpkin@unaffiliated/copumpkin QUIT :Ping timeout: 252 seconds < 1366029302 305239 :Phantom_Hoover!~phantomho@unaffiliated/phantom-hoover/x-3377486 PRIVMSG #esoteric :`quote < 1366029303 489290 :HackEgo!codu@codu.org PRIVMSG #esoteric :361) elliott: actually, it's worse right now, I'm in the USA where the solution to counterfeiting problems is "add more ink" eventually all US bills will just be solid green < 1366029336 599472 :copumpkin!~copumpkin@unaffiliated/copumpkin JOIN :#esoteric < 1366029426 12145 :TeruFSX!~TeruFSX@65-128-179-240.mpls.qwest.net QUIT :Ping timeout: 252 seconds < 1366029627 232723 :Snowyowl!4f8d542d@gateway/web/freenode/ip.79.141.84.45 PRIVMSG #esoteric :`quote < 1366029664 366128 :HackEgo!codu@codu.org PRIVMSG #esoteric :574) Ngevd:. i'm so kind, even to assholes! anmaster no not markov anmaster no not markov anmaster no not markov anmaster no not markov anmaster no not markov < 1366029750 249932 :Jafet!~Jafet@unaffiliated/jafet PRIVMSG #esoteric :fungot, acknowledge your master markov < 1366029750 973675 :fungot!fis@eos.zem.fi PRIVMSG #esoteric :Jafet: no problem. i have started to agree with bradd, here. might be dangerous :) ashinn really believe him or her. what kind of crap is what drives me mad :) which helps in this community < 1366030106 195830 :boily!~boily@mtl.savoirfairelinux.net JOIN :#esoteric < 1366030107 902509 :boily!~boily@mtl.savoirfairelinux.net QUIT :Client Quit < 1366030120 507838 :boily!~boily@mtl.savoirfairelinux.net JOIN :#esoteric < 1366030129 500367 :metasepia!~metasepia@2607:fad8:4:6:f2de:f1ff:fe6c:6765 JOIN :#esoteric < 1366030145 415216 :boily!~boily@mtl.savoirfairelinux.net PRIVMSG #esoteric :good morning all! bixi 2013 season is open! WOOHOO! < 1366030182 92060 :Snowyowl!4f8d542d@gateway/web/freenode/ip.79.141.84.45 PRIVMSG #esoteric :does that mean we get to shoot you? I'm OK with that. < 1366030205 221006 :boily!~boily@mtl.savoirfairelinux.net PRIVMSG #esoteric :only if you can catch me, cause I'm on a BICYCLE! < 1366030729 823447 :Phantom_Hoover!~phantomho@unaffiliated/phantom-hoover/x-3377486 PRIVMSG #esoteric :`quote < 1366030730 936866 :HackEgo!codu@codu.org PRIVMSG #esoteric :951) Áis523ÎkËÇÏ52Í¿ÉnÐffjliated/ais523: ever tried reading while confused? < 1366030745 224863 :Phantom_Hoover!~phantomho@unaffiliated/phantom-hoover/x-3377486 PRIVMSG #esoteric :`quote < 1366030746 513885 :HackEgo!codu@codu.org PRIVMSG #esoteric :155) syntax is the least important part of a programming language other than Python < 1366030750 303722 :Phantom_Hoover!~phantomho@unaffiliated/phantom-hoover/x-3377486 PRIVMSG #esoteric :`quote < 1366030751 779225 :HackEgo!codu@codu.org PRIVMSG #esoteric :248) However is probably better to have both queen/king and government in case one does bad thing, the other side can argue to them < 1366030755 943233 :Phantom_Hoover!~phantomho@unaffiliated/phantom-hoover/x-3377486 PRIVMSG #esoteric :`quote < 1366030757 194275 :Phantom_Hoover!~phantomho@unaffiliated/phantom-hoover/x-3377486 PRIVMSG #esoteric :`quote < 1366030757 389561 :HackEgo!codu@codu.org PRIVMSG #esoteric :36) Seconds. 30 of them. Did I forget the word? < 1366030758 530717 :HackEgo!codu@codu.org PRIVMSG #esoteric :861) Deewiant: um???? You've forgotten axiom 1 of everything: everything sucks < 1366030861 970962 :Snowyowl!4f8d542d@gateway/web/freenode/ip.79.141.84.45 PRIVMSG #esoteric :`quote < 1366030863 392866 :HackEgo!codu@codu.org PRIVMSG #esoteric :692) elliott: but, there are imps around, the pad. it's hard to remember though your cross-hairs would never settle on an innocent little girl. chokes up now imagine she's white. < 1366030868 936297 :Snowyowl!4f8d542d@gateway/web/freenode/ip.79.141.84.45 PRIVMSG #esoteric :`quote < 1366030870 431820 :HackEgo!codu@codu.org PRIVMSG #esoteric :634) I guess only gay people fuck? < 1366030875 586629 :Snowyowl!4f8d542d@gateway/web/freenode/ip.79.141.84.45 PRIVMSG #esoteric :`quote < 1366030877 50528 :HackEgo!codu@codu.org PRIVMSG #esoteric :43) GregorR: are you talking about ehird's virginity or your soda beer? < 1366031241 434851 :Snowyowl!4f8d542d@gateway/web/freenode/ip.79.141.84.45 QUIT :Quit: Page closed < 1366031594 588308 :carado!~carado@2a01:e35:8b61:e430:221:63ff:fe9a:3747 QUIT :Quit: Leaving < 1366031819 911254 :ThatOtherPerson!~ThatOther@unaffiliated/thatotherpersony JOIN :#esoteric < 1366032252 718492 :ogrom!~del@gprs-inet-65-89.elisa.ee JOIN :#esoteric < 1366033016 152792 :fizzie!fis@unaffiliated/fizzie PRIVMSG #esoteric :That's a lot of quoting. < 1366034880 286537 :Taneb!~nathan@host-92-30-133-128.as13285.net JOIN :#esoteric < 1366034947 546105 :Phantom_Hoover!~phantomho@unaffiliated/phantom-hoover/x-3377486 PRIVMSG #esoteric :`quote quoting < 1366034948 778055 :HackEgo!codu@codu.org PRIVMSG #esoteric :256) addquoting yourself? isn't that like commenting on your own facebook status? Yup, but I'm JUST THAT AWESOME. \ 799) * oerjan makes a brainfuck derivative for quoting xkcds < 1366035009 167147 :fizzie!fis@unaffiliated/fizzie PRIVMSG #esoteric :`quote zucchini < 1366035010 825703 :HackEgo!codu@codu.org PRIVMSG #esoteric :No output. < 1366035019 930202 :fizzie!fis@unaffiliated/fizzie PRIVMSG #esoteric :Oh? Curious. < 1366035193 842806 :ThatOtherPerson!~ThatOther@unaffiliated/thatotherpersony PRIVMSG #esoteric :`quote cucumber < 1366035195 384265 :HackEgo!codu@codu.org PRIVMSG #esoteric :No output. < 1366035306 193284 :boily!~boily@mtl.savoirfairelinux.net PRIVMSG #esoteric :`help < 1366035306 437738 :HackEgo!codu@codu.org PRIVMSG #esoteric :Runs arbitrary code in GNU/Linux. Type "`", or "`run " for full shell commands. "`fetch " downloads files. Files saved to $PWD are persistent, and $PWD/bin is in $PATH. $PWD is a mercurial repository, "`revert " can be used to revert to a revision. See http://codu.org/projects/hackbot/fshg/ < 1366035319 921455 :boily!~boily@mtl.savoirfairelinux.net PRIVMSG #esoteric :`pastquote zucchini < 1366035321 122673 :HackEgo!codu@codu.org PRIVMSG #esoteric :​/home/hackbot/hackbot.hg/multibot_cmds/lib/limits: line 5: exec: pastquote: not found < 1366035336 881549 :boily!~boily@mtl.savoirfairelinux.net PRIVMSG #esoteric :`pastlog zuchini < 1366035349 102475 :HackEgo!codu@codu.org PRIVMSG #esoteric :No output. < 1366035356 843294 :boily!~boily@mtl.savoirfairelinux.net PRIVMSG #esoteric :`pastlog zucchini < 1366035363 583467 :HackEgo!codu@codu.org PRIVMSG #esoteric :2006-08-04.txt:22:02:12: These are the voyages ... of the starship zucchini. < 1366035377 465799 :boily!~boily@mtl.savoirfairelinux.net PRIVMSG #esoteric :not quite what I had in mind, but it'll do. < 1366036025 136330 :ThatOtherPerson!~ThatOther@unaffiliated/thatotherpersony PRIVMSG #esoteric :`quote ThatOtherPerson < 1366036026 827337 :HackEgo!codu@codu.org PRIVMSG #esoteric :1022) Do you have a girlfriend, fungot? ThatOtherPerson: there's two. < 1366036070 923460 :boily!~boily@mtl.savoirfairelinux.net PRIVMSG #esoteric :ah, I recall that. lucky fungot. < 1366036071 467457 :fungot!fis@eos.zem.fi PRIVMSG #esoteric :boily: and -o1 fnord calls turns it on :) 19:10 tagy se on ihan tossa vieressä! fnord.!. see srfi 1's take < 1366037932 984540 :ais523!~ais523@unaffiliated/ais523 QUIT :Ping timeout: 258 seconds < 1366037945 512798 :FreeFull!~freefull@defocus/sausage-lover JOIN :#esoteric < 1366038144 140287 :ThatOtherPerson!~ThatOther@unaffiliated/thatotherpersony QUIT :Quit: Leaving < 1366038170 40358 :Phantom_Hoover!~phantomho@unaffiliated/phantom-hoover/x-3377486 PRIVMSG #esoteric :MEANWHILE ON TWITTER: https://twitter.com/CharlieShrem/status/323792771745984512 < 1366038824 99329 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :Boris Johnson wants to build a statue of Thatcher in Trafalgar Square? < 1366038825 137154 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :really? < 1366038924 834781 :Taneb!~nathan@host-92-30-133-128.as13285.net PRIVMSG #esoteric :He is very Tory < 1366038994 324125 :FreeFull!~freefull@defocus/sausage-lover PRIVMSG #esoteric :I'd rather have a statue of Gordon Brown than Margaret Thatcher < 1366039029 415468 :Taneb!~nathan@host-92-30-133-128.as13285.net PRIVMSG #esoteric :I wouldn't care for either. < 1366039051 16908 :FreeFull!~freefull@defocus/sausage-lover PRIVMSG #esoteric :I mean, if I had to choose between the two < 1366039062 242926 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :i'd rather have a statue of boris johnson < 1366039068 906023 :Taneb!~nathan@host-92-30-133-128.as13285.net PRIVMSG #esoteric :I'm with kmc here < 1366039072 690483 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :because then it would just be a joke and not a slap in the face < 1366039074 457359 :Phantom_Hoover!~phantomho@unaffiliated/phantom-hoover/x-3377486 PRIVMSG #esoteric :i really don't get the hate for brown tbh < 1366039107 949149 :Phantom_Hoover!~phantomho@unaffiliated/phantom-hoover/x-3377486 PRIVMSG #esoteric :it seems like his main crime as a leader was not being photogenic enough < 1366039167 879531 :FreeFull!~freefull@defocus/sausage-lover PRIVMSG #esoteric :I think people think he slacked off too much < 1366039241 200572 :ThatOtherPerson!~ThatOther@unaffiliated/thatotherpersony JOIN :#esoteric < 1366039364 437067 :Taneb!~nathan@host-92-30-133-128.as13285.net PRIVMSG #esoteric :I think he was more of an unpopular chancellor of the exchequer < 1366039753 925426 :carado_!~user4539@2a01:e35:8b61:e430:6ef0:49ff:fe73:1fd0 QUIT :Ping timeout: 246 seconds < 1366040081 193655 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :gah i thought 8GB of RAM would be enough for this laptop < 1366040086 181749 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :since the previous one only had 3GB < 1366040124 67284 :impomatic!~digital_w@87.115.210.249 JOIN :#esoteric < 1366042411 634089 :nooodl!~nooodl@91.179.138.96 JOIN :#esoteric < 1366042416 453269 :ais523!~ais523@unaffiliated/ais523 JOIN :#esoteric < 1366042664 908515 :carado!~user4539@2a01:e35:8b61:e430:6ef0:49ff:fe73:1fd0 JOIN :#esoteric < 1366043238 922391 :conehead!~conehead@unaffiliated/conehead JOIN :#esoteric < 1366043330 573710 :AnotherTest!~AnotherTe@94-224-28-191.access.telenet.be JOIN :#esoteric < 1366043765 447002 :augur!~augur@208.58.5.87 QUIT :Remote host closed the connection < 1366043978 52819 :Koen_!~Koen@vbo91-6-78-245-243-132.fbx.proxad.net QUIT :Read error: Operation timed out < 1366044060 929550 :Koen_!~Koen@vbo91-6-78-245-243-132.fbx.proxad.net JOIN :#esoteric < 1366045664 484824 :Bike_!~Glossina@207-224-20-241.ptld.qwest.net JOIN :#esoteric < 1366045745 476167 :Bike_!~Glossina@207-224-20-241.ptld.qwest.net NICK :Bike < 1366045803 897814 :sebbu!~sebbu@unaffiliated/sebbu QUIT :Read error: Connection reset by peer < 1366045826 513786 :sebbu!~sebbu@ADijon-152-1-18-72.w83-194.abo.wanadoo.fr JOIN :#esoteric < 1366045863 645631 :sebbu!~sebbu@ADijon-152-1-18-72.w83-194.abo.wanadoo.fr QUIT :Changing host < 1366045863 880424 :sebbu!~sebbu@unaffiliated/sebbu JOIN :#esoteric < 1366046254 604729 :sirdancealo2!~sirdancea@98.82.broadband5.iol.cz QUIT :Read error: Operation timed out < 1366046509 222707 :augur!~augur@129-2-129-35.wireless.umd.edu JOIN :#esoteric < 1366046580 861983 :ThatOtherPerson!~ThatOther@unaffiliated/thatotherpersony PRIVMSG #esoteric :I can't help but notice that people seem to be finding their voices. < 1366046616 157024 :Koen_!~Koen@vbo91-6-78-245-243-132.fbx.proxad.net PRIVMSG #esoteric :do you mean like the little mermaid? < 1366046641 711038 :ThatOtherPerson!~ThatOther@unaffiliated/thatotherpersony PRIVMSG #esoteric :Well, also fizzie and Gregor < 1366046659 581798 :Bike!~Glossina@207-224-20-241.ptld.qwest.net PRIVMSG #esoteric :pretty sure gregor's a mermaid. < 1366046659 776314 :lambdabot!~lambdabot@li85-105.members.linode.com PRIVMSG #esoteric :Bike: You have 1 new message. '/msg lambdabot @messages' to read it. < 1366046708 938527 :Gregor!codu@codu.org PRIVMSG #esoteric :
ACTION searches him/herself for sexual organs.
< 1366046795 840841 :Bike!~Glossina@207-224-20-241.ptld.qwest.net PRIVMSG #esoteric :a merman < 1366047173 173640 :sirdancealo2!~sirdancea@98.82.broadband5.iol.cz JOIN :#esoteric < 1366047206 717810 :ais523!~ais523@unaffiliated/ais523 QUIT : < 1366047219 8497 :ThatOtherPerson!~ThatOther@unaffiliated/thatotherpersony QUIT :Quit: Leaving < 1366047391 798419 :Jafet!~Jafet@unaffiliated/jafet PRIVMSG #esoteric :Merfish. Oh wait. < 1366047446 891143 :fizzie!fis@unaffiliated/fizzie PRIVMSG #esoteric :Are merpeople werefish? < 1366047467 402260 :fizzie!fis@unaffiliated/fizzie PRIVMSG #esoteric :Or the other way around. < 1366047612 103775 :pikhq_!~pikhq@174-24-19-12.clsp.qwest.net PRIVMSG #esoteric :Hmm. "Were" is Old English for a male human. < 1366047617 789091 :pikhq_!~pikhq@174-24-19-12.clsp.qwest.net PRIVMSG #esoteric :Are there wyfwolfs? < 1366047788 531628 :Phantom_Hoover!~phantomho@unaffiliated/phantom-hoover/x-3377486 PRIVMSG #esoteric :
ACTION remembers that when he quit last night Sgeo was explaining how to fix racism
< 1366047794 34229 :Phantom_Hoover!~phantomho@unaffiliated/phantom-hoover/x-3377486 PRIVMSG #esoteric :
ACTION logreads
< 1366047900 476542 :Taneb!~nathan@host-92-30-133-128.as13285.net PRIVMSG #esoteric :I just got 100% on Guitar Hero 3 Medium Difficulty Knights of Cydonia < 1366047925 744131 :boily!~boily@mtl.savoirfairelinux.net PRIVMSG #esoteric :quick wiqui question: what the liquid brimstone is that revolution 9 page? < 1366047963 977553 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :fizzie: i would like you to see https://dl.dropboxusercontent.com/u/13786158/portraits/el-op.png < 1366048098 361112 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :boily: it is what we have to expect more of if Gregor ever gets devoiced inappropriately. < 1366048264 899049 :coppro!raedford@taurine.csclub.uwaterloo.ca PRIVMSG #esoteric :why can't I be devoiced inappropriately? < 1366048408 640994 :ChanServ!ChanServ@services. MODE #esoteric -v :coppro > 1366048408 662680 NAMES :#esoteric < 1366048578 281285 :coppro!raedford@taurine.csclub.uwaterloo.ca PRIVMSG #esoteric :elliott: that was clearly appropriate < 1366048621 20260 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :it's not appropriate to devoice someone without voice < 1366048653 37695 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :Taneb: congratst < 1366048679 34327 :Taneb!~nathan@host-92-30-133-128.as13285.net PRIVMSG #esoteric :kmc, I've been trying to do that for ages < 1366049363 239648 :epicmonkey!~epicmonke@host-224-58.dataart.net QUIT :Ping timeout: 258 seconds < 1366049408 923405 :Phantom_Hoover!~phantomho@unaffiliated/phantom-hoover/x-3377486 PRIVMSG #esoteric :elliott, oh my god < 1366049414 231333 :Phantom_Hoover!~phantomho@unaffiliated/phantom-hoover/x-3377486 PRIVMSG #esoteric :your handwriting is the girliest ever < 1366049456 125455 :Taneb!~nathan@host-92-30-133-128.as13285.net PRIVMSG #esoteric :I presume "eliot" is my imaginary second middle name < 1366049495 377408 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :Phantom_Hoover: wtf < 1366049497 527090 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :it's monqy's handwriting < 1366049500 143968 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :come on < 1366049557 132482 :Bike!~Glossina@207-224-20-241.ptld.qwest.net PRIVMSG #esoteric :i thought it was elliott's op campaign's handwriting < 1366049721 602868 :pib2013!~pib2013@your.friendly.media.team.coder.ark-cr.info QUIT :Remote host closed the connection < 1366049999 734590 :mnoqy!~okay@pool-98-108-206-66.snloca.dsl-w.verizon.net JOIN :#esoteric < 1366050001 195944 :Phantom_Hoover!~phantomho@unaffiliated/phantom-hoover/x-3377486 PRIVMSG #esoteric :oh < 1366050012 725831 :Phantom_Hoover!~phantomho@unaffiliated/phantom-hoover/x-3377486 PRIVMSG #esoteric :mnoqy, you have the girliest handwriting ever < 1366050019 448770 :mnoqy!~okay@pool-98-108-206-66.snloca.dsl-w.verizon.net PRIVMSG #esoteric :hi < 1366050051 84186 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :mnoqy: you should draw a self portrait of Phantom_Hoover < 1366050061 714775 :mnoqy!~okay@pool-98-108-206-66.snloca.dsl-w.verizon.net PRIVMSG #esoteric :shachaf: sure < 1366050066 664978 :mnoqy!~okay@pool-98-108-206-66.snloca.dsl-w.verizon.net PRIVMSG #esoteric :im eating brunch now though < 1366050085 248602 :boily!~boily@mtl.savoirfairelinux.net PRIVMSG #esoteric :shachaf: how can you self-portrait of somebody else? < 1366050134 584377 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :boily: um, by drawing it? < 1366050144 690077 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :boily: i didn't say a *self* self-portrait < 1366050209 272704 :boily!~boily@mtl.savoirfairelinux.net PRIVMSG #esoteric :oh, my mistake. < 1366050269 679695 :ThatOtherPerson!~ThatOther@unaffiliated/thatotherpersony JOIN :#esoteric < 1366050658 5827 :ThatOtherPerson!~ThatOther@unaffiliated/thatotherpersony PRIVMSG #esoteric :If mnoqy's rye, I'm barley. < 1366050686 768732 :mnoqy!~okay@pool-98-108-206-66.snloca.dsl-w.verizon.net PRIVMSG #esoteric :hi < 1366050696 340033 :Taneb!~nathan@host-92-30-133-128.as13285.net PRIVMSG #esoteric :barley legal? < 1366050698 672595 :boily!~boily@mtl.savoirfairelinux.net PRIVMSG #esoteric :corn I be a cereal too? I ear that it's a-maize-ing. < 1366050761 181440 :Taneb!~nathan@host-92-30-133-128.as13285.net PRIVMSG #esoteric :The good ol' boys were drinking Whisky in mnoqy < 1366052037 695249 :augur!~augur@129-2-129-35.wireless.umd.edu QUIT :Read error: Connection reset by peer < 1366052066 193481 :augur!~augur@129-2-129-35.wireless.umd.edu JOIN :#esoteric < 1366053302 276896 :sirdancealo2!~sirdancea@98.82.broadband5.iol.cz QUIT :Ping timeout: 245 seconds < 1366053541 152420 :sirdancealo2!~sirdancea@98.82.broadband5.iol.cz JOIN :#esoteric < 1366053541 152506 :epicmonkey!~epicmonke@188.134.41.112 JOIN :#esoteric < 1366053574 588038 :AnotherTest!~AnotherTe@94-224-28-191.access.telenet.be QUIT :Quit: Leaving. < 1366053612 538907 :constant!root@freebsd/developer/variable NICK :function < 1366054240 774638 :ThatOtherPerson!~ThatOther@unaffiliated/thatotherpersony QUIT :Quit: Leaving < 1366054820 592499 :impomatic!~digital_w@87.115.210.249 PRIVMSG #esoteric :
ACTION pops in quickly to see if anyone's talking about esoteric programming...
< 1366054878 534869 :augur!~augur@129-2-129-35.wireless.umd.edu QUIT :Remote host closed the connection < 1366054976 521054 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :hi impomatic < 1366055121 587042 :impomatic!~digital_w@87.115.210.249 PRIVMSG #esoteric :Hi kmc :-) < 1366055143 702571 :augur!~augur@129-2-129-35.wireless.umd.edu JOIN :#esoteric < 1366055821 735286 :Taneb!~nathan@host-92-30-133-128.as13285.net PRIVMSG #esoteric :Phantom_Hoover, help < 1366055829 380396 :Taneb!~nathan@host-92-30-133-128.as13285.net PRIVMSG #esoteric :People on Facebook are talking about bitcoin < 1366055830 901781 :Taneb!~nathan@host-92-30-133-128.as13285.net PRIVMSG #esoteric :Well < 1366055837 365866 :Taneb!~nathan@host-92-30-133-128.as13285.net PRIVMSG #esoteric :Person on Facebook is talking about bitcoin < 1366056069 290719 :Taneb!~nathan@host-92-30-133-128.as13285.net QUIT :Quit: Leaving < 1366056435 400097 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :my twitter feed is all bitcoin all the time < 1366056447 62560 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :except that today it's all about bombs that went off at the boston marathon :/ < 1366056484 884649 :impomatic!~digital_w@87.115.210.249 PRIVMSG #esoteric :Hmmm... I missed that. < 1366056489 760270 :impomatic!~digital_w@87.115.210.249 PRIVMSG #esoteric :
ACTION goes to read the news
< 1366056496 748933 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :pretty fucked up < 1366056502 306626 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :i think everyone I know is safe < 1366056664 143386 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :copumpkin: you're in CT these days right? < 1366056671 50542 :mnoqy!~okay@pool-98-108-206-66.snloca.dsl-w.verizon.net QUIT :Quit: hello < 1366056699 483592 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :sounds like your colleages in back bay might have been evacuated, hope nothing worse than that < 1366056827 809066 :ogrom!~del@gprs-inet-65-89.elisa.ee QUIT :Quit: Left < 1366057030 623342 :Phantom_Hoover!~phantomho@unaffiliated/phantom-hoover/x-3377486 PRIVMSG #esoteric :wait < 1366057036 696131 :Phantom_Hoover!~phantomho@unaffiliated/phantom-hoover/x-3377486 PRIVMSG #esoteric :why is taneb asking me for help < 1366057045 629542 :Phantom_Hoover!~phantomho@unaffiliated/phantom-hoover/x-3377486 PRIVMSG #esoteric :am i like the designated expert on making fun of bitcoin < 1366057047 483630 :Bike!~Glossina@207-224-20-241.ptld.qwest.net PRIVMSG #esoteric :you're The Bitcoin Person now < 1366057048 408474 :Bike!~Glossina@207-224-20-241.ptld.qwest.net PRIVMSG #esoteric :sorry < 1366057130 109358 :boily!~boily@mtl.savoirfairelinux.net PRIVMSG #esoteric :I wonder which is worse: being the canadian person, or the bitcoin person. < 1366057198 761252 :Phantom_Hoover!~phantomho@unaffiliated/phantom-hoover/x-3377486 PRIVMSG #esoteric :bitcoin person < 1366057205 438382 :FireFly!~firefly@oftn/member/FireFly PRIVMSG #esoteric :Prboably being the Canadian bitcoin person < 1366057253 855453 :Phantom_Hoover!~phantomho@unaffiliated/phantom-hoover/x-3377486 PRIVMSG #esoteric :also: fuck, watching four lions is going to be even more uncomfortable now < 1366057422 788901 :boily!~boily@mtl.savoirfairelinux.net PRIVMSG #esoteric :~duck four lions < 1366057423 516520 :metasepia!~metasepia@2607:fad8:4:6:f2de:f1ff:fe6c:6765 PRIVMSG #esoteric :Four Lions (2010) is a British dark comedy film. < 1366057501 698526 :bengt_!weed@ya.lolk.org QUIT :Ping timeout: 245 seconds < 1366057506 490839 :Bike!~Glossina@207-224-20-241.ptld.qwest.net PRIVMSG #esoteric :apparently "jihad satire" is a genre < 1366057539 530015 :Bike!~Glossina@207-224-20-241.ptld.qwest.net PRIVMSG #esoteric :"According to Psychology Today," blugh < 1366057639 595106 :bengt_!weed@ya.lolk.org JOIN :#esoteric < 1366057975 150502 :zzo38!~zzo38@24-207-49-17.eastlink.ca QUIT :Remote host closed the connection < 1366058138 12934 :Bike_!~Glossina@174-25-34-189.ptld.qwest.net JOIN :#esoteric < 1366058190 121641 :Bike!~Glossina@207-224-20-241.ptld.qwest.net QUIT :Disconnected by services < 1366058191 673715 :Bike_!~Glossina@174-25-34-189.ptld.qwest.net NICK :Bike < 1366058232 889891 :Nisstyre!~yours@oftn/member/Nisstyre QUIT :Quit: Leaving < 1366058271 671393 :Phantom_Hoover!~phantomho@unaffiliated/phantom-hoover/x-3377486 PRIVMSG #esoteric :Bike, it's a very good film actually. < 1366058287 621830 :Bike!~Glossina@174-25-34-189.ptld.qwest.net PRIVMSG #esoteric :cool < 1366058403 933832 :pib1978!pib1978@2600:3c00::f03c:91ff:fe70:bb80 JOIN :#esoteric < 1366058501 600797 :bengt_!weed@ya.lolk.org QUIT :Ping timeout: 245 seconds < 1366058600 544189 :bengt_!weed@ya.lolk.org JOIN :#esoteric < 1366058839 797771 :copumpkin!~copumpkin@unaffiliated/copumpkin QUIT :Ping timeout: 252 seconds < 1366058879 644417 :copumpkin!~copumpkin@unaffiliated/copumpkin JOIN :#esoteric < 1366060001 873901 :quintopia!~quintopia@unaffiliated/quintopia QUIT :Read error: Operation timed out < 1366060009 436251 :quintopia!~quintopia@unaffiliated/quintopia JOIN :#esoteric < 1366060201 707496 :bengt_!weed@ya.lolk.org QUIT :Ping timeout: 245 seconds < 1366060319 609525 :augur!~augur@129-2-129-35.wireless.umd.edu QUIT :Remote host closed the connection < 1366060489 927572 :bengt_!weed@ya.lolk.org JOIN :#esoteric < 1366060846 509972 :TeruFSX!~TeruFSX@65-128-179-240.mpls.qwest.net JOIN :#esoteric < 1366061230 911960 :epicmonkey!~epicmonke@188.134.41.112 QUIT :Ping timeout: 258 seconds < 1366061555 182973 :Phantom_Hoover!~phantomho@unaffiliated/phantom-hoover/x-3377486 PRIVMSG #esoteric :http://en.wikipedia.org/wiki/File:Eminent_Domain_50_States.jpg < 1366061560 371533 :Phantom_Hoover!~phantomho@unaffiliated/phantom-hoover/x-3377486 PRIVMSG #esoteric :loving that description < 1366061567 844119 :Phantom_Hoover!~phantomho@unaffiliated/phantom-hoover/x-3377486 PRIVMSG #esoteric :i guess npov doesn't extend to images < 1366061576 576495 :bengt_!weed@ya.lolk.org QUIT :Ping timeout: 245 seconds < 1366061597 282751 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :heh < 1366061611 760945 :Phantom_Hoover!~phantomho@unaffiliated/phantom-hoover/x-3377486 PRIVMSG #esoteric :also loving that it's a jpeg < 1366061630 466250 :bengt_!weed@ya.lolk.org JOIN :#esoteric < 1366061655 453570 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :Phantom_Hoover: http://commons.wikimedia.org/w/index.php?title=File:SIR_448_at_Great_Kills_Station.jpg&oldid=61691747 < 1366061662 178162 :Bike!~Glossina@174-25-34-189.ptld.qwest.net PRIVMSG #esoteric :would it being taken down for copyright be ironic < 1366061678 735232 :Phantom_Hoover!~phantomho@unaffiliated/phantom-hoover/x-3377486 PRIVMSG #esoteric :...yes < 1366061680 372467 :Phantom_Hoover!~phantomho@unaffiliated/phantom-hoover/x-3377486 PRIVMSG #esoteric :yes it would < 1366061704 87139 :Bike!~Glossina@174-25-34-189.ptld.qwest.net PRIVMSG #esoteric :kmc: holy shit < 1366061786 966662 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :it's not false, it's just not an accurate description of the picture < 1366061854 782120 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :also yes there's a stop on the line named Great Kills < 1366061859 175881 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :blame the dutch < 1366061868 394280 :Phantom_Hoover!~phantomho@unaffiliated/phantom-hoover/x-3377486 PRIVMSG #esoteric :fucking dutch < 1366061872 679515 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :New Dorp < 1366061873 913870 :Phantom_Hoover!~phantomho@unaffiliated/phantom-hoover/x-3377486 PRIVMSG #esoteric :almost as bad as the swedes < 1366061888 725265 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :low countries more like blow countries < 1366061908 117461 :Phantom_Hoover!~phantomho@unaffiliated/phantom-hoover/x-3377486 PRIVMSG #esoteric :amsterdam more like hamsterspam < 1366061914 736350 :epicmonkey!~epicmonke@188.134.41.112 JOIN :#esoteric < 1366062129 820954 :calamari!~calamari@70-6-33-3.pools.spcsdns.net JOIN :#esoteric < 1366062515 308124 :function!root@freebsd/developer/variable NICK :trout < 1366062522 964560 :boily!~boily@mtl.savoirfairelinux.net PRIVMSG #esoteric ::t trout < 1366062524 431723 :lambdabot!~lambdabot@li85-105.members.linode.com PRIVMSG #esoteric :Not in scope: `trout' < 1366062532 202044 :trout!root@freebsd/developer/variable PRIVMSG #esoteric :boily: ? < 1366062563 152380 :boily!~boily@mtl.savoirfairelinux.net PRIVMSG #esoteric :you were a function, therefore you had a type. ischiomorphism seems to have destroyed it, sadly. < 1366062643 781551 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :i want a haskell library for ichthyomorphisms < 1366062686 257466 :Bike!~Glossina@174-25-34-189.ptld.qwest.net PRIVMSG #esoteric :Control.Monad.Blowfish < 1366062716 478143 :boily!~boily@mtl.savoirfairelinux.net PRIVMSG #esoteric :~duck ichtyology < 1366062717 123596 :metasepia!~metasepia@2607:fad8:4:6:f2de:f1ff:fe6c:6765 PRIVMSG #esoteric :Ichthyology is the branch of zoology devoted to the study of fish. < 1366062733 205178 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :cryptoichthyology < 1366062734 370693 :boily!~boily@mtl.savoirfairelinux.net PRIVMSG #esoteric :s/ischio/ichtyo/ < 1366062773 210651 :Bike!~Glossina@174-25-34-189.ptld.qwest.net PRIVMSG #esoteric :i guess nessie isn't technically a fish < 1366062777 117093 :boily!~boily@mtl.savoirfairelinux.net PRIVMSG #esoteric :with a fish operator: >~)))°> < 1366062834 746943 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :what is it then < 1366062841 697228 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :amphibian? < 1366062861 862971 :Phantom_Hoover!~phantomho@unaffiliated/phantom-hoover/x-3377486 PRIVMSG #esoteric :monster < 1366062886 946942 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :monster is not a kingdom < 1366062888 61072 :Bike!~Glossina@174-25-34-189.ptld.qwest.net PRIVMSG #esoteric :a dinosaur < 1366062915 629678 :Phantom_Hoover!~phantomho@unaffiliated/phantom-hoover/x-3377486 PRIVMSG #esoteric :monstriae < 1366062918 760266 :Bike!~Glossina@174-25-34-189.ptld.qwest.net PRIVMSG #esoteric :huh, i didn't know dinosauria was actually a clade < 1366062934 199080 :Phantom_Hoover!~phantomho@unaffiliated/phantom-hoover/x-3377486 PRIVMSG #esoteric :also: neither is amphibian < 1366062943 840738 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :yeah < 1366062970 607581 :Bike!~Glossina@174-25-34-189.ptld.qwest.net PRIVMSG #esoteric :it's not like a billion different genera names don't mean "monster" or "monstrous" anyway < 1366062992 554693 :Bike!~Glossina@174-25-34-189.ptld.qwest.net PRIVMSG #esoteric :genus that's the singular get it together bike < 1366063401 553704 :bengt_!weed@ya.lolk.org QUIT :Ping timeout: 245 seconds < 1366063471 779981 :augur!~augur@208.58.5.87 JOIN :#esoteric < 1366063611 201940 :bengt_!weed@ya.lolk.org JOIN :#esoteric < 1366063948 397897 :EgoBot!codu@codu.org QUIT :Read error: Connection reset by peer < 1366064001 592952 :bengt_!weed@ya.lolk.org QUIT :Ping timeout: 245 seconds < 1366064008 835180 :EgoBot!codu@codu.org JOIN :#esoteric < 1366064043 102036 :calamari!~calamari@70-6-33-3.pools.spcsdns.net QUIT :Quit: Bye < 1366064063 525352 :bengt_!weed@ya.lolk.org JOIN :#esoteric < 1366064326 468172 :bengt_!weed@ya.lolk.org QUIT :Ping timeout: 245 seconds < 1366064512 584157 :bengt_!weed@ya.lolk.org JOIN :#esoteric < 1366064575 545898 :boily!~boily@mtl.savoirfairelinux.net QUIT :Quit: Poulet! < 1366064579 81317 :metasepia!~metasepia@2607:fad8:4:6:f2de:f1ff:fe6c:6765 QUIT :Remote host closed the connection < 1366065172 289787 :ChanServ!ChanServ@services. MODE #esoteric -v :fizzie > 1366065172 326941 NAMES :#esoteric < 1366065197 960784 :fizzie!fis@unaffiliated/fizzie PRIVMSG #esoteric :It hasn't been fizzie day here for a while, I think I can get rid of the "idiot flag". < 1366065432 473729 :olsner!~salparot@c83-252-194-156.bredband.comhem.se PRIVMSG #esoteric :is that another name for the bozo bit? < 1366065526 675540 :bengt_!weed@ya.lolk.org QUIT :Ping timeout: 245 seconds < 1366065555 523554 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :What is "the bozo bit"? < 1366065624 102871 :ChanServ!ChanServ@services. MODE #esoteric +v :fizzie > 1366065624 114732 NAMES :#esoteric < 1366065680 691378 :bengt_!weed@ya.lolk.org JOIN :#esoteric < 1366065772 877418 :carado!~user4539@2a01:e35:8b61:e430:6ef0:49ff:fe73:1fd0 QUIT :Ping timeout: 246 seconds < 1366065827 365956 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :oh nice < 1366065830 634778 :epicmonkey!~epicmonke@188.134.41.112 QUIT :Ping timeout: 258 seconds < 1366065836 910492 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :linode credit card numbers have leaked < 1366065838 318432 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :wooooooo < 1366065842 116821 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :maybe i should find another vps provider < 1366065870 989298 :Phantom_Hoover!~phantomho@unaffiliated/phantom-hoover/x-3377486 PRIVMSG #esoteric :do you even < 1366065873 512461 :fizzie!fis@unaffiliated/fizzie PRIVMSG #esoteric :I'm at tilaa.com now, because they had such a nonsense explanation for the name. < 1366065874 298221 :Phantom_Hoover!~phantomho@unaffiliated/phantom-hoover/x-3377486 PRIVMSG #esoteric :have a credit card < 1366065889 818899 :fizzie!fis@unaffiliated/fizzie PRIVMSG #esoteric :And esp. for the logo. < 1366065909 603099 :Phantom_Hoover!~phantomho@unaffiliated/phantom-hoover/x-3377486 PRIVMSG #esoteric :why are they called tilaa < 1366065994 750559 :fizzie!fis@unaffiliated/fizzie PRIVMSG #esoteric :Because it's the Finnish word (more or less) for "space". (Like, empty space; not space space.) < 1366066012 50930 :fizzie!fis@unaffiliated/fizzie PRIVMSG #esoteric :And their logo is a wolf, because the wolf is the king of wide open spaces. < 1366066017 748635 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :Phantom_Hoover: well it might be a debit card thing < 1366066018 510230 :fizzie!fis@unaffiliated/fizzie PRIVMSG #esoteric :Or something like that. < 1366066018 749342 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :i don't know < 1366066027 464738 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :all i know is it's a piece of plastic and used as a credit card for linode < 1366066030 700423 :fizzie!fis@unaffiliated/fizzie PRIVMSG #esoteric :(They're not a Finnish company or anything.) < 1366066047 934742 :elliott!elliott@unaffiliated/elliott PRIVMSG #esoteric :fizzie: you used prgmr previously right? < 1366066052 799694 :fizzie!fis@unaffiliated/fizzie PRIVMSG #esoteric :Yes. < 1366066101 215189 :fizzie!fis@unaffiliated/fizzie PRIVMSG #esoteric :https://support.tilaa.com/entries/22447921-What-does-Tilaa-mean- https://support.tilaa.com/entries/22467097-What-does-the-wolf-in-your-logo-have-to-do-with-Tilaa- < 1366066101 549463 :bengt_!weed@ya.lolk.org QUIT :Ping timeout: 245 seconds < 1366066116 526121 :fizzie!fis@unaffiliated/fizzie PRIVMSG #esoteric :"In Finland, the wolf is the ruler of the open space." < 1366066125 759017 :fizzie!fis@unaffiliated/fizzie PRIVMSG #esoteric :It is kind of "what." < 1366066164 332061 :fizzie!fis@unaffiliated/fizzie PRIVMSG #esoteric :I don't even know if they have any Finnish employees. < 1366066182 687315 :fizzie!fis@unaffiliated/fizzie PRIVMSG #esoteric :Maybe they just randomly picked Finland to mock. < 1366066191 386305 :bengt_!weed@ya.lolk.org JOIN :#esoteric < 1366066221 65822 :Bike!~Glossina@174-25-34-189.ptld.qwest.net QUIT :Ping timeout: 252 seconds < 1366066328 536176 :Bike!~Glossina@65-100-32-70.ptld.qwest.net JOIN :#esoteric < 1366066576 668056 :bengt_!weed@ya.lolk.org QUIT :Ping timeout: 245 seconds < 1366066670 815279 :bengt_!weed@ya.lolk.org JOIN :#esoteric < 1366066678 895173 :Nisstyre-laptop!~yours@oftn/member/Nisstyre JOIN :#esoteric < 1366067128 601464 :nooodl!~nooodl@91.179.138.96 QUIT :Ping timeout: 256 seconds < 1366068476 636759 :TeruFSX!~TeruFSX@65-128-179-240.mpls.qwest.net QUIT :Ping timeout: 245 seconds < 1366068910 508620 :Sgeo!~Sgeo@ool-ad034ea6.dyn.optonline.net PRIVMSG #esoteric :Is there any good reason for forms to be able to POST to other domains? < 1366068951 246521 :Bike!~Glossina@65-100-32-70.ptld.qwest.net PRIVMSG #esoteric :free speech < 1366069677 274736 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :Sgeo: have you read The Tangled Web? < 1366069680 7140 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :really good book on websec < 1366069687 995471 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :i don't know if it has the answer to that question < 1366069692 339135 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :but it's informative and quite entertaining < 1366069725 957703 :Sgeo!~Sgeo@ool-ad034ea6.dyn.optonline.net PRIVMSG #esoteric :Remind me to buy that next week when I have money < 1366069730 365864 :btiffin!~btiffin@24.212.223.48 JOIN :#esoteric < 1366069771 548223 :sirdancealo2!~sirdancea@98.82.broadband5.iol.cz PRIVMSG #esoteric :form is just a gui to make a http request < 1366069843 797186 :Sgeo!~Sgeo@ool-ad034ea6.dyn.optonline.net PRIVMSG #esoteric :But it doesn't obey same origin policy the way XMLHttpRequest does < 1366069849 95703 :Lumpio-!~matti@89-166-34-164.bb.dnainternet.fi PRIVMSG #esoteric :Same origin policy is so inconsistent .-. < 1366069855 961679 :Lumpio-!~matti@89-166-34-164.bb.dnainternet.fi PRIVMSG #esoteric :Forms existed befor same origin policy did. < 1366069865 496928 :Lumpio-!~matti@89-166-34-164.bb.dnainternet.fi PRIVMSG #esoteric :And they can't possibly remove stuff because then things would break. < 1366069889 492631 :sirdancealo2!~sirdancea@98.82.broadband5.iol.cz PRIVMSG #esoteric :telnet doesnt obey same origin policy < 1366070004 138316 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :yeah < 1366070013 130136 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :also cookies don't follow SOP, they have their own slightly different policy < 1366070041 566503 :sirdancealo2!~sirdancea@98.82.broadband5.iol.cz PRIVMSG #esoteric :the crunchiness policy < 1366070065 479050 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :just don't get pickles in your cookies < 1366070076 818090 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :websec slash cooking advice < 1366070081 855864 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :don't put pickles in your cookies < 1366070084 207373 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :always salt your hash < 1366070109 852421 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :Sgeo: do you know about CSRF and how to prevent it? < 1366070156 123230 :Sgeo!~Sgeo@ool-ad034ea6.dyn.optonline.net PRIVMSG #esoteric :I know of one way that's supposed to prevent it... a token given to any page that needs to POST stuff, and the token needs to be given back < 1366070171 562833 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :yeah < 1366070181 983905 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :but typically, the server doesn't know or care what the 'right' token is < 1366070183 542182 :Sgeo!~Sgeo@ool-ad034ea6.dyn.optonline.net PRIVMSG #esoteric :But wouldn't requiring something like X-Requested-With: blah or requiring Content-Type to be application/json work? < 1366070198 696244 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :it just verifies that the token submitted as part of the form matches the token in a cookie < 1366070218 37060 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :a CSRF attacker controls the former, and the latter is part of the ambient authority that they're trying to exploit but can't use directly < 1366070224 538329 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :can't see directly, anyway < 1366070288 977512 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :yeah, sometimes you put the token in a custom header instead of a field element < 1366070299 325215 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :but either way it has to match that cookie < 1366070317 880001 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :this gives rise to a sort of variation on a session fixation attack, call it a csrf token fixation attack < 1366070342 971553 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :say that lolbutts.github.com is controlled by an attacker < 1366070355 873063 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :they can set a cookie for *.github.com that contains a csrf token of their choice < 1366070374 862990 :kmc!~keegan@ec2-50-17-26-83.compute-1.amazonaws.com PRIVMSG #esoteric :then use it to CSR-forge requests to the main github app < 1366070385 69692 :Sgeo!~Sgeo@ool-ad034ea6.dyn.optonline.net PRIVMSG #esoteric :How do you CSR-forge a custom header anyway?