< 1117591750 0 :wooby!~wooby@66.57.219.125 JOIN :#esoteric < 1117591880 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :hello, wooby < 1117591991 0 :wooby!unknown@unknown.invalid PRIVMSG #esoteric :hi < 1117592056 0 :wooby!unknown@unknown.invalid PRIVMSG #esoteric :what's crackin? < 1117592200 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :writing an interpreter (slowly) for a new esolang < 1117593454 0 :wooby!unknown@unknown.invalid PRIVMSG #esoteric :that's awesome < 1117593466 0 :wooby!unknown@unknown.invalid PRIVMSG #esoteric :an esolang of your own design? < 1117594357 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :yes < 1117594377 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :it is based on the principle of insertion sort < 1117594510 0 :wooby!unknown@unknown.invalid PRIVMSG #esoteric :that's interesting < 1117595763 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :*p++ parses as *(p++), right? < 1117596299 0 :kipple!unknown@unknown.invalid QUIT :Read error: 60 (Operation timed out) < 1117599632 0 :malaprop!unknown@unknown.invalid QUIT :"quit" < 1117603530 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :Wow, logicex-2 is a bitch. < 1117603535 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :I'm never going to beat this >_> < 1117603602 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :Until jix does, then I will be forced to defeat his :) < 1117603895 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :heh, i just realized these two operators i had proposed are exactly the same: < 1117603896 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :^ Strings String Provides whichever comes later out of op1 and op2, < 1117603896 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric : or "" if they are equal < 1117603896 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :$ Strings String Returns "" if both strings are "", the string that < 1117603896 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric : comes later out of op1 and op2 if neither string is < 1117603897 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric : "", or the string that is not "", if one of them is < 1117603898 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric : "" < 1117603907 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :obviously, i had not had my coffee when i made those up < 1117604015 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :have you considered making an interactive FYB, wherein players could control their warriors at runtime somehow? < 1117604023 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :using , and . of course < 1117604476 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :Why no, no I have not :-P < 1117605025 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :it wouldn't work very well < 1117605045 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :i can't imagine a situation where a person at the keyboard could decide what to do better than the program < 1117607416 0 :wooby!unknown@unknown.invalid QUIT : < 1117607740 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :You would need to have a really, really good grasp on what the program was doing. < 1117607747 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :Which is incredibly difficult to get. < 1117607751 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :(Part of the point, really) < 1117607954 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :and if you were that smart, though, you would just make your program figure it out, right? < 1117608588 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :Exactly ;) < 1117608824 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :i hope you will enjoy my new esoteric programming language < 1117608836 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :the interpreter is not working right, i will have to fix it tomorrow, good night < 1117612799 0 :clog!unknown@unknown.invalid QUIT :ended < 1117612800 0 :clog!unknown@unknown.invalid JOIN :#esoteric < 1117624765 0 :sp3tt!~sp3tt@skola-elev2-182.edu.umea.se JOIN :#esoteric < 1117624864 0 :sp3tt!unknown@unknown.invalid PRIVMSG #esoteric :";; warning: alcohol destroys brain cells! (not as much as brainfuck)" rofl < 1117624959 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :hi sp3tt, yeah that was a good advice :) < 1117624991 0 :sp3tt!unknown@unknown.invalid QUIT :Client Quit < 1117628708 0 :kipple!~kipple@163.80-202-100.nextgentel.com JOIN :#esoteric < 1117631100 0 :jix!jix@p5489AF8C.dip.t-dialin.net JOIN :#esoteric < 1117631368 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :kipple: your 99bob is still in the first place closely followed by Shakespeare < 1117631394 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :moin! < 1117631620 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :moin jix < 1117631655 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :hi < 1117631685 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :pgimeno: yes, wonder how long it's gonna last < 1117631895 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :it's a hard competition, both are equally fascinating :) < 1117631961 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :bbl < 1117632141 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :ACTION has an idea... .. is it turing complete ?.... *thinks* < 1117632381 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :HAH# < 1117633194 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :i have an idea for an ultimate language < 1117633229 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :programs will look like levels of a platform game .. and even work a bit like them ^^ < 1117633281 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :hmm. < 1117633292 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :is there a nethack esolang, btw? < 1117633581 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :my language will use a graphical editor.. text representation is.. to complex (maybe i write a text exporter and importer.. but graphical editor comes first) < 1117633613 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :yay! the world needs more non-ascii based esolangs! < 1117633640 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :name: bit-dropper < 1117633745 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :anyone here knows 'the hellacopters' ? < 1117633752 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :(band) < 1117633755 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :you mean the band? < 1117633778 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :yes < 1117633783 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :I've heard about it. Aren't they finnish or something? < 1117633789 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :swedish afaik < 1117633794 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :they rule < 1117633805 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :only heard about them, not heard them... < 1117633893 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :the flaming sideburns rule too.. they are finnish < 1117634584 0 :J|x!jix@p5489AF8C.dip.t-dialin.net JOIN :#esoteric < 1117634614 0 :jix!unknown@unknown.invalid QUIT :Nick collision from services. < 1117634620 0 :J|x!unknown@unknown.invalid NICK :jix < 1117634633 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :what was my last msg ? < 1117634668 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :flaming sideburns < 1117634914 0 :malaprop!~ph@ppp-68-251-63-230.dsl.chcgil.ameritech.net JOIN :#esoteric < 1117636184 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :ah < 1117636253 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :moin malaprop < 1117636394 0 :sp3tt!~chatzilla@lite-148-133.umenet.net JOIN :#esoteric < 1117636535 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :moin sp3tt < 1117636764 0 :sp3tt!unknown@unknown.invalid PRIVMSG #esoteric :Hi. < 1117636841 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :jix: good news for your graphical language: http://www.99-bottles-of-beer.net/language-labview-729.html :) < 1117636851 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :(99bob supports images now) < 1117636869 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :wow < 1117636872 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :and, Hi sp3tt (what kind of nick is that anyway???) < 1117636887 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :does it support image+text (text for pasting it into the interpreter) < 1117636891 0 :sp3tt!unknown@unknown.invalid PRIVMSG #esoteric :LOL... < 1117636947 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :jix: no idea. I don't even know what you mean... ;) < 1117636953 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :because i'm not going to store the data as images < 1117636974 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :but it would be too hard to write programms in the native (binary) format < 1117637005 0 :sp3tt!unknown@unknown.invalid PRIVMSG #esoteric :The IKEA language? < 1117637022 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :no < 1117637024 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :bit-dropper < 1117637028 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :haha. no I don't think that one will be made < 1117637121 0 :sp3tt!unknown@unknown.invalid PRIVMSG #esoteric :It would own. < 1117637137 0 :sp3tt!unknown@unknown.invalid PRIVMSG #esoteric :Do you have a link for bit-dropper? < 1117637153 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :no i just thought a bit about it < 1117637188 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :the programs look like platform-game levels.. and work a bit like them.. hmm a mix of: falldown,lemmings and super mario < 1117637292 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :the levels look like super mario.. the object movement is a bit like falldown.. but the strategy is a bit like lemmings < 1117637368 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :away < 1117637665 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :back < 1117637889 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :in bit-dropper bits can slide,fall,roll,jump,bounce,fly... < 1117637924 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :i hope it's turing complete.. but anyway it's crazy < 1117638000 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :ok i'm still connected... (it's quiet here) < 1117638058 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :back < 1117638085 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :away < 1117638214 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :does anybody know if there is a command line utility like the linux timer available for windows? < 1117638381 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :do you mean the "time" command? < 1117638388 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :yeah < 1117638394 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :time not timer :P < 1117638409 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :yes: use cygwin :P < 1117638418 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :no thanks < 1117638431 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :any bash will do; I think there's a non-cygwin bash < 1117638445 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :but 'time' is a bash command < 1117638450 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :mingw+msys < 1117638456 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :arg.. i'm away.... < 1117638459 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :then yeay < 1117638464 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :oh, later then < 1117638482 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :yeay -> yeah (I mean: msys has a bash) < 1117638506 0 :sp3tt!unknown@unknown.invalid PRIVMSG #esoteric :Bash for windows? < 1117638514 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :sure < 1117638528 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :anyway, I installed perl on my windows box in order to run my sous-chef version of 99bob in a reasonable amount of time, and it needed only 5 minutes :) < 1117638530 0 :sp3tt!unknown@unknown.invalid PRIVMSG #esoteric :Now Windows can bash instead of being bashed! Resistance is futile! < 1117638565 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :kipple: "only" as compared with what? I don't remember the other timings < 1117638596 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :well, I never ran it with 99 verses, but I ran it with fewer, and estimated it to take about 45 minutes < 1117638617 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :not bad then < 1117638651 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :sp3tt: cygwin is around for several years actually; msys is more modern but is still a bit old < 1117638677 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :well, the windows box is 1.4GHz Duron compared to 187MHz K6, so it wasn't really a surprise :) < 1117638717 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :pretty linear :) < 1117638734 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :I like cygwin for one reason: it's basically a distribution < 1117638743 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :anyway, the time it takes to run a chef program with sous-chefs grows exponentially with the number of sous-chef calls... < 1117638767 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :exponentially? wasn't it quadratically? < 1117638779 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :hmm. yes < 1117638788 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :maybe... < 1117638815 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :I think I could find an exponantial function that is a good estimate for it as well. (I don't have enough data really to be precise) < 1117638835 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :just wondering based on what you told < 1117638869 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :I have no idea on how the interpreter is written anyway < 1117638880 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :it's the spec, not the interpreter < 1117638918 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :basically you have to pass ALL data in the program as parameters (by value!) to each function call < 1117639005 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :hum, how much data are we talking about? < 1117639035 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :depends on the program. in this case, the lyrics to 99bob < 1117639060 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :that's not too much, so I guess the interpreter could be more efficient < 1117639278 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :I'd guess so < 1117639333 0 :fizzie!unknown@unknown.invalid PRIVMSG #esoteric :We-ell, the interpreter could pass the contents by-reference and do some copy-on-write -like thing. < 1117639390 0 :fizzie!unknown@unknown.invalid PRIVMSG #esoteric :(Disclaimer: I don't really know anything about Chef.) < 1117639494 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :me neither, apart from having fun with the Fibonacci Numbers with Caramel Sauce < 1117639555 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :btw, copy-on-write is just another example of a lazy strategy :P < 1117639588 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :ACTION promises he'll be quiet next time < 1117639999 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :oh man < 1117640014 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :the world needs a language based on recursive regular expressions < 1117640042 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :it could be called Two Problems :D < 1117640303 0 :sp3tt!unknown@unknown.invalid PRIVMSG #esoteric :Or brain-fubar. < 1117640322 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :Why "two problems"? < 1117640353 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :it's a quote from Jamie Zawinski < 1117640378 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :"Some people, when confronted with a problem, think 'I know, I'll use regular expressions.' Now they have two problems." < 1117640464 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :heheh, it'd be a functional language < 1117640467 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :oh, so evil >:) < 1117640476 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :Heh, I was just about to point out it'd be FP. < 1117640501 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :that's so awesomely evil < 1117640580 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :the primary conditional could be a list of regexps, works like a switch (without fallthrough) < 1117640597 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :who said anything about a conditional? :) < 1117640624 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :bah, I suppose it's necessary < 1117640627 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :*wonders* < 1117640645 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :Is not so much a conditional as matching. Like how in ML you'll have to write f for the empty list as well as for the full one. < 1117640683 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :ooh < 1117640687 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :maybe just use the regex match operation < 1117640712 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :and keep sets of match:sub triplets < 1117640717 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :er, pairs < 1117640870 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :not sure whether I need variables *messes around* < 1117641225 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :er, by variables I mean functions < 1117641236 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :yeah, guess I do < 1117641476 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :CXI "Some people, when confronted with a problem, think 'I know, I'll use regular expressions.' Now they have two problems." < where is this quote from? < 1117641500 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :comp.lang.emacs < 1117641506 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :fairly famous < 1117641532 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :Excellent, excellent quote :) < 1117641748 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :GregorR: I just found this which may be of interest to you: http://fishbowl.pastiche.org/2003/08/18/beware_regular_expressions < 1117641812 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :I'll look at it later, time to go to school. < 1117641921 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :sure < 1117642137 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :blagh, I keep forgetting all the perl I know :D < 1117642173 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :ah, crap, I can't store my function table as a hash because of pattern matching < 1117642202 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :or maybe I could store it as a hash of hashes... yes! >:) < 1117642281 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :CXI: Are you implementing Two Problems now? < 1117642285 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :yeah < 1117642290 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :neat < 1117642328 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :actually pretty easy to write in perl, I'm just working out how to do the functional bit properly < 1117642686 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :I haven't done data structures in perl for ages, wow < 1117643994 0 :j|x!~gecko@dyndsl-080-228-179-176.ewe-ip-backbone.de JOIN :#esoteric < 1117643999 0 :j|x!unknown@unknown.invalid PRIVMSG #esoteric :back < 1117646648 0 :jix!unknown@unknown.invalid QUIT :"This computer has gone to sleep" < 1117647991 0 :j|x!unknown@unknown.invalid PRIVMSG #esoteric :oh... < 1117648288 0 :j|x!unknown@unknown.invalid QUIT :"Leaving" < 1117648463 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :hmm < 1117648472 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :I just realised I may be doing this in an unnecessarily complex way < 1117648490 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :right now I'm doing function:/pattern/:/match/replace/ < 1117648499 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :but pattern and match are fundamentally the same thing < 1117648783 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :yes < 1117648841 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :ACTION kicks himself for being silly < 1117648850 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :most of the development time here is forgetting how to use perl < 1117649629 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :yay < 1117649630 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :hello world works < 1117649822 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :erk, I've hit another "my brain stopped working" roadblock < 1117649822 0 :jix!jix@p5489AF8C.dip.t-dialin.net JOIN :#esoteric < 1117649955 0 :sp3tt!unknown@unknown.invalid PRIVMSG #esoteric :Example of the language? < 1117649983 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :actually, the problem is working out how the language should go < 1117650177 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :actually, hmm, I think I've got it < 1117650182 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :just have to work out how to write it down < 1117650196 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :what language ? < 1117650205 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :Two Problems :D < 1117650215 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :a functional language based entirely on regular expressions < 1117650238 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :using which regex engine ? < 1117650257 0 :ZeroOne!unknown@unknown.invalid PRIVMSG #esoteric :pgimeno: hey, no problem :) < 1117650257 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :perl's, at the moment < 1117650276 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :does perl support recursive regexpes ? < 1117650279 0 :ZeroOne!unknown@unknown.invalid PRIVMSG #esoteric :the articles aren't safe in wikipedia < 1117650309 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :jix: not really... but yes with a little craziness < 1117650317 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :the perl regex engine lets you use a function in the replacement of a regex < 1117650317 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :use: http://www.geocities.jp/kosako3/oniguruma/ < 1117650331 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :that's not recursive pattern matching < 1117650369 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :with oniguruma it's possible to test a string like (()((()())())) for correct ( ) placement < 1117650944 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :aha! < 1117651042 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :ZeroOne: wow, that's a 50 hour lag :) < 1117651060 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :yeah, I was gonna say I thought I saw the comment that started that a couple days ago < 1117651127 0 :ZeroOne!unknown@unknown.invalid PRIVMSG #esoteric :pgimeno: just some military service in between there ;) < 1117651158 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :ZeroOne: hehe, no prob, just probably the biggest lag I've seen on IRC < 1117651229 0 :ZeroOne!unknown@unknown.invalid PRIVMSG #esoteric :pgimeno: ok :) I've got this shell running irssi and it notifies me about new messages when I come back. < 1117651258 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :graue has been working on porting your articles < 1117651287 0 :ZeroOne!unknown@unknown.invalid PRIVMSG #esoteric :good, good < 1117651337 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :(see http://esoteric.voxelperfect.net/wiki/Special:Recentchanges ) < 1117651614 0 :ZeroOne!unknown@unknown.invalid PRIVMSG #esoteric :nice < 1117651838 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :ugh < 1117651844 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :turns out perl probably wasn't the best choice for this < 1117652806 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :haha, this is so ugly, but I think it works < 1117652907 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :!! hehe < 1117652947 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :main:/(.*)/(head $1)/ < 1117652948 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :head:/^(.).*$/$1/ < 1117652952 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :best syntax ever < 1117653044 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :nice < 1117653068 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :C:\Projects\TwoProblems>2probs test.2p hello < 1117653068 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :h < 1117653077 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :heh, and only about 5 regex calls to do that, too :P < 1117653102 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :though I think recursion may not entirely work... :D < 1117653129 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :actually, scratch that, I know recursion doesn't work < 1117653147 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :you should make () do print and plain be code. optimize for the common case, eh? < 1117653187 0 :lindi-!unknown@unknown.invalid PRIVMSG #esoteric :CXI: doesn't that form a context-free grammar and not a regular grammar? < 1117653274 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :Hm, it's not quite a CFG. Close, tho. < 1117653285 0 :Keymaker!~Not@wire74.adsl.netsonic.fi JOIN :#esoteric < 1117653303 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :except if you can use main/^.(.*)$/(main $1)/ or something similar < 1117653310 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :er, main: < 1117653332 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :which you should be able to do according to the spec of the language, but for some stupid reason I accidentally didn't implement right < 1117653434 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :oh dear, I definitely need to go to bed :P < 1117653434 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :CXI: You should have the ability to have multiple rules of the same name that match different things. main:/^foo.*/saw foo $1/ \n main:/^bar.*/saw bar $1/ < 1117653438 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :Then you'be got conditionals. < 1117653449 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :yeah, theoretically that's what should happen < 1117653538 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :I'll fix it up later when I'm not so tired < 1117653577 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :where are the specs ? < 1117653587 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :jix: Scroll up. :) < 1117653794 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :hmhmmm... < 1117653796 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :anyway, definitely need sleep < 1117653802 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :catch you guys later < 1117653805 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :later! < 1117653819 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :$_ < 1117656076 0 :Keymaker!unknown@unknown.invalid QUIT :"Freedom!" < 1117657100 0 :kipple!unknown@unknown.invalid QUIT :brown.freenode.net irc.freenode.net < 1117657100 0 :cpressey!unknown@unknown.invalid QUIT :brown.freenode.net irc.freenode.net < 1117657442 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :GregorR: the specs for FYB need an extension: ;: added on runtime and unmatching ;:,{} and [] < 1117657452 0 :kipple!~kipple@163.80-202-100.nextgentel.com JOIN :#esoteric < 1117657452 0 :cpressey!nobody@d154-20-76-195.bchsia.telus.net JOIN :#esoteric < 1117657940 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :GregorR: 1 < 1117657943 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :oops < 1117657945 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :GregorR: ! < 1117658234 0 :sp3tt!unknown@unknown.invalid QUIT :"Chatzilla 0.9.68a [Firefox 1.0.4/20050511]" < 1117659281 0 :jix!unknown@unknown.invalid NICK :jix|crackattack < 1117662379 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :the interpreter for my insertion sort language is nearly complete < 1117664176 0 :jix|crackattack!unknown@unknown.invalid NICK :jijx < 1117664183 0 :jijx!unknown@unknown.invalid PRIVMSG #esoteric :graue: complete ? < 1117664187 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :nearly < 1117664202 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :i am still working on the regular expression matcher, an essential feature < 1117664491 0 :jijx!unknown@unknown.invalid PRIVMSG #esoteric :ACTION can't wait < 1117664496 0 :jijx!unknown@unknown.invalid NICK :jix < 1117664670 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :is it written in perl? < 1117664824 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :night < 1117664857 0 :jix!unknown@unknown.invalid QUIT :"Banned from network" < 1117664930 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :it is written in C < 1117667393 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :http://illegal.coffeestops.net:3703/sort.zip - enjoy < 1117668205 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :is it already finished? wow < 1117668240 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :heh. that's one quick development process! < 1117668558 0 :calamari!~jeffryj@lilly.csoft.net JOIN :#esoteric < 1117668560 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :hi < 1117668569 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :hi < 1117668599 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :hi calamari < 1117668666 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :made some nice improvements to EsoShell (bash-style command history, program return values/$?, better defined API and JavaDoc comments, but won't be able to upload it until the 8th < 1117668695 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :I waited too long to have my phone service switched and so I'll be without an internet connection until then.. oops! < 1117668729 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :Unless I copy it all on a floppy and come back here to upload.. could do that :) < 1117668747 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :I want to implement globs, forgot about those < 1117668757 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :are you in an internet café? < 1117668764 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :nope, I'm at school < 1117668767 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :ah < 1117668769 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :when you say API, does that mean that there will be an easy way for third party apps to be made? < 1117668822 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :kipple: yes, for sure.. I'm offering familiar exit(), out.__ and in.. as well as main(String[] args) < 1117668832 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :btw, do you have the link again? forgot to bookmark... < 1117668843 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :Writing an EsoShell app is very similar to writing a Java console app < 1117668872 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :http://lilly.csoft.net/~jeffryj/EsoShell or http://kidsquid.com/EsoShell < 1117668878 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :hmm. is there any reason you need a special API? couldn't you just execute a normal console app? < 1117668884 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :in an applet? < 1117668900 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :yes. console apps are classes like everything else, no? < 1117668914 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :System.exit() wouldn't work, I know that < 1117668925 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :you're probably right < 1117668929 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :System.out would print to the Java console, rather than the applet window < 1117668938 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :can't you redirect that? < 1117668951 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :possibly.. I'll do that if possible < 1117668957 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :maybe not. it was just a thought < 1117668961 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :might cause some kind of security exception though < 1117668992 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :graue: octothorpe = # ? < 1117668993 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :but, good idea if it works I'll do it :) < 1117669018 0 :fizzie!unknown@unknown.invalid PRIVMSG #esoteric :Google says octothorpe is a #. < 1117669035 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :thanks fizzie < 1117669042 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :anyhow.. I'm pushing back multiple threads/taskbar for now < 1117669076 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :can't you use a custom made System object to override normal System.exit()? < 1117669099 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :kipple: aren't the methods final? < 1117669108 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :hmm. perhaps < 1117669142 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :cool < 1117669147 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :they don't seem to be < 1117669173 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :I'll try that too, then :) < 1117669179 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :anyway, initializing an app might be as easy as this: ConsoleApp c = new ConsoleApp(); c.main(args); < 1117669199 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :but there are probably issues I'm not thinking of here... < 1117669205 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :I'm already runnign the applications just fine < 1117669229 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :But, If I can provide amore familar interface than I am, that's great < 1117669333 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :hhmm, System.exit is final.. might not work well if I decide to do the multithreaded thing in the future < 1117669340 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :err final -> static < 1117669439 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :hello < 1117669457 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :i've been working on the sort thing since yesterday < 1117669471 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :also, () and [] in regular expressions don't work yet < 1117669519 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :I'm taking a look < 1117669540 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :but there aren't many examples... < 1117669551 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :wel,, I'm gonna go grab some food.. I'll be baack when I can < 1117669551 0 :calamari!unknown@unknown.invalid QUIT :"Leaving" < 1117669557 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :i haven't figured out how to write a nontrivial program yet < 1117669632 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :hmm, regular expressions in general seem to be buggy < 1117669635 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :I'd like to see examples of how the description applies to the language < 1117669664 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :it matches the name of the current expression, which it shouldn't, and the ! modifier doesn't work at the end of the search string < 1117669681 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :I have some difficulty understanding some aspects of the language < 1117669683 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :here's an alternate hello world that demonstrates regular expressions: < 1117669683 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :world := "" < 1117669683 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :hello := "hello, " "w...." "" ? ~ < 1117669723 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :substituting ".!d" for "w...." also works < 1117669819 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :is the initial order important? < 1117669875 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :no < 1117669884 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :the expressions are always maintained in sorted order < 1117669899 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :ok < 1117669913 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :absence of operator is concatenation, right? < 1117669924 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :no, ~ is concatenation < 1117669940 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :a literal number or string just pushes itself onto the stack < 1117669949 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :oh ok < 1117669956 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :I missed the stack part < 1117670678 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :I'm too tired right now to try to figure out how to do anything with sort < 1117670692 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :I'm off to bed, good night < 1117670857 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :good night < 1117671467 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :updated http://illegal.coffeestops.net:3703/sort.zip, fixed one regex bug < 1117671800 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :this now works: < 1117671800 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :world := "" < 1117671800 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :hello := "hello, " ".!" "" ? ~ < 1117673711 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :heh, i just realized you can trick the matcher into matching a literal ! < 1117673742 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :"r@!", if you can make sure there won't be an r at the beginning, will match only "!" < 1117677056 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :jix: True. Quick rundown: < 1117677082 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :A) If you put a [, { or : somewhere where there HASN'T been one, it will work just like any other. If you put one where there HAS been one, it will still be spent. < 1117677095 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :(That is, a : placed where there has been one will still be spent) < 1117677125 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :B) If a jump is to be made, but there is no matching symbol, the jump is ignored. < 1117677146 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :IE: in [[], if it hit that first [ and decided to jump, it wouldn't, and in []] if it hit that second ] and decided to jump, it wouldn't. < 1117678853 0 :malaprop_!~ph@adsl-69-209-242-189.dsl.chcgil.ameritech.net JOIN :#esoteric < 1117679365 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :hey Greg, ph, what do you guys think of my sorted language innovation? < 1117679696 0 :malaprop!unknown@unknown.invalid QUIT :Read error: 110 (Connection timed out) < 1117679841 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :Sorry, haven't taken a look at it yet. Also, my name is Gregor ;) < 1117679895 0 :kipple!unknown@unknown.invalid QUIT :Read error: 110 (Connection timed out) < 1117680230 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :eliminating all syllables but the first is a typical way of abbreviating someone's name < 1117680271 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :Yes, I'm well aware of that, but I personally don't like blunt names, such as one-syllable names starting and ending with the same letter ;p < 1117680384 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :so you are offended by the 99bob program in ORK, which uses someone named Bob as a mathematician? < 1117680615 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :or are you only offended when blunt names are used to address you? < 1117680686 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :anyway, check out the sort lang < 1117680697 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :i fixed all regex bugs of which i am aware < 1117683588 0 :graue_!~graue@ip68-100-130-21.dc.dc.cox.net JOIN :#esoteric < 1117685681 0 :graue_!unknown@unknown.invalid PRIVMSG #esoteric :i posted some thoughts on sort at http://esoteric.voxelperfect.net/research/ < 1117685688 0 :graue_!unknown@unknown.invalid PRIVMSG #esoteric :as well as an updated package < 1117685691 0 :graue_!unknown@unknown.invalid QUIT :"Leaving" < 1117686442 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :I'm not offended by blunt names. < 1117686459 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :And if somebody wants to be called by a blunt name, I'll call them that. < 1117686461 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :I just prefer not to myself. < 1117686463 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :hey Gregor < 1117686477 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :as long as you're here, why not give Sort a look? < 1117686517 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :Sure, por que no. < 1117686526 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :(Please ignore my terrible Spanish :-P) < 1117686532 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :i don't even know what that means < 1117686558 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :In my happy universe where I know any Spanish, it means "Why not?" < 1117686829 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :cool < 1117686963 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :So, stack elements are a sort of "variant," that can be either a number or a string? < 1117687015 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :if by "variant," you mean they get automatically converted to whichever form an operator requires when the operator is used, then yes < 1117687065 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :Oh, OK. < 1117687463 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :*brain melting* < 1117687521 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :heh, pretty esoteric, eh? < 1117687554 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :Very. < 1117687560 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :I'm trying to wrap me brain around it. < 1117687580 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :I don't quite understand what triggers the program to end ... < 1117687598 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :when there is only one expression left < 1117687606 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :all expressions but one must have deleted themselves < 1117687608 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :OHhhhhhhhhhhhhhhhhhhhhhhhhhhhhh < 1117687656 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :And when you create an expression with :=, what does that expression evaluate to when it gets to it? < 1117687693 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :That is ... < 1117687698 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :Not when you "create" an expression ... < 1117687703 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :But when one expression translates into another. < 1117687703 0 :malaprop_!unknown@unknown.invalid QUIT :"quit" < 1117687713 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :translates into another? < 1117687751 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :an expression that is evaluated must result in exactly one value on the stack < 1117687765 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :that value if it is a number is converted to a string, then it becomes the new name of the expression < 1117687770 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :an expression that is renamed to "" is deleted < 1117687779 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :the number 0 converts to the string "" < 1117687809 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :It becomes the new NAME of the expression ... < 1117687824 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :(How to phrase this ... ) < 1117687859 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :And when it comes across that expression again (now with the new name), what does it evaluate to? < 1117687885 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :whatever the result of the expression is < 1117687905 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :the expression is unchanged, although the results of a regex searching the expression name list may be < 1117687915 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :So, for simple string literals, just itself, though other------- < 1117687919 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :I was just mentally computing that. < 1117687927 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :OK, thank you. < 1117687966 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :I think the doc could be helped a bit by explicitly defining all of the nomenclature at the top. < 1117687985 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :like "push", "pull", "regex", "expression"? < 1117688014 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :uh oh, the interpreter has another bug < 1117688058 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :I guess [name] := [expression] is pretty much what I was looking for, and is there. < 1117688067 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :So ... *cough* ... ignore me. < 1117688073 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :okay < 1117688087 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :lalala < 1117688104 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :hey lament < 1117688181 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :feel like trying a new esolang today? < 1117688190 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :no < 1117688211 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :maybe tomorrow, then < 1117689642 0 :CXI!unknown@unknown.invalid QUIT :Read error: 145 (Connection timed out) < 1117693509 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :i uploaded a new package fixing clobbering < 1117693530 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :meaning that if an expression evaluates to the name of another existing expression, it overwrites that one < 1117693537 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :so you can now write hello, world like this: < 1117693541 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :hello := "hello, world" < 1117693545 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :world := "hello, world" < 1117693579 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :this also may make it easier to write more sophisticated programs, but it's hard to say < 1117695356 0 :graue!unknown@unknown.invalid QUIT :"Are you a Schweinpenis? If so, type "I am not a Schweinpenis."" < 1117699199 0 :clog!unknown@unknown.invalid QUIT :ended < 1117699200 0 :clog!unknown@unknown.invalid JOIN :#esoteric < 1117701176 0 :puzzlet!~puzzlet@61.247.148.38 JOIN :#esoteric < 1117701216 0 :puzzlet!unknown@unknown.invalid QUIT :Client Quit < 1117701219 0 :puzzlet!~puzzlet@61.247.148.38 JOIN :#esoteric < 1117708516 0 :kipple!~kipple@163.80-202-100.nextgentel.com JOIN :#esoteric < 1117710536 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :hm, it looks to me as if graue's language has a mechanism for converting the programas to SMETANA < 1117710554 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :I'm not sure though < 1117718169 0 :malaprop!~ph@ppp-68-251-59-237.dsl.chcgil.ameritech.net JOIN :#esoteric < 1117718686 0 :pgimeno!unknown@unknown.invalid QUIT :Read error: 110 (Connection timed out) < 1117719184 0 :pgimeno!pgimeno@124.Red-80-59-211.pooles.rima-tde.net JOIN :#esoteric < 1117719498 0 :jix!jix@p5489EB9C.dip.t-dialin.net JOIN :#esoteric < 1117722061 0 :CXI!~Sanity@dialup-42.105.221.203.acc51-kent-syd.comindico.com.au JOIN :#esoteric < 1117725656 0 :graue!~graue@ip68-100-130-21.dc.dc.cox.net JOIN :#esoteric < 1117726108 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :hi graue < 1117726115 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :hello < 1117726140 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :i think Sort resembles Whenever a bit < 1117726161 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :I was wondering if it is possible to transform a SMETANA program into a Sort program < 1117726184 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :the ending conditions are different < 1117726194 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :in Sort, if it falls off the end it just goes back to the beginning < 1117726228 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :yes hmm... < 1117726244 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :you know what'd be a neat idea? < 1117726263 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :no, what? < 1117726282 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :a program to take a list of inputs and outputs, and use some kind of state-space search over all possible programs to find a program that matches the inputs and outputs < 1117726313 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :yeah, that would be cool < 1117726341 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :you could use it to duplicate a closed-source reverb effect < 1117726346 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :it'd be easier in BF because of its' tiny instruction set < 1117726350 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :give it a PCM wave before and after the effect was applied < 1117726363 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :CXI: How goes the regexp esolang? < 1117726372 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :i wrote a program once that generated BF programs at random < 1117726380 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :you'd type and they would do funny things < 1117726383 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :it was cool < 1117726383 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :been busy since yesterday, unfortunately < 1117726408 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :i have a concern about the regexp esolang < 1117726419 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :What's that? < 1117726421 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :if it uses perl for the regexp matching, doesn't that tie the language inextricably to perl? < 1117726465 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :I don't think so... though I suppose there are slight regex variations between engines < 1117726484 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :CXI: are you familiar with genetic programming? < 1117726495 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :maybe if that "perl compatible" regexp library really is, it would work < 1117726505 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :perl's regular expressions are not anything like a standard though < 1117726515 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :kipple: I'm quite a fan of it, but not terribly familiar < 1117726536 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :because it is used for what you described < 1117726547 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :that's more or less how the first Hello world program was written in Malbolge < 1117726576 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :haha < 1117726586 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :malbolge is a fearsome beast < 1117726590 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :yes, that's right :) < 1117726603 0 :puzzlet!unknown@unknown.invalid PRIVMSG #esoteric :malbolge is the name of hell < 1117726618 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :and so appropriately named < 1117726641 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :I'm trying to write a 'cat' program in it < 1117726669 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :but that's a tough task < 1117726700 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :my program is already complete if the memory can be preloaded into the virtual machine; I'm now working in the initialization < 1117726748 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :i.e. the code that sets up the memory to be as desired, but it will be several K's long < 1117726783 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :it's a bit stalled right now until I finish the changes in my homepage though < 1117726825 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :I'm pretty sure I won't see a quine in Malbolge < 1117726832 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :good lord < 1117726838 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :Dis is a bit more tractable < 1117726858 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :poor Dis never really gets talked about at all < 1117726869 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :yeah, I wanted to change that < 1117726898 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :there are just a few progs ever written in Dis < 1117726921 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :it *might* be possible to write a (real) 99bob in dis < 1117726994 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :the main advantage of Dis is that instructions stay in their place, i.e. they do not change after being executed (as opposed to Malbolge) < 1117727014 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :I thought that was an endearing feature, personally < 1117727022 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :we need an article on Dis in the esolang encyclopedia < 1117727033 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :i've never really looked at it, so it would be nice to have an overview < 1117727047 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :if you can wait about one week more I can write it < 1117727055 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :fair enough < 1117727056 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :I'd like to do < 1117727237 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :in "useable" Malbolge, the program flow is expressed as data (jump addresses), because instructions must be at fixed positions < 1117727286 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :Lou Scheffer wrote an excellent article (which hooked me into Malbolge coding) < 1117727308 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :graue: use oniguruma for regexps < 1117727326 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :tell CXI that < 1117727330 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :he's the one making the regexp language < 1117727332 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :sry < 1117727338 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :unless you mean for Sort < 1117727353 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :for anything where regexps are used < 1117727354 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :Sort intentionally uses its own underpowered regexp implementation < 1117727367 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :CXI: use oniguruma for regexps < 1117727369 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric ::P < 1117727391 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :you mentioned it before, but to be honest I've already written most of it in perl now anyway < 1117727395 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :jix, have you checked out sort? < 1117727400 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :no < 1117727407 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :why not do so? < 1117727425 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :it is at http://esolangs.org/research/ < 1117727594 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :haha < 1117727599 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :I want to make a uno programming language < 1117727635 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :flow control: reverse, skip < 1117727647 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :IO: draw two/draw four < 1117727700 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :heh, do it then < 1117727832 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :uno? like in the card game? < 1117727866 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :yeah < 1117727883 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :hehe. nice idea. (long time since I've played that) < 1117730231 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :hey kipple, you tried out Sort yet? < 1117730584 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :jix: So, about FYB ... < 1117730592 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :I realized a problem with my old programs. < 1117730603 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :Many of them had something like this: :@....; < 1117730624 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :The problem is, when that thread does the second loop, it defects again, hence editing the enemy! < 1117730645 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :So, *cough*, yeah, totally fubar'd code there 8-D < 1117734200 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :i just noticed that a FYB war ends after the 1st or 2nd bomb.. so my idea was: every player has 10 lives < 1117734882 0 :GregorR-L!~GregorR-L@host-202-212.pubnet.pdx.edu JOIN :#esoteric < 1117734909 0 :GregorR-L!unknown@unknown.invalid PRIVMSG #esoteric :The reason that it ends after the first is so that threads are a blessing and a curse. < 1117734922 0 :GregorR-L!unknown@unknown.invalid PRIVMSG #esoteric :They're nice because you can do more, but bad because they make you more susceptible. < 1117734930 0 :GregorR-L!unknown@unknown.invalid PRIVMSG #esoteric :I think having more lives would skew that balance. < 1117735014 0 :GregorR-L!unknown@unknown.invalid PRIVMSG #esoteric :Or at least, I can't think of a "lives" system that would not skew that balance, I don't know if you have something up your sleeves ;) < 1117735956 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :is there a language that uses analog memory < 1117736313 0 :GregorR-L!unknown@unknown.invalid PRIVMSG #esoteric :Would that not be similar to simply having floating-point memory elements? < 1117736673 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :no < 1117736684 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :memory positions are floating too... < 1117736695 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :+point < 1117736700 0 :GregorR-L!unknown@unknown.invalid PRIVMSG #esoteric :Oh, I think I sort of see what you're saying. < 1117737237 0 :GregorR-L!unknown@unknown.invalid PRIVMSG #esoteric :Here's a great language! < 1117737244 0 :GregorR-L!unknown@unknown.invalid PRIVMSG #esoteric :The only command is "add to output que" < 1117737255 0 :GregorR-L!unknown@unknown.invalid PRIVMSG #esoteric :Any character entered is assumed to be a parameter for this command. < 1117737260 0 :GregorR-L!unknown@unknown.invalid PRIVMSG #esoteric :I call this language "cat" < 1117737355 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :heh, already been invented < 1117737362 0 :GregorR-L!unknown@unknown.invalid PRIVMSG #esoteric :Damn! < 1117737374 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :that was discussed on lang@esoteric a few years back < 1117737375 0 :GregorR-L!unknown@unknown.invalid PRIVMSG #esoteric ::P < 1117737380 0 :GregorR-L!unknown@unknown.invalid PRIVMSG #esoteric :lol < 1117737386 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :the main attraction of cat is that every program is a quine < 1117737396 0 :GregorR-L!unknown@unknown.invalid PRIVMSG #esoteric :Heheh, that's nice. < 1117737432 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :Hm, the defintion for "programming language" that I have in my head requires conditionals. < 1117737445 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :if you add a second command to read from the output queue, you can get by like that, with no formal way of storing data < 1117737456 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :(you do need other commands to process the data, of course) < 1117737476 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :Choon works that way, its only data storage is its own past output < 1117737504 0 :GregorR-L!unknown@unknown.invalid PRIVMSG #esoteric :malaprop: Is HQ9+ a programming language? < 1117737523 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :definately not! < 1117737528 0 :GregorR-L!unknown@unknown.invalid PRIVMSG #esoteric :w00t < 1117737538 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :is Sort a programming language? < 1117737567 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :GregorR-L: I don't know HQ9+ < 1117737581 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :...or sort. < 1117737591 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :HQ9+ is a parody of a programming languge :) < 1117737598 0 :GregorR-L!unknown@unknown.invalid PRIVMSG #esoteric :malaprop: The H command outputs "Hello World!", the Q command outputs the content of the program, the 9 command outputs 99-bottles-of-beer, the + command increments the accumulator. < 1117737599 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :HQ9+ is a language with four commands, H = print hello world, Q = print program's source code, 9 = print lyrics to 99 bottles of beer, + = increment the accumulator < 1117737609 0 :GregorR-L!unknown@unknown.invalid PRIVMSG #esoteric :Hahah, I win by several seconds :-P < 1117737611 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :Sort is at http://esolangs.org/research/ < 1117737617 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :it was not a contest < 1117737624 0 :GregorR-L!unknown@unknown.invalid PRIVMSG #esoteric :I'm kidding ;) < 1117737734 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :I would not call HQ9+ a programming language, no. But I still like it. < 1117737744 0 :GregorR-L!unknown@unknown.invalid PRIVMSG #esoteric :Heheh < 1117737789 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :Hm, I'd like to see an esolang where it's impossible to write a quine in the lang. < 1117737826 0 :GregorR-L!unknown@unknown.invalid PRIVMSG #esoteric :Make it incapable of outputting arbitrary characters. < 1117737827 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :malbolge? (I dare anyone to disprove it!) < 1117737828 0 :GregorR-L!unknown@unknown.invalid PRIVMSG #esoteric :Only numbers. < 1117737864 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :i dare anyone to write a quine in Sort! < 1117737875 0 :GregorR-L!unknown@unknown.invalid PRIVMSG #esoteric :Hmmmmmmmmmmmmmmmmmmmmmmmmmmmmmm < 1117737931 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :(man, what's the deal here? Everyone was like, "Hey, graue, we're really excited about your esoteric language," but now that I have a working interpreter no one seems to care) < 1117737992 0 :GregorR-L!unknown@unknown.invalid PRIVMSG #esoteric :I still haven't wrapped my head around it enough to write anything useful :P < 1117738198 0 :GregorR-L!unknown@unknown.invalid PRIVMSG #esoteric :\22 didn't get translated into a " for me ... < 1117738227 0 :GregorR-L!unknown@unknown.invalid PRIVMSG #esoteric :Oh wait .. < 1117738230 0 :GregorR-L!unknown@unknown.invalid PRIVMSG #esoteric :Maybe I'm wrong ... < 1117738289 0 :GregorR-L!unknown@unknown.invalid PRIVMSG #esoteric :a := "a := \22" "a" "" ? ~ < 1117738289 0 :GregorR-L!unknown@unknown.invalid PRIVMSG #esoteric :quit := "" < 1117738302 0 :GregorR-L!unknown@unknown.invalid PRIVMSG #esoteric :Seems like that should output: < 1117738315 0 :GregorR-L!unknown@unknown.invalid PRIVMSG #esoteric :a := "a := " or something < 1117738320 0 :GregorR-L!unknown@unknown.invalid PRIVMSG #esoteric :Still working on it :P < 1117738360 0 :GregorR-L!unknown@unknown.invalid PRIVMSG #esoteric :Still working on it :P < 1117738367 0 :GregorR-L!unknown@unknown.invalid PRIVMSG #esoteric :Whoops, up-entered in the wrong window. < 1117738702 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :an expression can't find itself with a regex < 1117738707 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :it only searches all the other expression names < 1117738711 0 :GregorR-L!unknown@unknown.invalid PRIVMSG #esoteric :Ohhhhhhhhhhhhhh < 1117738729 0 :GregorR-L!unknown@unknown.invalid PRIVMSG #esoteric :I guess that makes sense, otherwise it would recurse forever :P < 1117738750 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :no it wouldn't, i just disabled that feature to make it esoteric :) < 1117738838 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :you realize, don't you, that it only searches expression names, not the expressions themselves? < 1117739017 0 :GregorR-L!unknown@unknown.invalid PRIVMSG #esoteric :I thought it searched the names and replaced with the expressions, but I'm realizing that that's wrong. < 1117739069 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :for the record, I do consider HQ9+ a programming language, just not Turing-complete < 1117739092 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :graue: the lack of examples makes the idea difficult to aprehend < 1117739108 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :to me at least < 1117739247 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :hm, my Spanish->English dict says "aprehender" = "seize" < 1117739316 0 :GregorR-L!unknown@unknown.invalid PRIVMSG #esoteric :Apprehend might be another word :P < 1117739366 0 :sp3tt!~chatzilla@cust-148-133.elhandel.umeaenergi.se JOIN :#esoteric < 1117739368 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :oops, right, sorry < 1117739410 0 :GregorR-L!unknown@unknown.invalid PRIVMSG #esoteric :Though seize is right too I suppose. < 1117739412 0 :GregorR-L!unknown@unknown.invalid PRIVMSG #esoteric :Just a strange context. < 1117739457 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :pgimeno, i've included all the examples i've been able to come up with < 1117739458 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :maybe grab would make more sense < 1117739471 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :it seems possible to make more sophisticated programs, but i haven't figured out how to do so yet < 1117739480 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :have you seen hello3.sort? it illustrates some features usefully < 1117739494 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :nope, I just downloaded the zip < 1117739523 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :get the new tar.gz from http://esolang.org/research/ < 1117739528 0 :GregorR-L!unknown@unknown.invalid PRIVMSG #esoteric :I'm trying to figure out how to have a decrementer ... have something like a99 := "a98", but then a98 becomes a97, etc. < 1117739530 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :it also fixes some bugs in the interpreter < 1117739545 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :well, you need at least two expressions to pull that off < 1117739560 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :an expression can rename only itself, but it can access only the names of others < 1117739588 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :graue: i care about sort.. but i need time to get an idea how to do things < 1117739594 0 :GregorR-L!unknown@unknown.invalid PRIVMSG #esoteric :Yeah, I figured I would need more than one, but still haven't figured out how :P < 1117739601 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :jix, cool < 1117739630 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :graue: oh, by the way, http://www.esolangs.org/wiki/ redirects to voxelperfect < 1117739637 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :i hate this.. every day i add a new dns server to my list and the 2nd day it's down < 1117739669 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :pgimeno: yeah i am aware, i'm not sure if there is a way to fix that < 1117739682 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :(other than making it do the reverse) < 1117739693 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :there's an ugly way, using index.html and a refresh with a relative path < 1117739727 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :the HTTP spec doesn't allow refreshes with relative paths < 1117739733 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :yuck < 1117739739 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :however, i could examine the Host: header in the request < 1117739748 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :i was hoping for a way to do it without editing MediaWiki :) < 1117739755 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :in php? < 1117739765 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :you'd just need an index.php < 1117739783 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :i already do, it's from mediawiki < 1117739797 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :oh, dang < 1117739857 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :btw, when are you going to set up the database and images backup? < 1117739923 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :soonly < 1117739925 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :is there demand now? < 1117739979 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :well, I'm already backing up svn and waiting to start backing up the rest < 1117739991 0 :GregorR-L!unknown@unknown.invalid PRIVMSG #esoteric :Perhaps I'm confused, but it seems that the regex "a(.)" works bu "a(.!)" does not ... < 1117740009 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :! and @ aren't allowed within groups < 1117740015 0 :GregorR-L!unknown@unknown.invalid PRIVMSG #esoteric :Crapsy. < 1117740017 0 :GregorR-L!unknown@unknown.invalid PRIVMSG #esoteric :Hmmmmm < 1117740062 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :i think it'll search for a literal ! if you do that, actually < 1117740073 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :so there is a way to search for a literal ! or @, do [!] or [@] < 1117740331 0 :sp3tt!unknown@unknown.invalid PRIVMSG #esoteric :Is it possible to write a quine in Chef? XD < 1117740364 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :I would think so... < 1117740369 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :but HARD < 1117740424 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :btw sp3tt, is that Chef-interpreter you made available on the web somewhere? < 1117740430 0 :sp3tt!unknown@unknown.invalid PRIVMSG #esoteric :Not yet... < 1117740442 0 :sp3tt!unknown@unknown.invalid PRIVMSG #esoteric :It has some regexp trouble when it comes to multiple bowl.s < 1117741457 0 :sp3tt!unknown@unknown.invalid PRIVMSG #esoteric :These troubles seem to have disappeared overnight :O < 1117741469 0 :sp3tt!unknown@unknown.invalid PRIVMSG #esoteric :I'll write some comments and upload it... < 1117741480 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :great :) < 1117741942 0 :Keymaker!~Not@wire74.adsl.netsonic.fi JOIN :#esoteric < 1117741945 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :grrhh.. < 1117741952 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :this channel is TOO active!!!!!! :p < 1117741973 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :logs are filled with interesting stuff about interesting new or old languages < 1117741983 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :i don't have time to read them nor think about them!!!!!!!!!!! < 1117741994 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :just read and think about Sort < 1117742000 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :the others can wait < 1117742027 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :is that some new or old? < 1117742197 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :new < 1117742203 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :i made it up two days ago < 1117742210 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :got the interpreter working yesterday < 1117742223 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :still have yet to figure out how to write anything more sophisticated than hello, world in it < 1117742233 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :ok < 1117742244 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :how it works? :) < 1117742354 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :it's a series of named expressions < 1117742369 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :at runtime, first the expressions are sorted lexically according to their names < 1117742390 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :then the expressions are evaluated in turn going down, and wrapping around when reaching the bottom < 1117742391 0 :sp3tt!unknown@unknown.invalid PRIVMSG #esoteric :GAH. Two problems is named correctly. < 1117742411 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :the catch is that each expression renames itself to the value it evaluates to < 1117742420 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :what means 'lexically'? < 1117742422 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :the other catch is that this renaming is the only form of data storage < 1117742435 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :hmm sounds really tricky < 1117742436 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :the final catch is that an expression can only rename itself and can only examine other expressions' names < 1117742445 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :lexically means, it's sorted according to the results of strcmp() < 1117742457 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :that probably is not what "lexically" really means, i apologize < 1117742473 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :oh yeah, there's actually one more catch < 1117742490 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :(well, haven't used strcmp()..) < 1117742495 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :the program ends when only one expression is remaining, and prints out the name of that expression (that's its only form of output) < 1117742508 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :sounds really hard < 1117742510 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :an expression can delete itself by renaming itself to "", or can clobber another expression by renaming itself to that expression's name < 1117742535 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :the sorting is based on bytes being less than or greater, starting with the first byte < 1117742545 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :i.e., if you consider only capital letters, it's alphabetical < 1117742551 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :terminate := ".!" "" ? <- that terminates any program < 1117742568 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :not necessarily! < 1117742579 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :another expression could run in the meantime and rename itself to "terminate" < 1117742587 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :oh, right < 1117742593 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :uh < 1117742603 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :too hard language for me, probably < 1117742615 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :well, maybe you can try it < 1117742621 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :it's definitely too hard for me, its inventor < 1117742626 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :i can :) < 1117742633 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :but i can't get anything done probably < 1117742635 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :by the way, i fixed the problem on the wiki < 1117742648 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :nice < 1117742650 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :when you submit edits, it now redirects you using the proper hostname, so you can edit comfortably from http://esolangs.org < 1117742673 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :Wow! I just noticed that David Morgan-Mar, the creator of Chef, Piet, Whenever etc. is the author of the Irregular Webcomic! < 1117742706 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :? < 1117742708 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :i had never heard about Irregular Webcomic until i read the wikipedia article about Mr. Morgan-Mar < 1117742712 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :what's that? < 1117742714 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :http://www.irregularwebcomic.net/ < 1117742714 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :but i guess it's cool that he did something famous < 1117742742 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :I've been reading that comic for a while without knowing :D < 1117742830 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :has sort any site` < 1117742831 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :? < 1117742851 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :not at the moment < 1117742860 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :where are the example? < 1117742864 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :or interpreters < 1117742866 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :i hope to rename it once i learn more about its characteristics < 1117742872 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :http://esolangs.org/research/ < 1117742873 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric ::) < 1117742880 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :ah < 1117742970 0 :sp3tt!unknown@unknown.invalid PRIVMSG #esoteric :I was thinking of a very painful esolang... Using mathematics. < 1117742995 0 :sp3tt!unknown@unknown.invalid PRIVMSG #esoteric :It is partly based on beatnik, but instead of scrabble words, mathematical functions... < 1117743009 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :graue: I think it may fail to be turing-complete < 1117743042 0 :sp3tt!unknown@unknown.invalid PRIVMSG #esoteric :A modulo operation determines which opcode a given value represents. < 1117743045 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :maybe it's practically, but not formally, turing-complete < 1117743045 0 :GregorR-L!unknown@unknown.invalid QUIT :Read error: 113 (No route to host) < 1117743049 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :http://esolangs.org/wiki/Turing-complete < 1117743100 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :are you sure that something can e.g. do a finite loop before stopping? < 1117743117 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :no, i am not < 1117743118 0 :sp3tt!unknown@unknown.invalid PRIVMSG #esoteric :So, if the opcode for "Read from STDIN" is 3, one would have to come up with a mathematical function to return 3 at that point on the X axis XD < 1117743130 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :however, i do not know of a reason why that is not possible, either < 1117743168 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :the idea about the language that uses md5 as input sounds great < 1117743191 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :(although then there are more than one possible inputs) < 1117743223 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :a language with only one possible input would be pretty boring < 1117743242 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :;) < 1117743243 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :i mean more than one input for one md5 < 1117743245 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric ::) < 1117743256 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :well, if there's an stopper like terminate := ".!" "" ? then the only way to do a loop is to insert strings before reaching it < 1117743296 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :sp3tt: i had the same idea! < 1117743309 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :hmm, so why do you have to use an expression like that? < 1117743344 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :this language all crazy... < 1117743375 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :graue: in order to terminate < 1117743380 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :but i have also an idea for an lazy evaluating bf like list based language.. < 1117743387 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :you don't need clobbering, though < 1117743399 0 :sp3tt!unknown@unknown.invalid PRIVMSG #esoteric :You need an opcode to change between functions though. < 1117743402 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :you can make every expression but one rename itself to "" if a certain condition is met < 1117743411 0 :sp3tt!unknown@unknown.invalid PRIVMSG #esoteric :Imagine how representations of programs would look! < 1117743420 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :this should be possible between ^ and ? < 1117743427 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :the language is "lossy" in the sense that no new expressions can be created; all you can aspire to is swapping < 1117743429 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :sp3tt no your function can have an unlimited set of variables < 1117743429 0 :sp3tt!unknown@unknown.invalid PRIVMSG #esoteric :I'll try to code an interpreter for something like that this weeken. < 1117743433 0 :sp3tt!unknown@unknown.invalid PRIVMSG #esoteric :Weekend* < 1117743433 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :and you can change them < 1117743437 0 :sp3tt!unknown@unknown.invalid PRIVMSG #esoteric :Naming suggestions? < 1117743447 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :i want to implement it... < 1117743449 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :pgimeno, you can make fake variables, by adding onto the ends of names of existing expression < 1117743453 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :s < 1117743497 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :the difficulty arises only because an expression cannot look at its own name < 1117743513 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :in any case it's a quite unamageable beast :) < 1117743513 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :so you have to do something like, a renames itself to a99, which makes b rename itself to b98, which makes a rename itself to a97 < 1117743539 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :unmanageable < 1117743559 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :hm, i think there is a change that would make it more manageable < 1117743604 0 :sp3tt!unknown@unknown.invalid PRIVMSG #esoteric :kipple: http://rename.noll8.nu/sp3tt/chef.py < 1117743605 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :if a regex has (a)! at one point, and it matches aaa, perhaps aaa could be captured instead of a < 1117743626 0 :sp3tt!unknown@unknown.invalid PRIVMSG #esoteric :Has some bugs, no error reporting and it does not support stir. < 1117743631 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :that would make it possible for a single regex to look for "99", "4", and "", for instance < 1117743645 0 :sp3tt!unknown@unknown.invalid PRIVMSG #esoteric :But it is version 0.0.1 after all :) < 1117743649 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :also, character classes would help a lot < 1117743661 0 :sp3tt!unknown@unknown.invalid PRIVMSG #esoteric :Tell me what you think... < 1117743686 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :i don't think that makes anything possible that isn't now, though < 1117743689 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :it would just make it more manageable < 1117743883 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :thanks sp3tt. I've written a short chef article in the wiki. Should I link to it, or do you want to wait until a more complete version? < 1117743938 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :i'm going to call my language lazy-brain < 1117743945 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :sp3tt: so, stir and sous-chefs is all it is lacking now? < 1117744146 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :must go for a while.. < 1117744147 0 :Keymaker!unknown@unknown.invalid QUIT :"Freedom!" < 1117744187 0 :sp3tt!unknown@unknown.invalid PRIVMSG #esoteric :Sous-chefs work. < 1117744196 0 :sp3tt!unknown@unknown.invalid PRIVMSG #esoteric :Link me to the article. < 1117744200 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :noce! < 1117744212 0 :sp3tt!unknown@unknown.invalid PRIVMSG #esoteric :Loops are a bit buggy though... < 1117744219 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :nice! I mean... < 1117744220 0 :sp3tt!unknown@unknown.invalid PRIVMSG #esoteric :Two Problems XD < 1117744222 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :anyway: http://esolangs.org/wiki/Chef < 1117744223 0 :sp3tt!unknown@unknown.invalid PRIVMSG #esoteric ::) < 1117744265 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :ACTION must install python now... < 1117744270 0 :sp3tt!unknown@unknown.invalid PRIVMSG #esoteric :Thanks. Have to go now. Be back tomorrow. Esoteric for life! < 1117744272 0 :sp3tt!unknown@unknown.invalid QUIT :"Chatzilla 0.9.68a [Firefox 1.0.4/20050511]" < 1117744436 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :lazy-brain will rule < 1117744475 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :it's inspired by bf and haskell < 1117744554 0 :puzzlet!unknown@unknown.invalid TOPIC #esoteric :Another brainfuck site (http://www.bf-hacks.org/) is open! ~ http://chriscoyne.com/cfdg/ ~ Esolang Preservation project info: http://tinyurl.com/d3fk5 ~ Esolang wiki: http://esolangs.org/wiki/Main_Page < 1117744715 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :I think elpp can be removed from the topic < 1117744878 0 :puzzlet!unknown@unknown.invalid QUIT :"Leaving" < 1117745108 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :hmm i need to change some things in my concept < 1117745192 0 :pgimeno!unknown@unknown.invalid TOPIC #esoteric :Another brainfuck site (http://www.bf-hacks.org/) is open! ~ http://chriscoyne.com/cfdg/ ~ Esolang wiki: http://esolangs.org/wiki/Main_Page < 1117745247 0 :graue!unknown@unknown.invalid TOPIC #esoteric :Another brainfuck site (http://www.bf-hacks.org/) is open! ~ http://chriscoyne.com/cfdg/ ~ Esolang wiki: http://esolangs.org/wiki/ < 1117745251 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :even shorter < 1117746070 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :what's all this then? < 1117746077 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :smetana is NOT turing complete! < 1117746088 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :looks like i'm going to have to start editing this wiki thing :) < 1117746128 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :cpressey: lament proved otherwise < 1117746225 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :i can give you a proof that SMETANA programs are equivalent to FSA's, though. < 1117746231 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :it's actually pretty trivial < 1117746240 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :a SMETANA program has a finit # of states < 1117746244 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :yeah < 1117746303 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :but there's no size limit for a SMETANA program < 1117746335 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :there's no size limit for an FSA either < 1117746348 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :given a "big enough FSA" you can compute anything < 1117746357 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :that doesn't mean FSAs = Turing Machines < 1117746393 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :that's what "practical Turing completeness" referred to :) < 1117746424 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :I think it's just a problem on the choice of words < 1117746576 0 :fizzie!unknown@unknown.invalid PRIVMSG #esoteric :There is a size limit for an FSA: it must not have an infinite number of states. < 1117746738 0 :fizzie!unknown@unknown.invalid PRIVMSG #esoteric :Hm. Does the alphabet for a FSA need to be finite? Perhaps not. < 1117746908 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :speaking of FSAs, Malbolge may fail to be complete enough for performing complex tasks; it has a limit of 3^10 memory positions which may be insufficient even for the requisites of writing a countdown from e.g. 65535 to 0 (let alone a true 99bob) < 1117746911 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :ok, no "finite size limit" :) < 1117746927 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :yes, the alphabet has to be finite IIRC < 1117746951 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :pgimeno: but is that just an artefact of implementation? < 1117746986 0 :fizzie!unknown@unknown.invalid PRIVMSG #esoteric :I'm not sure if an infinite alphabet would make much of a difference. Perhaps it would. < 1117747007 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :well, it's a VM with 10 trits per register < 1117747022 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :the 10 trits is part of the language because rotations, one of the two operators that can be used, are 10 trits < 1117747133 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :every memory position holds a 10-trit machine word, and the instruction and data pointer and the accumulator are also a machine word long each < 1117747164 0 :Keymaker!~Not@wire74.adsl.netsonic.fi JOIN :#esoteric < 1117747186 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :the machine words might be extended to, say, 24 trits and maybe that makes it useable < 1117747193 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :yeah, it might be like befunge-93 then. < 1117747210 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :or... no, even befunge has a stack, making it a PDA < 1117747235 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :what does PDA stand for? < 1117747245 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :(assuming it's not Personal Data Assistant) < 1117747256 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :Pushdown Automata < 1117747268 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :ah thanks < 1117747407 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :I wrote my language Bitxtreme as a parody on Malbolge's capabilities < 1117747515 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :to express with some sense of humor my doubts about it being powerful enough as to perform simple tasks < 1117747547 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :(with a bit of irony) < 1117747777 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :8) < 1117747896 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :I'm sorry you took it seriously, Keymaker < 1117747926 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric ::) < 1117747941 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :I didn't intend to trick anyone < 1117747947 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :ok < 1117747961 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :you don't need to tell everyone i'm stupid :P < 1117747985 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :heh, I also didn't intend to mean that :) < 1117747996 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :Keymaker: don't worry. It's not a secret ;) < 1117748007 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :hah < 1117748016 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric ::) < 1117748051 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :hmmm < 1117748060 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :can anyone remember the name of that esoteric language that < 1117748064 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :has mouse support < 1117748068 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :and 2d graphics < 1117748071 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :anyway, nice to see all the updates in the wiki today. < 1117748076 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :like the output is to 2d screen < 1117748089 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :(as pixels and shapes like triangles and circles) < 1117748120 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :there was even pong made in it < 1117748272 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :that just rings a distant bell < 1117748324 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :if i remember any correct it started with 'o' < 1117748329 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :well, doesn't help much < 1117748458 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :no, it starts with 'g'! < 1117748462 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :Gammaplex! < 1117748467 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :http://www.student.kuleuven.ac.be/~m0216922/gammaplex/Manual.html < 1117748582 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :lol, the language has a big set of instructions :D < 1117748615 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :I'm afraid my bell was something else < 1117748639 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :ok < 1117748839 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :that one is in danger of disappearing, btw < 1117748844 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :the page is by one student < 1117748854 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :by a student, I mean < 1117749194 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :i don't like it < 1117749218 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :an overcomplicated befunge dialect < 1117749221 0 :graue!unknown@unknown.invalid QUIT :Read error: 60 (Operation timed out) < 1117749225 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :yeah < 1117749279 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :after befunge 94 and wierd and piet, it seems there's no new ground left for 2d languages :) < 1117749290 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :oh and the game of life of course < 1117749301 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric ::) < 1117749310 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :well, better get to 3d then.. < 1117749335 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :I think a saw a 4d language somewhere... < 1117749342 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :yeah < 1117749345 0 :graue!~piecrust@ip68-100-130-21.dc.dc.cox.net JOIN :#esoteric < 1117749348 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :you're not the only one then i guess < 1117749358 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :i remember seeing something like that as well < 1117749426 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :it was probably befunge < 1117749461 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :a funge you mean? < 1117749483 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :i thought that befunge-like languages were called funges < 1117749492 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :probably befunge < 1117749492 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :no, I don't think it was a funge < 1117749512 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :okay, funge. < 1117749523 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric ::) < 1117749529 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :or befunge < 1117749543 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :quadfunge? < 1117749564 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :http://www.cliff.biffle.org/esoterica/4dl.html < 1117749582 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :yeah, that's it < 1117749591 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :yeah < 1117749645 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :later funges are bizarrely complex < 1117749659 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :dunno if they allowed for more than 2d but seems likely < 1117749669 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric ::) < 1117749698 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :it's amazing how much work cpressey put in later funges < 1117749706 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :heh < 1117749707 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :and i doubt anybody ever actually used them :) < 1117749723 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :yes < 1117749723 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :just look at http://catseye.mine.nu:8080/projects/funge98/doc/funge98.html < 1117749738 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :hah < 1117749772 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :seems like an attempt to make it a non-esoteric language < 1117749835 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :Funge-98 was mostly designed by committee (isn't it obvious? :) so I can't take entire credit :) < 1117749891 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :it's a language family, not a single language, technically, so of course it's a royal mess. < 1117749903 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric ::D < 1117749906 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :yeah, but... why?! :) < 1117749908 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :it kind of maxed out at Nefunge (n-dimensional) and Chronofunge (time-travelling) < 1117749919 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric ::) < 1117749923 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :lament: heh < 1117749932 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :that is the WRONG question to ask in this community :) < 1117749937 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :cpressey: did people ever write any programs fon any of those? < 1117749942 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :how would time travelling work in language? < 1117749959 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :lament: they were never specified fully or implemented, so i imagine, no < 1117749962 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :ACTION thinks of continuations < 1117749967 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :Keymaker: painfully < 1117749972 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :yeah < 1117749973 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :yeah, continuations kind of < 1117749975 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :i can see that < 1117749979 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :store the state of the program at every step < 1117749987 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :then when you travel back in time, restore it < 1117749998 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :so, continuations without returning anything? < 1117750002 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :seems horribly useful :) < 1117750019 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :it's the time travelling to the future that we never quite modelled :) < 1117750029 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric ::) < 1117750072 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :hmm < 1117750075 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :shouldn't be too hard! < 1117750109 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :well, probably not unless the language has input < 1117750118 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :while (year < 2100); < 1117750150 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :well, any instruction implicitly travels to the future < 1117750162 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :at an alarmingly fast rate of one second per second < 1117750171 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric : hehe < 1117750208 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :ok. how about letting the interpreter optimize it by altering the system clock instead? ;) < 1117750213 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :hey! i got an idea: program language that has one bit as it's memory, but it can be accessed at different times < 1117750242 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :hmmmmm < 1117750245 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :neat! (as long as you can move back and forward in time) < 1117750252 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :and since future is uncertain, the future bit, along with all the ones before it would be randomized < 1117750258 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :so the future couldn't be predicted < 1117750274 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :hmm < 1117750284 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :in Choon you can access the past < 1117750309 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :it has one 'register' and you can access its value at any past point < 1117750337 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :so, does this mean somebody used time travelling and stole my idea? < 1117750352 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :no < 1117750358 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :as you said, time travelling to the future isn't possible < 1117750358 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :ah good :) < 1117750363 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :well, it wasn't a one-bit register, and choon had other things as well < 1117750374 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :yeah, so i think i can still use it < 1117750376 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :good < 1117750378 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :hahaha < 1117750427 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :besides nobody knows about choon < 1117750436 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :yeah < 1117750437 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :it's on the wiki, everyone will know soon < 1117750439 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :and it wasn't the key feature of choon < 1117750445 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :oh, so that's how wiki works < 1117750475 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :but seriously, since i hadn't idea about that and it isn't totally same idea, so i can't see a problem if i use this idea < 1117750486 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :indeed, there is no problem whatsoever < 1117750486 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :as well, many esolangs share same features < 1117750498 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :but this will be probably much different than any choon < 1117750508 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :now i'll try to think with brain < 1117750530 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :the key feature of choon is sound output < 1117750534 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :nobody cares about its other features < 1117750590 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :ok.. lazy-brain specs are complete (in my head) < 1117750624 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :lazy brain??? < 1117750629 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :now write them down before you forget < 1117750631 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :how what < 1117750656 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :lazy-brain is brainfuck with functions,lists and lazy evaluation < 1117750672 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :how!?? < 1117750710 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :well, one could code those extras with normal brainfuck :p < 1117750745 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :you could code a c compiler in smallfuck+io extension < 1117750764 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :yes < 1117750770 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :that would be neat indeed < 1117750772 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric ::) < 1117750781 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :and notice i was only joking, < 1117750783 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :that would be grotesque < 1117750789 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :i'm waiting to see your work now < 1117750792 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :sounds fun < 1117750796 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :it would be neat to write anything in smallfuck < 1117750799 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :(without cheating) < 1117750807 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :cheating? < 1117750813 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :compiling brainfuck code to smallfuck < 1117750816 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :yeah < 1117750818 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :no < 1117750821 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :that's not allowed! < 1117750853 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :i'll write something it when i have time < 1117750910 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :jix: so what about this lazybrain thing! < 1117750927 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :lament: wait.. i post an example < 1117750936 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :cool < 1117750944 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :it doesn't shows all features.. just lists and functions < 1117750995 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :ok < 1117751094 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :Today I'm going to release a new version of FYB with a better spec (Thanks jix for telling me what things needed to be added) and more verbose output when verbose is enabled. < 1117751116 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :http://rafb.net/paste/results/cY9zp019.html < 1117751131 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :should print ABCDEFGHIJKLMNOPQRSTUVWXYZ < 1117751225 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :wait no.. updated specs in my head < 1117751227 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :well, I'm going to sleep, so you guys don't flood up the log while I'm away, ok? ;) < 1117751233 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :ateoh < 1117751233 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :aoeu < 1117751233 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :ho < 1117751234 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :qrcjkgx < 1117751235 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :jqkrcgx < 1117751237 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :.ptnhoe < 1117751240 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :gcfaoeu < 1117751242 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :heheh < 1117751242 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :qfxkglcf < 1117751243 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :lament: while he's away! < 1117751250 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :oh, oops < 1117751254 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :;) < 1117751263 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :i'm too impatient :( < 1117751268 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :g'nite all < 1117751287 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :gn8 < 1117751342 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :g'nite < 1117751347 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :bye < 1117751348 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :nite < 1117751417 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :http://rafb.net/paste/results/pzwMJM37.html < 1117751528 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :its: upto a b = (a:if a==b EMPTY else upto a+1 b) < 1117752656 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :hmm i need to rethink some things for lazy brain < 1117752664 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :g'nite < 1117752668 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :ok < 1117752724 0 :jix!unknown@unknown.invalid QUIT :"Banned from network" < 1117752773 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :hmmm < 1117752804 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :i think i'll watch some movie < 1117752816 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :'nite < 1117752822 0 :Keymaker!unknown@unknown.invalid QUIT :"Freedom!" < 1117764277 0 :graue_!~graue@ip68-100-130-21.dc.dc.cox.net JOIN :#esoteric < 1117764387 0 :graue_!unknown@unknown.invalid PRIVMSG #esoteric :GregorR: is FukYourBrane really a programming language, rather than a game? < 1117764423 0 :graue_!unknown@unknown.invalid PRIVMSG #esoteric :it's definitely of interest to the Esoteric World, but i'm thinking maybe it shouldn't go on the language list in the wiki < 1117764790 0 :kipple!unknown@unknown.invalid QUIT :Read error: 60 (Operation timed out) < 1117770008 0 :graue_!unknown@unknown.invalid PRIVMSG #esoteric :the wiki doesn't have any programming languages whose names start with X < 1117770015 0 :graue_!unknown@unknown.invalid PRIVMSG #esoteric :someone make up a language with a name that starts with an X < 1117771939 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :heh < 1117772442 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :graue_: I guess the question is, is RedCode a programming language? < 1117772536 0 :malaprop!unknown@unknown.invalid QUIT :"sleep" < 1117773111 0 :graue_!unknown@unknown.invalid PRIVMSG #esoteric :RedCode may be but CoreWars isn't < 1117773215 0 :graue_!unknown@unknown.invalid PRIVMSG #esoteric :FYB/FukYorBrane is associated with your game, not with the language, and you use the page to describe the game, not the language < 1117773223 0 :graue_!unknown@unknown.invalid PRIVMSG #esoteric :hence, i'd call it a game, and not a language < 1117773239 0 :graue!unknown@unknown.invalid PART #esoteric :? < 1117773244 0 :graue_!unknown@unknown.invalid NICK :graue < 1117773288 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :I see. So where should I link to it? I'd rather not have it just be a hanging page ... < 1117773310 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :add it to [[Category:Brainfuck derivatives]] < 1117773350 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :perhaps link it from Brainfuck as a "more interesting variant", too < 1117773435 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :ACTION is unsure how to get to the Category: Brainfuck derivatives page ... < 1117773551 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :add "[[Category:Brainfuck derivatives]]" at the end of the FYB article < 1117773587 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :Aha < 1117773588 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :There 'tis. < 1117776931 0 :graue!unknown@unknown.invalid QUIT :"Leaving" < 1117780087 0 :GregorR-L!~GregorR-L@c-24-21-138-66.hsd1.or.comcast.net JOIN :#esoteric < 1117780209 0 :GregorR-L!unknown@unknown.invalid PRIVMSG #esoteric :FYB A0.6 released < 1117780223 0 :GregorR-L!unknown@unknown.invalid PRIVMSG #esoteric :Cool new verbose system implemented. < 1117780236 0 :GregorR-L!unknown@unknown.invalid PRIVMSG #esoteric :Produces megs of output for a run, but is very helpful. < 1117784702 0 :graue!~piecrust@ip68-100-130-21.dc.dc.cox.net JOIN :#esoteric < 1117784726 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :i uploaded a wiki sql backup to http://www.oceanbase.org/graue/junk/sqlbackup.zip < 1117784734 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :so pgimeno, you can download that and stop worrying < 1117784746 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :it doesn't have the images, but there was only one image anyway, and it sucked, so no great loss < 1117784748 0 :graue!unknown@unknown.invalid PART #esoteric :? < 1117785599 0 :clog!unknown@unknown.invalid QUIT :ended < 1117785600 0 :clog!unknown@unknown.invalid JOIN :#esoteric < 1117790221 0 :sp3tt!~sp3tt@skola-elev2-182.edu.umea.se JOIN :#esoteric < 1117790357 0 :GregorR-L!unknown@unknown.invalid QUIT :Read error: 110 (Connection timed out) < 1117790459 0 :sp3tt!unknown@unknown.invalid QUIT :Client Quit < 1117793284 0 :kipple!~kipple@163.80-202-100.nextgentel.com JOIN :#esoteric < 1117801359 0 :sp3tt!~sp3tt@skola-elev2-182.edu.umea.se JOIN :#esoteric < 1117801984 0 :sp3tt!unknown@unknown.invalid QUIT :Read error: 104 (Connection reset by peer) < 1117802271 0 :malaprop!~ph@ppp-68-251-59-237.dsl.chcgil.ameritech.net JOIN :#esoteric < 1117805837 0 :jix!jix@p5489AE15.dip.t-dialin.net JOIN :#esoteric < 1117806024 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :moin < 1117807660 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :Hoi < 1117807867 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :hi < 1117807956 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :Gregor: are the periods at the end of each line optional in ORK? < 1117807962 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :Yes < 1117807967 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :ok. < 1117807981 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :It ignores the punctuation, but it's good for clarity *shrugs* < 1117808000 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :I'm writing a polyglot, so it's nice to know these things :) < 1117808009 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :*whew* < 1117808014 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :Good luck with that *head explodes* < 1117808037 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :so far I have brainfuck, befunge and ORK and it was rather trivial < 1117808097 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :I can put the befunge and brainfuck code straight into the file, and ORK just ignores it! < 1117808103 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :I guess since you would only need to formally comment in ORK, it ought not be too hard *shrugs* < 1117808111 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :Oh, right X-D < 1117808127 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :I didn't make an } else { printf("THIS BAD CODE!!!"); } < 1117808133 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :what do you mean with "formally comment"? < 1117808146 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :Well, by the spec you have to use a # to comment. < 1117808153 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :But really you don't ;) < 1117808163 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :hehe. same with kipple :) < 1117808182 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :cipple support both types of comments < 1117808211 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :what is the other type? (not #) < 1117808259 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :10>o This is ignored because here is no command "Hello">o < 1117808278 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :ah, yes. same here < 1117808301 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :i tried to get as close to your interpreter as possible < 1117808323 0 :sp3tt!~chatzilla@cust-148-133.elhandel.umeaenergi.se JOIN :#esoteric < 1117809301 0 :J|x!jix@p5489AE15.dip.t-dialin.net JOIN :#esoteric < 1117809508 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :Yay! I've got the polyglot working with befunge, brainfuck, kipple and ORK :) < 1117809892 0 :jix!unknown@unknown.invalid QUIT :Read error: 110 (Connection timed out) < 1117809899 0 :J|x!unknown@unknown.invalid NICK :jix < 1117809965 0 :fizzie!unknown@unknown.invalid PRIVMSG #esoteric :What does it do? < 1117809974 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :just Hello world... < 1117809979 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :rather boring < 1117809999 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :but I intend to add several more languages < 1117810252 0 :sp3tt!unknown@unknown.invalid PRIVMSG #esoteric :Polyglot? < 1117810288 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :program that is valid in more than one language < 1117810293 0 :sp3tt!unknown@unknown.invalid PRIVMSG #esoteric :Ah. < 1117810301 0 :sp3tt!unknown@unknown.invalid PRIVMSG #esoteric :Link/Example? < 1117810315 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :http://en.wikipedia.org/wiki/Polyglot_(computing) < 1117810730 0 :sp3tt!unknown@unknown.invalid PRIVMSG #esoteric :And your code? < 1117810767 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :still a work in progress... < 1117810849 0 :jix!unknown@unknown.invalid NICK :jix|essen < 1117810890 0 :sp3tt!unknown@unknown.invalid PRIVMSG #esoteric :From the eight language polyglot page: "25 Jan 2001 Richard Stallman The proper name is GNU/Polyglot, damn you!" < 1117810937 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :added chef < 1117810970 0 :sp3tt!unknown@unknown.invalid PRIVMSG #esoteric ::O < 1117810993 0 :sp3tt!unknown@unknown.invalid PRIVMSG #esoteric :I am working on a language with some basic self modification... < 1117811070 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :bbl < 1117812765 0 :jix|essen!unknown@unknown.invalid NICK :jix < 1117813073 0 :Keymaker!~Not@wire74.adsl.netsonic.fi JOIN :#esoteric < 1117813088 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :hey! i wanna write a polyglot too! < 1117813097 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :ACTION starts writing < 1117813134 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :Keymaker: Just write 'print "hello world";' and you've got python, perl, and PHP done. : < 1117813197 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric ::) < 1117813234 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :Now if you really want to have fun, write a polygot quine. < 1117813256 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :hmm < 1117813260 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :that sounds really interesting < 1117813274 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :malaprop: ruby too < 1117813278 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :i'll try! < 1117813285 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :bbl < 1117813288 0 :Keymaker!unknown@unknown.invalid QUIT :"Freedom!" < 1117813305 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :jix: Damn am I good. < 1117813535 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :but for php you need < 1117813622 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :one of my polyglots: http://rafb.net/paste/results/d6Bq0K77.html < 1117813632 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :4 languages < 1117815437 0 :sp3tt!unknown@unknown.invalid PRIVMSG #esoteric :http://rename.noll8.nu/sp3tt/mathspec.txt Comments? < 1117815621 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :are you going to use the 8 bf commands ? < 1117816079 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :RMS doesn't get the respect he deserves. < 1117816129 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :Did RMS create an esolang that doesn't have a wiki page? < 1117816135 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :XD < 1117816141 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :Yeah, it's called "emacs" < 1117816154 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :I guess it's not a language, but it's pretty damn esoteric. < 1117816175 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :I was just referring to the quip about "GNU/Polyglot" < 1117816211 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :I'll stop calling "Linux" GNU/Linux the day I decide to release a program I care about under a weak license like BSD instead of GPL. < 1117816229 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :(Not that those are directly related) < 1117816373 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :sp3tt: do you have some code examples? < 1117816387 0 :sp3tt!unknown@unknown.invalid PRIVMSG #esoteric :Sure. < 1117816404 0 :sp3tt!unknown@unknown.invalid PRIVMSG #esoteric :http://rename.noll8.nu/sp3tt/hw.math < 1117816466 0 :sp3tt!unknown@unknown.invalid PRIVMSG #esoteric :Basically uses a stack to print Hello world, when it can be done without one. Also demonstrates how to use userdefined vars in functions. < 1117817945 0 :Keymaker!~a@wire74.adsl.netsonic.fi JOIN :#esoteric < 1117817958 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :this'll be fun. < 1117817965 0 :Keymaker!unknown@unknown.invalid PART #esoteric :? < 1117818145 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :http://rafb.net/paste/results/MmZgkY86.html < 1117818178 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :my 5 lang poly that prints: Just another hacker,\n < 1117818213 0 :sp3tt!unknown@unknown.invalid PRIVMSG #esoteric ::O I am surprised it is even possible. < 1117818274 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :in c i'm using #define:s and /**/ to comment the other code out < 1117818289 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :in bf i jump ([-][ code ]) over the code containing ,s < 1117818303 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :in ruby i end the code with __END__ < 1117818311 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :(with is defined as c macro ;) ) < 1117818315 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :which < 1117818362 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :line 13,14 is a comment for bash to line 21 and for perl to 24 < 1117818380 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :line 23 is a comment for bash to line 26 < 1117818393 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :now i'm going to add whitespace ;) < 1117818586 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :nah < 1117818591 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :i'm not going to do that < 1117818701 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :kipple < 1117819326 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :er < 1117819333 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :[-][code] isn't really safe < 1117819366 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :oh, wait < 1117819373 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :you were talking about something specific, not in general < 1117819374 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :ACTION shuts up < 1117819589 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :Kipple is included < 1117819598 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :6 langs.. i rule ;) < 1117819656 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :uh.. it's working with Cipple but not with the java interpreter < 1117819694 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :Cipple is very syntax tolerant =<<- is ignored because neither the first nor the second < have valid arguments < 1117820735 0 :sp3tt!unknown@unknown.invalid PRIVMSG #esoteric :3 != 3 according to python... < 1117821001 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :3 != 3 #=> False < 1117821065 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :sp3tt: that evaluates to False for me < 1117821123 0 :sp3tt!unknown@unknown.invalid PRIVMSG #esoteric :Exactly. < 1117821140 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :Which is correct. < 1117821272 0 :sp3tt!unknown@unknown.invalid PRIVMSG #esoteric :Not according to python if you don't use int() correctly first <.< < 1117821322 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :How is (3!=3)==False wrong? < 1117821390 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :enough polygloting for today.. < 1117821401 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :time to write down lazybrain specs < 1117821508 0 :OliBir!~bb_oli@202.70.71.242 JOIN :#esoteric < 1117821553 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :moin OliBir < 1117821706 0 :OliBir!unknown@unknown.invalid PRIVMSG #esoteric :HI < 1117821782 0 :OliBir!unknown@unknown.invalid PART #esoteric :? < 1117821796 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :0o < 1117821947 0 :NotGregorR!~GregorR@c-24-21-138-66.hsd1.or.comcast.net JOIN :#esoteric < 1117821954 0 :NotGregorR!unknown@unknown.invalid PRIVMSG #esoteric :... < 1117821957 0 :NotGregorR!unknown@unknown.invalid PRIVMSG #esoteric :HI < 1117821960 0 :NotGregorR!unknown@unknown.invalid PART #esoteric :? < 1117822242 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :0o... < 1117826494 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :anybody familiar with C-INTERCAL here? Chris? < 1117826514 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :I get an error when trying to compile the included examples < 1117826517 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :ICL999I NO SKELETON IN MY CLOSET, WOE IS ME! < 1117826517 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric : ON THE WAY TO 1 < 1117826517 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric : CORRECT SOURCE AND RESUBNIT < 1117827491 0 :jix!unknown@unknown.invalid QUIT :"Banned from network" < 1117829537 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :kipple: I don't know about C-INTERCAL but that error sounds as if it depends on a file from the distribution that can't be found < 1117829914 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :it does? < 1117829942 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :it's the same error that comes if I try to compile a file which doesn't exist. < 1117829977 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :the "no skeleton" part suggest it but you never know < 1117831817 0 :sp3tt!unknown@unknown.invalid QUIT :"Chatzilla 0.9.68a [Firefox 1.0.4/20050511]" < 1117834898 0 :Keymaker!~a@wire74.adsl.netsonic.fi JOIN :#esoteric < 1117835321 0 :jix!jix@p5489AE15.dip.t-dialin.net JOIN :#esoteric < 1117835351 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :ACTION is back < 1117835518 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric ::) < 1117835530 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :i'm gonna be few days away starting from tomorrow < 1117835559 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :a 140km bike trip (and the other 140km back) < 1117835565 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :totally 280 km < 1117835580 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :the longest trip i have ever done is ~10km < 1117835587 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric ::} < 1117836342 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :c is annoying! < 1117836353 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :it took me about 20 mins to realize a logical error.. < 1117836425 0 :graue!~graue@ip68-100-130-21.dc.dc.cox.net JOIN :#esoteric < 1117836472 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :yeah, C is pretty damn annoying < 1117836904 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :true < 1117836910 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :but it's fast < 1117836994 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :yes < 1117837049 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :ACTION hugs DirectNet, OBLISK, orkc, 2lc, and FYB. < 1117837053 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :I love you, C. < 1117837058 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :NOOOOOOOOOOOOOOOOOOOO < 1117837061 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :You're such a wonderful language. What power, what grace. < 1117837072 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :ACTION dies < 1117837076 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :(again) < 1117837095 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :ACTION does some pointer manipulation. < 1117837115 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :C is easy to learn because it does exactly what you tell it, but like, if you make large projects with it, it sort of becomes an impossible mess < 1117837174 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :doesn't it? right? < 1117837189 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :it's all about design. < 1117837196 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :Any language can become an impossible mess. < 1117837204 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :Mozilla is an impossible mess because of bad design. < 1117837214 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :But yes, C doesn't HELP any ;) < 1117837232 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric ::) < 1117837309 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :we need an INTERCAL article at the wiki < 1117837312 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :anyone feel like writing one? < 1117837322 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :no < 1117837325 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :can't do that < 1117837330 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :never even tried the language < 1117837641 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :INTERCAL is one of those classic esoteric programming languages everyone praises and nobody programs in, i guess < 1117837933 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :someone said recently in the GMP mailing list: 'C' gives you enough rope to hang yourself, and will even do the favor of throwing one end of the rope over the tree for you ... < 1117837949 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :heh < 1117837979 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :i made a lame stub for INTERCAL just to have something there < 1117838001 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :by the way, pgimeno, did you see the SQL backup i made available? < 1117838015 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :yes, it's here, thanks! :) < 1117838043 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :but I suspect I'm not the only one who wants to make backups < 1117838061 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :Most people look at that rope, and go "hey, that's handy!" then kill themselves. < 1117838083 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :The trick is to use the rope to devise a pully system, and then exert less effort to get your task done. < 1117838097 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :Also, stretch all metaphores far beyond any real meaning. < 1117838201 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :I just read partially the spec of INTERCAL, a few years ago < 1117838211 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :it's really funny :) < 1117838239 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :some day I want to read it fully < 1117838248 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :wasn't INTERCAL designed to be uninterpretable/compilable? < 1117838265 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :it was designed just to be different < 1117838290 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :there are interpreters and compilers, or that's what I thought < 1117838294 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :i have my spec writing setup complete... i can start writing specs fast now! < 1117838331 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :pgimeno: yes but afaik they tried to make it as hard as possible to code them < 1117838344 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :Now that's a good diea. < 1117838347 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :*idea < 1117838355 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :maybe, not sure < 1117838356 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :An esoteric language that is neither compilable nor interpretable. < 1117838360 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :I was going to try out INTERCAL today, but I can't even manage to compile the example programs :( < 1117838384 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :How about a language that acts differently depending on the author's eye color. < 1117838398 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :Since the computer can't know that, it can neither compile nor interpret it. < 1117838406 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :Though I guess it could be an input. < 1117838410 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :you would need a web cam < 1117838440 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :How about a language that acts differently depending on the author's thoughts < 1117838447 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :;) < 1117838450 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric ::D < 1117838471 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :and uses author's brain cells as memory < 1117838473 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :if the author is thinking "Sex" then it prints "Hello, world!" < 1117838478 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric ::) < 1117838492 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :and if it is think "beer" then... < 1117838502 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :thinking! < 1117838505 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :that's easy in basic: 10 PRINT "Hello, World!" 20 GOTO 10 < 1117838506 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :99 booootleeeees oof beeer on thee waaaal < 1117838577 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :some day I'll submit my Choon program < 1117838592 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :too bad the wav converter crashes < 1117838864 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :This sounds like the work of David R. Hawkins. < 1117841481 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :kipple: I've reproduced the problem; when I do an strace I get this: open("/usr/local/share/intercal-0.24/ick-wrap.c", O_RDONLY) = -1 ENOENT (No such file or directory) < 1117841684 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :there's an intercal package available for Debian, apparently (is it the first esoteric language to be in a Linux distribution?) < 1117841714 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :there is? < 1117841724 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :that's nice :) < 1117841732 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :two, actually; one in perl and the other seems to be c-intercal < 1117841743 0 :mathkid!mathkid@1Cust230.an4.det15.da.uu.net JOIN :#esoteric < 1117841744 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :my current specs (just lang design no syntax yet): http://www.harderweb.de/jix/langs/lazybrain/specs.rc.txt (redcloth text file) http://www.harderweb.de/jix/langs/lazybrain/specs.html the generated html < 1117841760 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :bbl < 1117841879 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :pgimeno: I'm pretty sure it's not the first, they've got Java. < 1117842299 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :updated my .txt => html script to output strict xhtml (the automatic content list generation is done by me... txt => html is redcloth and html cleanup is tidy) < 1117842452 0 :graue!unknown@unknown.invalid QUIT :Read error: 110 (Connection timed out) < 1117842581 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :i've done an important part of my specs and no one cares .. ;) < 1117842607 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :be patient ;) < 1117842829 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :For a basic idea of "be patient," consider that it was several weeks between my writing FYB and your picking it up ;) < 1117842868 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :GregorR: but it was 5min between i knew about FYB and my first test program ;) < 1117842942 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :Touchet ;) < 1117842946 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :With spelling 8-D < 1117842964 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :However, we cannot yet write programs in lazybrain. < 1117842993 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :hehe.. yes. but i just want some respond to my ideas.. < 1117842996 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :With spelling? < 1117843162 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :Yay! the debian intercal package works! < 1117843261 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :there is no dp intercal package < 1117843261 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :ACTION is reading the lazybrain spec < 1117843298 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :dp? < 1117843306 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :darwin ports < 1117843315 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :ah < 1117843329 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :automatic downloading+(patching if needed)+compilation of source code < 1117843353 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :there is apt-get for osx (fink) too.. but the packages are always out of date < 1117843421 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :jix: are the function's tapes local or global? < 1117843431 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :local < 1117843435 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :semi local < 1117843456 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :they are used for passing arguments.. but they aren't used for returning values < 1117843508 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :so, whatever the function does, it does not alter the main tape? (except for the return values) < 1117843517 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :yes < 1117843533 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :ok. the spec should be a bit clearer about that methinks < 1117843539 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :hmm.. < 1117843574 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :or perhaps not... on second reading it is quite clear :) < 1117843625 0 :graue!~graue@ip68-100-135-226.dc.dc.cox.net JOIN :#esoteric < 1117843696 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :changed it a bit so that it is clear on the first reading < 1117843702 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :debian has the libacme-brainfck-perl package, which seems to implement brainfuck (it allows it to be mixed with perl code according to the package description) < 1117843744 0 :mathkid!unknown@unknown.invalid PART #esoteric :? < 1117843749 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :also, a whitespace interpreter, whitespace, is there < 1117843999 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :lazy brain confuses me too much < 1117844171 0 :graue!unknown@unknown.invalid QUIT :"Leaving" < 1117844351 0 :graue!~graue@ip68-100-135-226.dc.dc.cox.net JOIN :#esoteric < 1117844830 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :graue: why? < 1117845007 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :22 commands... < 1117845088 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :23 < 1117845666 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :hm < 1117845673 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :must go < 1117845686 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :see you on 7th or 8th. :) < 1117845696 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :nite < 1117845700 0 :Keymaker!unknown@unknown.invalid PART #esoteric :? < 1117846621 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :I've abandoned xhtml in favour of html4 since these M$ patents < 1117846665 0 :graue!unknown@unknown.invalid QUIT :Read error: 110 (Connection timed out) < 1117846860 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :Sorry! The wiki is experiencing some technical difficulties, and cannot contact the database server. < 1117846860 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :Can't connect to local MySQL server through socket '/tmp/mysql.sock' (61) < 1117846926 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :which wiki? the esolang wiki works fine... < 1117846934 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :it was down for about 20 secs < 1117847604 0 :jix!unknown@unknown.invalid QUIT :"Banned from network" < 1117847696 0 :graue!~graue@ip68-100-130-21.dc.dc.cox.net JOIN :#esoteric < 1117848905 0 :wooby!~wooby@cpe-065-191-186-247.nc.res.rr.com JOIN :#esoteric < 1117848955 0 :wooby!unknown@unknown.invalid PRIVMSG #esoteric :ahoyo < 1117850420 0 :kipple!unknown@unknown.invalid QUIT :"See you later" < 1117851019 0 :graue!unknown@unknown.invalid QUIT :"Lost terminal" < 1117853582 0 :comet_11!~Sanity@dialup-151.89.221.203.acc50-kent-syd.comindico.com.au JOIN :#esoteric < 1117854969 0 :CXI!unknown@unknown.invalid QUIT :Connection timed out < 1117855581 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :This stupid commercial says that they can give you any hair color, "within the physical limitations of electromagnetic waves." < 1117855585 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :I want ultraviolet hair. < 1117855590 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :WHERE'S MY ULTRAVIOLET HAIR?! < 1117857150 0 :wooby!unknown@unknown.invalid PRIVMSG #esoteric :i'm sure it could be managed with the right chemicals < 1117857163 0 :wooby!unknown@unknown.invalid PRIVMSG #esoteric :invisible wavelength hair is an interesting concept, lol < 1117858628 0 :GregorR-L!~GregorR-L@c-24-21-138-66.hsd1.or.comcast.net JOIN :#esoteric < 1117858632 0 :GregorR-L!unknown@unknown.invalid PRIVMSG #esoteric :Gamma hair 8-D < 1117858640 0 :GregorR-L!unknown@unknown.invalid PRIVMSG #esoteric :"My hair gives me cancer" < 1117859584 0 :wooby!unknown@unknown.invalid PRIVMSG #esoteric :lol < 1117859623 0 :wooby!unknown@unknown.invalid PRIVMSG #esoteric :your hair could also give other people cancer < 1117859775 0 :GregorR-L!unknown@unknown.invalid PRIVMSG #esoteric :But would I care? No! I'd be too brain-cancery to care. < 1117859947 0 :wooby!unknown@unknown.invalid PRIVMSG #esoteric :yeah if i had elite radioactive hair i probably wouldn't care either < 1117860096 0 :GregorR-L!unknown@unknown.invalid PRIVMSG #esoteric ::P < 1117860135 0 :GregorR-L!unknown@unknown.invalid PRIVMSG #esoteric :How about radio waves? < 1117860150 0 :GregorR-L!unknown@unknown.invalid PRIVMSG #esoteric :When your hair flowed around, different static would be sent over the radio. < 1117861157 0 :wooby!unknown@unknown.invalid PRIVMSG #esoteric :it would be kind of cool to walk into a room and the TV goes bonkers < 1117861179 0 :wooby!unknown@unknown.invalid PRIVMSG #esoteric :"hey sonny, you dig my ku-band hair?" < 1117861203 0 :GregorR-L!unknown@unknown.invalid PRIVMSG #esoteric :XD < 1117861249 0 :wooby!unknown@unknown.invalid PRIVMSG #esoteric :so i desperately want to come up with my own esolang, but i'm idea-less < 1117861329 0 :GregorR-L!unknown@unknown.invalid PRIVMSG #esoteric :If I came up with an idea and gave it to you, it wouldn't be your idea. < 1117861333 0 :GregorR-L!unknown@unknown.invalid PRIVMSG #esoteric :So good luck ;) < 1117861545 0 :wooby!unknown@unknown.invalid PRIVMSG #esoteric :yeah i know! that's the kicker < 1117862095 0 :GregorR-L!unknown@unknown.invalid PRIVMSG #esoteric :If I knew anything about the communication between proteins, it would be awesome to make a programming language based on genetic code :) < 1117862175 0 :GregorR-L!unknown@unknown.invalid PRIVMSG #esoteric :"Communication" is a stretch. < 1117862222 0 :wooby!unknown@unknown.invalid PRIVMSG #esoteric :haha < 1117862267 0 :wooby!unknown@unknown.invalid PRIVMSG #esoteric :well a hack would be to implement smallfuck, using g,t,c,a as the operators < 1117862288 0 :wooby!unknown@unknown.invalid PRIVMSG #esoteric :programs would look cool, anyways < 1117862301 0 :wooby!unknown@unknown.invalid PRIVMSG #esoteric :GATTACA < 1117862326 0 :GregorR-L!unknown@unknown.invalid PRIVMSG #esoteric :Not authentic enough for me *shrugs* < 1117862343 0 :wooby!unknown@unknown.invalid PRIVMSG #esoteric :yeah me neither :\ < 1117862662 0 :wooby!unknown@unknown.invalid PRIVMSG #esoteric :well, i'm calling it a night < 1117862677 0 :wooby!unknown@unknown.invalid PRIVMSG #esoteric :have to polish off some takeout and watch some law and orders < 1117862708 0 :wooby!unknown@unknown.invalid PRIVMSG #esoteric :g'night < 1117862784 0 :GregorR-L!unknown@unknown.invalid PRIVMSG #esoteric :Buhbye < 1117865044 0 :GregorR-L!unknown@unknown.invalid PRIVMSG #esoteric :OK, now I know how to build peptide chains ... < 1117865114 0 :GregorR-L!unknown@unknown.invalid PRIVMSG #esoteric :I'm still not sure how to turn that into programming :-P < 1117865130 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :haha < 1117867827 0 :GregorR-L!unknown@unknown.invalid PRIVMSG #esoteric :The function of the peptide sequences is deterministic but mind-numbingly complex. < 1117868094 0 :comet_11!unknown@unknown.invalid QUIT :brown.freenode.net irc.freenode.net < 1117868094 0 :pgimeno!unknown@unknown.invalid QUIT :brown.freenode.net irc.freenode.net < 1117868094 0 :cpressey!unknown@unknown.invalid QUIT :brown.freenode.net irc.freenode.net < 1117868096 0 :wooby!unknown@unknown.invalid QUIT :brown.freenode.net irc.freenode.net < 1117868098 0 :lindi-!unknown@unknown.invalid QUIT :brown.freenode.net irc.freenode.net < 1117868098 0 :fizzie!unknown@unknown.invalid QUIT :brown.freenode.net irc.freenode.net < 1117868099 0 :ChanServ!unknown@unknown.invalid QUIT :brown.freenode.net irc.freenode.net < 1117868099 0 :GregorR-L!unknown@unknown.invalid QUIT :brown.freenode.net irc.freenode.net < 1117868114 0 :malaprop!unknown@unknown.invalid QUIT :brown.freenode.net irc.freenode.net < 1117868114 0 :cmeme!unknown@unknown.invalid QUIT :brown.freenode.net irc.freenode.net < 1117868114 0 :mtve!unknown@unknown.invalid QUIT :brown.freenode.net irc.freenode.net < 1117868114 0 :ZeroOne!unknown@unknown.invalid QUIT :brown.freenode.net irc.freenode.net < 1117868220 0 :ChanServ!ChanServ@services. JOIN :#esoteric < 1117868220 0 :GregorR-L!~GregorR-L@c-24-21-138-66.hsd1.or.comcast.net JOIN :#esoteric < 1117868220 0 :comet_11!~Sanity@dialup-151.89.221.203.acc50-kent-syd.comindico.com.au JOIN :#esoteric < 1117868220 0 :wooby!~wooby@cpe-065-191-186-247.nc.res.rr.com JOIN :#esoteric < 1117868220 0 :malaprop!~ph@ppp-68-251-59-237.dsl.chcgil.ameritech.net JOIN :#esoteric < 1117868220 0 :pgimeno!pgimeno@124.Red-80-59-211.pooles.rima-tde.net JOIN :#esoteric < 1117868220 0 :cpressey!nobody@d154-20-76-195.bchsia.telus.net JOIN :#esoteric < 1117868220 0 :lindi-!~lindi@81.17.193.150 JOIN :#esoteric < 1117868220 0 :fizzie!fis@sesefras.tky.hut.fi JOIN :#esoteric < 1117868220 0 :ZeroOne!~vsaalo@kekkonen.cs.hut.fi JOIN :#esoteric < 1117868220 0 :cmeme!~cmeme@216.184.11.2 JOIN :#esoteric < 1117868220 0 :mtve!mtve@mtve.vm.jvds.com JOIN :#esoteric < 1117868220 0 :irc.freenode.net!unknown@unknown.invalid MODE #esoteric :+o ChanServ < 1117868246 0 :GregorR-L!unknown@unknown.invalid PRIVMSG #esoteric :Well, I made a PHP genetic code -> peptide parser < 1117868246 0 :comet_11!unknown@unknown.invalid NICK :CXI < 1117869814 0 :Keymaker!~Not@wire74.adsl.netsonic.fi JOIN :#esoteric < 1117869819 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :hi < 1117869827 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :i just to came say "bye for a while" < 1117869832 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :Bye for a while! < 1117869845 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :see you all on 7th < 1117869852 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :keep up to good work < 1117869855 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :bye < 1117869857 0 :Keymaker!unknown@unknown.invalid QUIT :Client Quit < 1117870989 0 :graue!~graue@ip68-100-130-21.dc.dc.cox.net JOIN :#esoteric < 1117871035 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :news flash: sort language gets name, nice website, faux-academic paper! details @ http://www.oceanbase.org/graue/sortle/ < 1117871099 0 :GregorR-L!unknown@unknown.invalid PRIVMSG #esoteric :w00t < 1117871124 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :cool name < 1117871171 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :Sortle < 1117871172 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :From Esolang < 1117871172 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :(There is currently no text in this page) < 1117871172 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :awesome :D < 1117871205 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :heh, well, go ahead and make it then < 1117871233 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :I would if I knew anything about it < 1117871252 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :oh < 1117871276 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :i vaguely remember a programming language called GCAT that pretended to be genetic code < 1117871543 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :you know < 1117871553 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :a vaguely remember hearing something about a sorting language < 1117871567 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :s/^a/i < 1117871582 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :not sure if i'm hallucinating or not < 1117871629 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :there's the language Sorted!, but it doesn't seem very similar to sortle < 1117871656 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :Bubble? there's also Jeffry Johnston's Bubble, based on bubble sort < 1117871695 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :i hadn't gotten around to reading this yet, but it's described at http://lilly.csoft.net/~jeffryj/compilers/bubble/bubble.txt < 1117871893 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :yeah < 1117871894 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :that < 1117871975 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :is it fun? it doesn't seem to have been implemented < 1117871999 0 :clog!unknown@unknown.invalid QUIT :ended < 1117872000 0 :clog!unknown@unknown.invalid JOIN :#esoteric < 1117872002 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :i have no idea < 1117872162 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :why are ^ and $ separate operators? < 1117872249 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :because i didn't realize they were exactly equivalent when i wrote the spec :) < 1117872275 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :i decided to maintain both of them just to see if anyone would notice < 1117872281 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :their implementation is the exact same < 1117872326 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :i noticed, can you remove one now? :) < 1117872392 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :maybe in commercial implementations, the difference will be that the ^ operator is licensed for noncommercial use only, and you have to pay extra to get the $ operator < 1117872399 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :but seriously < 1117872417 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :i'll replace the $ operator with something better when i have an idea for another string operator that will be useful < 1117872593 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :maybe the opposite of ^? "" if either string is empty? < 1117872733 0 :GregorR-L!unknown@unknown.invalid PRIVMSG #esoteric :OK, I need brainstorming help. < 1117872752 0 :GregorR-L!unknown@unknown.invalid PRIVMSG #esoteric :After I've produced peptide sequences, how should they be parsed into functional entities? < 1117872951 0 :GregorR-L!unknown@unknown.invalid PRIVMSG #esoteric :ACTION peruses the human genome. < 1117872969 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :i'm blissfully ignorant as to what a peptide sequence represents in the first place < 1117873023 0 :GregorR-L!unknown@unknown.invalid PRIVMSG #esoteric :Amino acids are combined into peptide sequences, which in turn fold into proteins, which are the most prominant physical building blocks of life. < 1117873134 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :is this programming language supposed to be realistic? < 1117873145 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :what does a peptide sequence look like? GCAT and such? < 1117873188 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :Gregor: well you just have to work out how they fold into proteins, and then use the proteins as functional entities :P < 1117873200 0 :GregorR-L!unknown@unknown.invalid PRIVMSG #esoteric :CXI: Wow, that's easy 8-D < 1117873205 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :yeah eh? :D < 1117873214 0 :GregorR-L!unknown@unknown.invalid PRIVMSG #esoteric :graue: Chemically speaking, they're usually written something like this: SKPRVYASQDVR < 1117873228 0 :GregorR-L!unknown@unknown.invalid PRIVMSG #esoteric :That's some peptide sequence in neurons. < 1117873637 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :well, heck if i know < 1117873644 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :you're the peptide expert < 1117873674 0 :GregorR-L!unknown@unknown.invalid PRIVMSG #esoteric :No I'm not X-D < 1117874157 0 :GregorR-L!unknown@unknown.invalid PRIVMSG #esoteric :UGUCAUGUCGACGCGAGACGCGCCGUCGCACGCUUCGACUACUACUAUGCGUUCGAACUCCACCACUAA < 1117874157 0 :GregorR-L!unknown@unknown.invalid PRIVMSG #esoteric :CHVDARRAVARADYYYAAELHH < 1117874157 0 :GregorR-L!unknown@unknown.invalid PRIVMSG #esoteric :UCACGCGUUCGAGCAUCGACUACGCGUGUCGAUCGACACGUCGCAUCGAACCGCAUGAUCGAUCGAUGA < 1117874157 0 :GregorR-L!unknown@unknown.invalid PRIVMSG #esoteric :SRVRASTTRVDRHVASNRMIDR < 1117874157 0 :GregorR-L!unknown@unknown.invalid PRIVMSG #esoteric :CUCGAUCACAGUCACCGCGUCUAUUCGACCGUUCGAACGACACUCCUAUCGACGUCACCUCUCUACUAUGCUGUGCCUCGUAGCUGUACGUAG < 1117874158 0 :GregorR-L!unknown@unknown.invalid PRIVMSG #esoteric :LDHSHRVYSTVRTTLLSTSPLYYAVPRSCT < 1117874162 0 :GregorR-L!unknown@unknown.invalid PRIVMSG #esoteric :^ A melanin concentrating hormone < 1117874531 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :what's the relationship between GCAT and GCAU, again? < 1117874544 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :is it A <-> T/U, G <-> C? < 1117874898 0 :GregorR-L!unknown@unknown.invalid PRIVMSG #esoteric :T -> U < 1117874905 0 :GregorR-L!unknown@unknown.invalid PRIVMSG #esoteric :In DNA, it's T, in RNA it's U. < 1117874927 0 :GregorR-L!unknown@unknown.invalid PRIVMSG #esoteric :Oh, I just answered the wrong question, didn't I? < 1117874950 0 :GregorR-L!unknown@unknown.invalid PRIVMSG #esoteric :a-g and c-t/u I think < 1117874979 0 :GregorR-L!unknown@unknown.invalid PRIVMSG #esoteric :N/M < 1117874983 0 :GregorR-L!unknown@unknown.invalid PRIVMSG #esoteric :It's a-t/u, g-c < 1117877033 0 :GregorR-L!unknown@unknown.invalid QUIT :"Leaving" < 1117877075 0 :fizzie!unknown@unknown.invalid PRIVMSG #esoteric :There's http://www.wisdom.weizmann.ac.il/~udi/DNA5/scripps_short/sld019.htm and the slides after that. < 1117877121 0 :fizzie!unknown@unknown.invalid PRIVMSG #esoteric :Not-really-related-but-still. < 1117879091 0 :sp3tt!~chatzilla@lite-148-133.umenet.net JOIN :#esoteric < 1117879501 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :hello sp3tt < 1117880009 0 :sp3tt!unknown@unknown.invalid QUIT :Read error: 145 (Connection timed out) < 1117881209 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :moin < 1117881549 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :good moining, pgimeno < 1117881640 0 :GregorR!unknown@unknown.invalid QUIT :Read error: 110 (Connection timed out) < 1117881941 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :(np: Scrap Heap - Hiccup Jam) < 1117883080 0 :puzzlet!~puzzlet@61.247.148.38 JOIN :#esoteric < 1117883578 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :hi puzzlet < 1117883879 0 :sp3tt!~chatzilla@lite-148-133.umenet.net JOIN :#esoteric < 1117884029 0 :puzzlet!unknown@unknown.invalid PRIVMSG #esoteric :hi graue < 1117884407 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :i wish C had ||= and &&= operators < 1117884473 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :isn't |= !! enough? < 1117884490 0 :puzzlet!unknown@unknown.invalid PRIVMSG #esoteric :graue: maybe += and *= will do it < 1117884517 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :|= !! works, i guess < 1117884533 0 :puzzlet!unknown@unknown.invalid PRIVMSG #esoteric :what's "!!"? < 1117884538 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :not not < 1117884542 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :turns a value into 0 or 1 < 1117884543 0 :puzzlet!unknown@unknown.invalid PRIVMSG #esoteric :ah < 1117884566 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :the lhs should be already 0 or 1 for that to work < 1117884590 0 :puzzlet!unknown@unknown.invalid PRIVMSG #esoteric :what was i thinking, !! works for tribit or something? < 1117884620 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :how are troolean operations defined? < 1117884636 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :(if George Boole saw me write that...) < 1117884651 0 :jix!jix@p5489AE15.dip.t-dialin.net JOIN :#esoteric < 1117884655 0 :puzzlet!unknown@unknown.invalid PRIVMSG #esoteric :there is crazy operators for tribits in [[Malbolge]] < 1117884660 0 :puzzlet!unknown@unknown.invalid PRIVMSG #esoteric :operator* < 1117884661 0 :GregorR!~GregorR@c-24-21-138-66.hsd1.or.comcast.net JOIN :#esoteric < 1117884677 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :moin < 1117884687 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :moin jix, GregorR < 1117884691 0 :puzzlet!unknown@unknown.invalid PRIVMSG #esoteric :joheun achim < 1117884698 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :troolean algebra? < 1117884709 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :yeah < 1117884721 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :how does that go? true, false, or maybe? < 1117884729 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :maybe ;) < 1117884755 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :I have a strong preference towards balanced trinary though < 1117884774 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :how about analog boolean algebra; instead of false or true everything is a float from 0.0 to 1.0 < 1117884792 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :that sounds like fuzzy logic < 1117884803 0 :puzzlet!unknown@unknown.invalid PRIVMSG #esoteric :thats what i thought too < 1117884844 0 :puzzlet!unknown@unknown.invalid PRIVMSG #esoteric :how about, like GTTCAAATGGTA? < 1117884907 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :i swear i remember a "GCAT programming language" from somewhere < 1117885038 0 :puzzlet!unknown@unknown.invalid PRIVMSG #esoteric :i've seen an article about making a processor out of DNA's and RNA's < 1117885201 0 :puzzlet!unknown@unknown.invalid PRIVMSG #esoteric :maybe making retro-virii out of those biocomputers to infect human world will become possible ;) < 1117886673 0 :kipple!~kipple@163.80-202-100.nextgentel.com JOIN :#esoteric < 1117887037 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :moin kipple < 1117887042 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :hi < 1117887720 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :uhrg... some logic mistakes in my Lazy Brain design < 1117887935 0 :J|x!jix@p5489F5C2.dip.t-dialin.net JOIN :#esoteric < 1117887961 0 :jix!unknown@unknown.invalid QUIT :Nick collision from services. < 1117887969 0 :J|x!unknown@unknown.invalid NICK :jix < 1117888215 0 :GregorR!unknown@unknown.invalid QUIT :Read error: 60 (Operation timed out) < 1117888347 0 :GregorR!~GregorR@c-24-21-138-66.hsd1.or.comcast.net JOIN :#esoteric < 1117888636 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :ok.. that should work now < 1117888877 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :graue: I've read the Sortle spec. it's not clear to me how to push values onto the stack. < 1117888910 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :there are a list of operators that work on the stack, but I can't find how to acutally get any data on the stack in the first place... < 1117888920 0 :sp3tt!unknown@unknown.invalid PRIVMSG #esoteric :"Befunge and BrainF*ck are both toy languages written expressly to be perverse in some way (Befunge to be uncompilable, and BrainF*ck to be absurdly minimalist.)" < 1117888983 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :says who? < 1117889851 0 :sp3tt!unknown@unknown.invalid PRIVMSG #esoteric :Some slashdotter. < 1117889862 0 :sp3tt!unknown@unknown.invalid PRIVMSG #esoteric :http://slashdot.org/comments.pl?sid=32469&cid=3504293 < 1117890083 0 :sp3tt_!~chatzilla@cust-148-133.elhandel.umeaenergi.se JOIN :#esoteric < 1117890172 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :bah. he got a slashdot entry for a polyglot with just 4 languages?? < 1117890595 0 :sp3tt!unknown@unknown.invalid QUIT :Read error: 60 (Operation timed out) < 1117890601 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :kipple, literal numbers or strings push themselves onto the stack < 1117890610 0 :puzzlet!unknown@unknown.invalid PRIVMSG #esoteric :he sees uncompilability as absurdness? < 1117890687 0 :puzzlet!unknown@unknown.invalid PRIVMSG #esoteric :every language is compilable though < 1117890698 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :ok. so will the expression "12" push 12 or 1 and 2 onto the stack? < 1117890701 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :12 < 1117890748 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :ok. so how do you separate numbers? space? comma? semicolon? (is this missing from the spec, or am I blind?) < 1117890781 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :terms are separated by spaces < 1117890822 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :ok. you might want to make the spec a little clearer on this... < 1117890888 0 :puzzlet!unknown@unknown.invalid PRIVMSG #esoteric :where is the spec? < 1117890986 0 :smart!~sexabad@202.61.60.49 JOIN :#esoteric < 1117891013 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :http://www.oceanbase.org/graue/sortle/sortle.pdf < 1117891048 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :the format used is spelled out in "Source Code Format" < 1117891305 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :ah, yes. there it is. < 1117891512 0 :smart!unknown@unknown.invalid QUIT :Read error: 104 (Connection reset by peer) < 1117892009 0 :GregorR!unknown@unknown.invalid QUIT :Read error: 104 (Connection reset by peer) < 1117892253 0 :sexy!~sexabad@202.61.60.49 JOIN :#esoteric < 1117892284 0 :sexy!unknown@unknown.invalid QUIT :Read error: 104 (Connection reset by peer) < 1117892341 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :i have a 5lang polyglot < 1117892385 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :me too < 1117892405 0 :GregorR!~GregorR@c-24-21-138-66.hsd1.or.comcast.net JOIN :#esoteric < 1117892409 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :but I intend to add more < 1117892616 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :what languages has your poly? < 1117892635 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :BF, befunge, kipple, Ork and chef < 1117892639 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :and yours? < 1117892647 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :bash perl ruby c and BF < 1117892672 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :no malbolge? < 1117892681 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :>:) < 1117892684 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :i have also a version with kipple but it doesn't work with the online interpreter (with cipple it does) < 1117892696 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :what's the problem? < 1117892718 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :does the java interpreter ignore << ? < 1117892727 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :probably not < 1117892738 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :cipple does because in $E=<<#&>/dev/null there is no valid command < 1117892754 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :and i use heredocs to seperate ruby,perl and bash code < 1117892769 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :i assume my interpreter will give an invalid stack identifier error or something < 1117892937 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :hmm. here's a thought: If I allow < to be used as a stack name, then this expression could be used: a<b would be valid code (brainfuck/kipple polyglot would be very nice) < 1117894044 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :+ is a number? < 1117894051 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :no < 1117894053 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :no a stack < 1117894063 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :oh < 1117894067 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :and a command < 1117894069 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :it's either a stack or an operator < 1117894596 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :a friend of my brother is a friend of the false inventor < 1117894673 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :cool < 1117894766 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :hmm. should I keep stack names case insensitive, or change to case sensitive? < 1117894851 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :oh, man < 1117894858 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :I just realised a much easier way to write my regex language < 1117894889 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :I can do away with function names entirely < 1117894905 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :and just make it repeatedly reapply the regexes < 1117894966 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :kipple: i have no opinion on that at the moment < 1117894984 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :not a big deal, but it might break some old programs < 1117895050 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :sure, do it < 1117895157 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :yeah. screw backwards compatability :) < 1117895219 0 :sp3tt__!~chatzilla@lite-148-133.umenet.net JOIN :#esoteric < 1117895222 0 :sp3tt__!unknown@unknown.invalid NICK :sp3tt < 1117895240 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :real men don't need backwards compatibility < 1117895516 0 :graue_!~graue@ip68-100-135-226.dc.dc.cox.net JOIN :#esoteric < 1117896009 0 :graue!unknown@unknown.invalid QUIT :Read error: 145 (Connection timed out) < 1117896111 0 :sp3tt!unknown@unknown.invalid PRIVMSG #esoteric :http://slashdot.org/comments.pl?sid=32469&cid=3505272 rofl < 1117896285 0 :sp3tt_!unknown@unknown.invalid QUIT :Read error: 110 (Connection timed out) < 1117897291 0 :graue_!unknown@unknown.invalid QUIT :Read error: 110 (Connection timed out) < 1117897345 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :chef is awesome < 1117897566 0 :graue_!~graue@ip68-100-130-21.dc.dc.cox.net JOIN :#esoteric < 1117898727 0 :graue_!unknown@unknown.invalid NICK :graue < 1117900856 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :hmm < 1117900861 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :ACTION tries to figure out 99 bottles < 1117900882 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :which 99 bottles? < 1117900912 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :in Two Problems :P < 1117900919 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :ah < 1117900922 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :see, I'm not actually sure if it's turing complete < 1117900951 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :basically I figured I can just make it a list of regular expressions and evaluate them in order, rewinding the list if any match < 1117901240 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :ah well < 1117901244 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :I made it count from 1 to 99 < 1117901247 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :so that's something :D < 1117901255 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :but I just need to find a less braindead way of doing it < 1117901595 0 :sp3tt!unknown@unknown.invalid PRIVMSG #esoteric :Heh. My maths based language can print 99 bottles, but it's not pretty xD < 1117901609 0 :sp3tt!unknown@unknown.invalid PRIVMSG #esoteric :http://rename.noll8.nu/sp3tt/beer.math < 1117901648 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :that's not bad < 1117901689 0 :sp3tt!unknown@unknown.invalid PRIVMSG #esoteric ::) < 1117901739 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :hmm < 1117901816 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :http://members.dodo.com.au/~sgentle/99.2p < 1117901824 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :that only counts up to 99 :( < 1117901845 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :well, technically it counts down from 99 < 1117901860 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :but it adds to the front of the list < 1117901932 0 :sp3tt!unknown@unknown.invalid PRIVMSG #esoteric :At least it proves the name fits the language. < 1117901940 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric ::D < 1117901956 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :or maybe it should be called 99 problems < 1117901978 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :heh < 1117901982 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :but a bitch ain't one? < 1117902019 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :(google 99 problems if you don't get it) < 1117902049 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :ah. didn't know it was a song < 1117903959 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :i just invented and implemented a new language < 1117903963 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :brb, testing it < 1117903986 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :wow. these languages sure keep popping up lately... < 1117904202 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :haha < 1117904213 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :now you see why wikipedia is so afraid of them < 1117905672 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :i think the interpreter works, now it's time to write hello world < 1117906031 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :why does "k">@>o in kipple produce 7? < 1117906037 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :shouldn't it produce the ascii value of k? < 1117906103 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :"k">@ pushes 3 values onto @, 1, 0 and 7. @>o only pushes one value onto o, nemaly 7 < 1117906112 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :oh, ok < 1117906159 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :namely, I meant :) < 1117906367 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :"k">@ (@>o) would be the way to do that < 1117906850 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :not "k">(@>o)? < 1117906915 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :that would not work < 1117906939 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :"k">( would give an error that ( is not a stack < 1117906957 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :though I have considered allowing that < 1117907071 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :CXI: are there specs for 2p already? < 1117907204 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :heh, not really... I want to make sure it's turing complete first < 1117907252 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :have you seen Thue? it's turing-complete < 1117907423 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :hmm, interesting < 1117909020 0 :graue!unknown@unknown.invalid QUIT :"Leaving" < 1117909032 0 :graue!~graue@ip68-100-130-21.dc.dc.cox.net JOIN :#esoteric < 1117909960 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :does anyone have a description of PingPong? < 1117911345 0 :ZeroOne!unknown@unknown.invalid PRIVMSG #esoteric :pgimeno: http://web.archive.org/web/*/http://www.inz.info/pingpong/ < 1117911381 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :wee, thanks! I tried it in the past to no avail. < 1117911420 0 :ZeroOne!unknown@unknown.invalid PRIVMSG #esoteric :no problem. :) archive.org is sometimes a true jewel. < 1117911506 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :however I mean that I tried archive.org in the past but I got an error or a not found < 1117911545 0 :ZeroOne!unknown@unknown.invalid PRIVMSG #esoteric :oh, ok. maybe you tried some wrong address then? < 1117911604 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :I don't know what happened < 1117911622 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :I'm pretty sure I tried that at least twice a few weeks ago < 1117911672 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :Wikipedia redirects to the Pong game :( < 1117911709 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :I've got an idea for my genomic programming language :) < 1117911738 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :My peptide chains will stack rather than fold, and simply based on every-other amino acid being "compatible" < 1117911764 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :Certain peptide chains will be attracted to the "output" receptor, and will cause the data on them to be output. < 1117911776 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :Same with input, except a new peptide chain will be created. < 1117911790 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :I'm still working on breaking peptide chains. < 1117911864 0 :ZeroOne!unknown@unknown.invalid PRIVMSG #esoteric :right :) < 1117911880 0 :ZeroOne!unknown@unknown.invalid PRIVMSG #esoteric :good luck with that genetic manipulation then. ;) bbl. -> < 1117911930 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :Heheh < 1117912048 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :damnit, the storage available to programs in my language is dependent on code size < 1117912063 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :i'll have to change something to fix this < 1117912121 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :(it took me two hours to realize that) < 1117912191 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :graue: do you mean Sortle or the new one? < 1117912195 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :how so? can't both the expressions and the expression names be of arbitrary length? < 1117912197 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :the new one < 1117912200 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :not Sortle < 1117912206 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :ah, the new one :) < 1117912294 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :actually, if a program reads input up to EOF, it has as much storage as it wants because it can keep getting new zero bytes < 1117912299 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :but that's not very pretty < 1117912392 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :what's the opinion about having all of the languages of the List of Lesser Known Languages in the Wiki, with a category just for them? < 1117912453 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :pgimeno: about this wiki-category "Lesser known programming languages". what exactly do you consider lesser known? < 1117912462 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :well, they're jokes, right? < 1117912475 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :graue: yes < 1117912478 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :if they're significant in your opinion they could go on the joke language list < 1117912489 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :kipple: the list is an old joke posted to usenet in the 80's < 1117912496 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :of languages that didn't exist < 1117912511 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :ah < 1117912530 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :one of them, VALGOL, has since been implemented < 1117912544 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :is there such a list already created? < 1117912549 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :anyway, I think this "joke language" category has some issues < 1117912586 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :while some languages are just a joke (Bitxtreme, HQ9+), some are fully functional < 1117912601 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :l33t, for instance < 1117912624 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :is it interesting for more than humor value to you? < 1117912643 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :not really < 1117912673 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :so that's why it's a joke < 1117912687 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :HQ9+ is just as fully functional; it's been implemented < 1117912720 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :well I was talking about being actually usable. < 1117912800 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :INTERCAL (and a lot of other esolangs) isn't really interesting to me for more than humor value, either < 1117912821 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :so do you want to make a list of remarkably useable programs as opposed to a list of joke languages? < 1117912851 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :no. I want ALL languages in the main list, and several categories to classify them further < 1117912861 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :++ < 1117912865 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :kipple: I was asking to graue, sorry < 1117912876 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :ah < 1117912877 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :and I agree with kipple: arguably most esoteric languages are jokes < 1117912931 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :and where the line between jokes and interesting languages go is highly subjective < 1117912986 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :yeah I think that the wikipedia approach of adding a short explanation of the language together with the name is a good idea < 1117913006 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :I thought that that was possible with categories, hence my comment some days ago < 1117913035 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :but it turns out not to be possible, so the main list seems to be the proper place < 1117913135 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :well < 1117913153 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :i think it's reasonable to split languages into turing-complete, non-turing-complete, and unknown < 1117913175 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :that would filter out hq9+ which is not turing-complete < 1117913196 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :that's a good idea, categories for computational class < 1117913204 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :I disagree. turing-completeness isn't that important < 1117913209 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :yes it is. < 1117913213 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :i.e. ANSI C is not TC < 1117913214 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :of course, SMETANA and Befunge-93 are not Turing-complete, but still interesting < 1117913222 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :Argh! is not Turing-complete < 1117913224 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :graue: exactly < 1117913224 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :etc < 1117913227 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :okay < 1117913237 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :s/turing-completeness/anywhere close to turing :) < 1117913238 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :kipple: doesn't mean it isn't a nice category idea though < 1117913252 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :we can have as many sets of categories as we like < 1117913268 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :very true. we should have a bunch of categories < 1117913285 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :i still have no idea what makes smetana/befunge better than hq9+ computationally < 1117913291 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :indeed I've added some already (Lambda calculus paradigm) < 1117913292 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :actually befunge is turing-complete i think < 1117913296 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :not -93 < 1117913304 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :it had a limited code size < 1117913306 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :you can program with smetana/befunge. You cannot program in HQ9+ ;) < 1117913311 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :yes < 1117913322 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :turing complete != "you can program in it" < 1117913359 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :turing completeness is often overrated IMHO < 1117913390 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :well < 1117913403 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :maybe a "finite state machine with enough states to do a lot of useful things at least" category < 1117913405 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :"TC with memory restriction" is important < 1117913412 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :which is handwaving of course < 1117913424 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :but essentially means "as good as computers" < 1117913448 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :befunge and smetana can do as much computation as a computer < 1117913453 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :hq9+ can't < 1117913503 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :i still like the cat programming language: every program is a quine! < 1117913511 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :what category should that one go in? < 1117913567 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :the same as HQ9+ IMO < 1117913612 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :"TC with memory restriction" = finite state automaton = lookup table, at least in terms of computability < 1117913626 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :the really interesting thing is not just computability then < 1117913638 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :but i'm not sure what it is < 1117913649 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :i've looked in the literature and there's really nothing that i could find about it < 1117913652 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :"Useable for programming"? < 1117913656 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :hmm < 1117913658 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :sure, informally < 1117913661 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :but define that?!?! < 1117913662 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :useable/unuseable < 1117913664 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric ::) < 1117913666 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :can write 99bob in it? :D < 1117913677 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :HQ9+? < 1117913678 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :can write 'n' bottles of beer, maybe < 1117913682 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :I was just suggesting it being a Category:Useable for programming < 1117913682 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :99 is finite :) < 1117913687 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :true < 1117913699 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :i think it's spelled Usable < 1117913711 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :CXI: actually, no, you're right < 1117913713 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :or close < 1117913726 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :it's like, being able to write 99 bottles of beer, in less space than writing out the song literally < 1117913732 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :like a form of compression < 1117913736 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :heh < 1117913737 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :gzip < 1117913740 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric ::) < 1117913745 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :(don't laugh, there's a gzip quine) < 1117913769 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :that's also what the malbolge program did < 1117913772 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :well, if wang tiles are a computer then... < 1117913863 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :graue: I think both spellings are allowed < 1117913873 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :okay then < 1117913900 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :at least, in smb.conf you can use both writeable and writable ;) < 1117913943 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :my English-Spanish dict does not list "useable", so it's probably wrong < 1117913973 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :my dict: usable also: useable < 1117913981 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :don't you hate it when you make a wonderful elegant symmetrical Turing tarpit with just the right level of pain and it turns out the storage available is limited by how many nested loops you use? < 1117913984 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :yeah. dictionary.com too < 1117914000 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :ACTION throws his dict out the window < 1117914005 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :http://dict.leo.org/?useable < 1117914034 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :i hate it when that happens < 1117914043 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :never happened to me < 1117914179 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :okay: how about distinguishing between pure joke languages (HQ9+, bitxtreme etc.) and humorous, though still useful languages < 1117914182 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :graue: sounds like a push-down automaton < 1117914227 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :a category for languages clearly intended as jokes would work, i think < 1117914245 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :a category plus a little mention in the list, IMO < 1117914248 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :well, just because a language is intended as a joke, doesn't mean it can't be useful < 1117914258 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :(as in turing-complete) < 1117914268 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :agreed < 1117914272 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :or as in us[e]able ;) < 1117914278 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :not that i can think of any examples at the moment < 1117914285 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :INTERCAL < 1117914286 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :cow < 1117914293 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :ook! < 1117914293 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :well yeah, intercal < 1117914308 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :suppose the joke category is only for languages which both were clearly intended as jokes and have not attracted significant attention from others after their creation < 1117914310 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :the problem is this is that unless the author makes the entry, we're sort of left to try to read their minds < 1117914311 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :yeah, ook and the like.. i'm not even sure they deserve a mention < 1117914321 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :they aren't even jokes < 1117914334 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :it's not funny, it's sad < 1117914354 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :to clarify my preceding statement, significant attention as us[e]able languages :) < 1117914361 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :well, I thought the Hello World program in Ook! was pretty funny the first time I saw it... < 1117914383 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :i'd actually like a rating/voting system , but that's probably beyond the scope of a wiki < 1117914393 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :like: 3 people thought this was amusiing, etc < 1117914395 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :i think the fact that we're whining about Ook! on irc is enough reason to document it, but it shouldn't be on the main list < 1117914453 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :I think it could be, with an entry like this: * [[Ook!]] (joke), direct translation of [[Brainfuck]] commands < 1117914490 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :(as well as COW etc.) < 1117914550 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :it could be in a "alternate representations" category < 1117914571 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :but only ook and cow would be in it < 1117914583 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :doublefuck < 1117914588 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :the huffman encoded BF < 1117914594 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :heh, that opens a whole new can of worms: is Malbolge an alternate representation of Dis? is it the other way around? < 1117914602 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :isn't fuckfuck one of those as well? < 1117914607 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :heh < 1117914608 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :yup < 1117914620 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :so all alternate representations are alternate representations of brainfuck < 1117914627 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :heh < 1117914632 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :boolfuck < 1117914640 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :perhaps they could all be grouped in one article then. < 1117914640 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :there's a nice list on wp: http://en.wikipedia.org/wiki/Brainfuck#Languages_based_on_brainfuck < 1117914643 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :yeah < 1117914657 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :along with smalfuck and the like < 1117914681 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :that's a good idea, lament < 1117914683 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :there is a difference in "based on" and "exactly the same" though < 1117914692 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :yes < 1117914709 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :but are there any bf-based languages that really deserve any attention? :) < 1117914737 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :yes there are < 1117914755 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :smallfuck for one < 1117914764 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :erm... i'm not sure i'd call the lambda calculus a "paradigm"... < 1117914783 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :I think we should aim to include every esolang, even ook, fuckfuck, cow etc. but those could be bunched together in one article, referenced from the BF article < 1117914793 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :i agree < 1117914801 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :and if the most succinct way to describe it is "it's Brainfuck with a...", it belongs in that article < 1117914803 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :cpressey: sorry, I'm not an academic, feel free to correct it < 1117914816 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :yeah, I think that's a good approach too < 1117914841 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :pgimeno: ok (still reading the diffs from the past few days :) < 1117914896 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :so the only remaining question is whether they should be listed in the main list or not < 1117914920 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :I think they should, so that anyone looking for a particular language can find them < 1117914925 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :about this "program forms" category: what exactly should be in it? only abstract concepts like the ones there now, or also things like hello world and 99bob? < 1117914977 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :I think categories for the level of presence of a langauge would be nice < 1117914984 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :probably measured in the amount of works there are for it < 1117915015 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :spec/compiler or interpreter/sample programs etc < 1117915017 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :CXI: yeah. but where to draw the line..... < 1117915028 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :also, SNUSP looks like a bf descendant and a 2-d language, should probably be in both cats < 1117915039 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :well, you wouldn't necessarily have to draw any lines < 1117915066 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :just have category:compiler/interpreter exists or whatever < 1117915139 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :cpressey: I agree, but graue apparently disagrees. < 1117915146 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :SNUSP and LNUSP are both derived from PATH, so if any of them should be in the BF-derived category, all should probably be < 1117915208 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :graue: the SNUSP article is written by you, right? < 1117915212 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :SNUSP is the most interesting of them and in its modular version it doesn't really look anything like brainfuck code, but core snusp is indeed close < 1117915214 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :yes < 1117915225 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :well, it says: " Core SNUSP is a two-dimensional Brainfuck with a more flexible way of expressing loops" < 1117915242 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :well, most SNUSP programs are written in Modular SNUSP < 1117915242 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :and " Core SNUSP is essentially Brainfuck with a two-dimensional control flow" < 1117915286 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :CXI: how about category:implemented ? < 1117915406 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :i like category: implemented < 1117915411 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :i think < 1117915422 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :yeah, that's nice < 1117915598 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :man < 1117915605 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :the wikipedia Chef Hello World isn't well-formed < 1117915606 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :no title :D < 1117915665 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :it's becoming apparent that there should be a list of categories to categorize each language (sorry for the repetition): joke, usable, implemented... < 1117915681 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :CXI: it has a title. it's comments it lacks. < 1117915707 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :mm? it doesn't have anything above "Ingredients." though < 1117915714 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :oh, wait, we may be looking at different pages < 1117915720 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :incidentally, this made me laugh: < 1117915721 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :The following code should theoretically translate to the peptide HELLQWQRLD, (cross fingers). < 1117915721 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric : TACGTACTTAATAATGTTACCGTTGCAAATCTAATC < 1117915771 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :okay, yeah, the one on [[Chef programming language]] is okay < 1117915792 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :I was talking about [[Hello world program in esoteric languages]] < 1117915833 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :ah. I see < 1117915912 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :well, now it is correct :) < 1117915918 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric ::D < 1117915932 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :pgimeno: yes. there are a LOT of potential categories < 1117915987 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :for instance: I think we should have a "stack-based" category < 1117916026 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :stack-based meaning which languages? < 1117916040 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :but what exactly is that? only langs with only one stack, like befunge, or including languages like Chef and Kipple? < 1117916076 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :I think that including all; that makes it easier to look for a particular language which is stack based < 1117916084 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :probably < 1117916101 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :languages that use stacks as its main/only data structure < 1117916111 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :what do you call the brainfuck datastructure? tape? < 1117916117 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :I'd call it a tape, yeah < 1117916138 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :I'm going to write an attempt of a [[Categorization]] page < 1117916146 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :but there are 3 different tape types.. no ends.. one end.. 2 ends < 1117916151 0 :sp3tt!unknown@unknown.invalid PRIVMSG #esoteric :99 esoteric languages on the web, 99 esoteric languages. < 1117916178 0 :sp3tt!unknown@unknown.invalid PRIVMSG #esoteric :You look one up and code a song in it, 98 esoteric languages on the web. < 1117916185 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :drink 99 bottles of beer and write a new... < 1117916194 0 :sp3tt!unknown@unknown.invalid PRIVMSG #esoteric :XD < 1117916202 0 :sp3tt!unknown@unknown.invalid PRIVMSG #esoteric :Rather 99 cans of jolt < 1117916220 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :alternatively: stay up late, write a spec. 100 esolangs on the web. < 1117916229 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :"Hello, 99 bottles of beer on the world!" < 1117916265 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :pgimeno, make it an [[Esolang:Categorization]] page < 1117916276 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :meta stuff should be in the Esolang namespace since mediawiki likes it that way < 1117916279 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :ok < 1117916281 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :jix: I don't think it is necessary to be THAT specific with the cats < 1117916294 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :hehe.. yes.. < 1117916307 0 :sp3tt!unknown@unknown.invalid PRIVMSG #esoteric :cpressey: that needs a quine! < 1117916319 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :you missed a fourth type of tape, jix, the kind that loops around < 1117916326 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :uh < 1117916327 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :unless you count that as "no ends" < 1117916348 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :and the one that has one end end loops at the other end < 1117916352 0 :sp3tt!unknown@unknown.invalid PRIVMSG #esoteric :Sugar high... Ugh. < 1117916361 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :like fyb < 1117916366 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :yes < 1117916369 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :haha < 1117916372 0 :sp3tt!unknown@unknown.invalid PRIVMSG #esoteric :FuckYorBrane XD < 1117916375 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :how about a 99bob-based language < 1117916380 0 :sp3tt!unknown@unknown.invalid PRIVMSG #esoteric :LOL < 1117916406 0 :sp3tt!unknown@unknown.invalid PRIVMSG #esoteric :A brainfuck translation with parts of the lyrics. < 1117916440 0 :sp3tt!unknown@unknown.invalid PRIVMSG #esoteric :On the wall, go to the store all represent different operations. XD < 1117916453 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :13 letters of "Hello, world!" on the wall, 13 letters of "Hello, world!" Take one down, pass it around, 12 letters of "Hello, world!" on the wall. < 1117916455 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :CXI: yeah! it could have 99 commands. Each verse a different one < 1117916463 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric ::P < 1117916471 0 :sp3tt!unknown@unknown.invalid PRIVMSG #esoteric :lol 99 commands < 1117916491 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :so you would need four lines of code to do the equivalent of a brainfuck > < 1117916525 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :99 commands in the spec. 99 commands. < 1117916529 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :haha < 1117916687 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :write one down and pass it some arguments. 98 commands in the spec < 1117916800 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :hmm, i'm tempted to add a debugger or an assert command to this esolang of mine, but that would be cheating < 1117916857 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :heh < 1117916863 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :I want to write a language made entirely of asserts < 1117916886 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :it just brute-forces the input until it matches all your asserts and then returns it :P < 1117917138 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :graue: i have to say, sortle's pretty neat < 1117917402 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :CXI: hmm prolog? < 1117917444 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :if you write your own naive sort function in prolog it scales O(n!*n) < 1117917457 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :in the worst case < 1117917474 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :(hm, maybe "unimplemented" would be a better category than "implemented") < 1117917518 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :i need a language where i have a simple platform independent canvas i can draw to and get mouse events from < 1117917583 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :non esoteric < 1117917651 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :python! < 1117917656 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :python/tk < 1117917667 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :hmm ruby/tk.. but i don't know tk < 1117917691 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :big deal < 1117917704 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :don't know about ruby but python has a very good tk reference :) < 1117917729 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :there are ruby/tk tutorials and references < 1117917757 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :then stop complaining :) < 1117917785 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :i don't want to learn how to use tk just for a stupid canvas < 1117917975 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :http://www.esolangs.org/wiki/Esolang:Categorization <- my first attempt < 1117917983 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :cpressey, sorry for the delayed reaction but cool, i'm glad you like it < 1117918074 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :graue: np... do you suspect that it (umm) "admits computation" or not? < 1117918125 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :i like that there is no strict requirement that esolangs be TC... it provides open research questions. < 1117918130 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :aura is an interesting case < 1117918131 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :too < 1117918215 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :i suspect that it admits computation, yes, although i haven't thought of a way to show this < 1117918341 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :hm, do "lesser known programming languages" have to be a category? < 1117918361 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :well, there are quite a few and I think they deserve one < 1117918386 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :heh, everything's going to be in like ten categories < 1117918386 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :but if you have a different thought you're welcome to expose it < 1117918411 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :yeah < 1117918428 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :"turing tarpit" seems a problematic category < 1117918437 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :ultimately I'd add an "esolang" category < 1117918443 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :hard to categorize < 1117918448 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :what's a tarpit and what's not < 1117918459 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :e.g. Lazy K could be trivially made one instruction shorter < 1117918465 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :by removing i < 1117918480 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :so it dosen't have "as few instructions as possible" < 1117918496 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :lament: doesn't lazy k needs i for church integers ? < 1117918519 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :jix: i can be represented with s and k < 1117918524 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :oh < 1117918555 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :how can you be represented with s and k? ;p < 1117918568 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :lazy k? that sounds a lot like unlambda < 1117918570 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :```s`kk``s`kk < 1117918580 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :(no that's wrong) < 1117918589 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :lament: how can you... < 1117918627 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :CXI: but unlambda has unneeded commands with side effects < 1117918634 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :lazy-k is side effect free < 1117918637 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :so which came first? < 1117918645 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :combinatory logic came first ;) < 1117918656 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :pgimeno: i guess "purely functional" deserves a category < 1117918658 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :is that where s/k notation came from? < 1117918669 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :CXI: unlambda came first < 1117918671 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :lament: there's a "functional programming" cat now < 1117918675 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :I don't know much about functional programming < 1117918677 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :CXI: yes < 1117918682 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :pre-turing, iirc < 1117918687 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :which blew my mind < 1117918691 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :cpressey: yes, and also "functional paradigm" :) < 1117918703 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :change that at will < 1117918709 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :one of those must die < 1117918717 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :but there's a difference between functional and purely functional < 1117918724 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :unlambda is functional < 1117918734 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :"functional paradigm" has 0 members now, it can die < 1117918737 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :iota, jot, lazy k are purely functional < 1117918752 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :lament: not a difference worth categorizing on, imo... or if it is, call it "referentially transparent" < 1117918756 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :cpressey: sure < 1117918765 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :pgimeno: paradigm sounds better though :) < 1117918804 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :I'm not sure if Thue has a different paradigm and if it's worth being included in any if so < 1117918834 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :well, it does < 1117918851 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :there's even a name for it < 1117918860 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :string-rewriting < 1117918866 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :string-rewriting < 1117918868 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :yes < 1117918883 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :rewriting languages could be their own cat < 1117918890 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :I was tainted to include that but I was not sure as I've just said < 1117918892 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :(ignoring that any language can be described as a rewriting language :) < 1117918928 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :at some point, for categorization, you just have to go on what the author probably intended... < 1117918943 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :would malbolge go in "Unusable"? < 1117918951 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :hm < 1117918961 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :I don't think it's categorizable yet... < 1117918975 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :there should be category: unknown TC status < 1117918984 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :a very important category imo < 1117918986 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :i think ben intended "hellishly difficult" rather than purely "unusable" :) < 1117918988 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :it's usable to some extent, but it's possible that as an FSA it has too few states < 1117919030 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :lament: that's OK to me < 1117919046 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :is anyone editing the Esolang:Categorization page? < 1117919058 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :not i < 1117919088 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :can turing tarpit be a subcategory of turing-complete? < 1117919181 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :what's tarpit mean, anyway? < 1117919191 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :IIRC it's a misspelling < 1117919209 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :a pit full of tar, like LaBrea :) < 1117919210 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :I don't remember the details nor where I read about that < 1117919217 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :i don't think tarpit is a useful category for esolangs < 1117919220 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :most esolangs are small < 1117919221 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :where all the dinos got stuck... < 1117919224 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :heh < 1117919229 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :I know what an actual tarpit means < 1117919241 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :i propose to just keep turing-complete < 1117919244 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :ok :) < 1117919259 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :a turing tarpit is just "arbitrarily low # of instructions" < 1117919268 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :ah, okay < 1117919269 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :for some def'n of "instruction" < 1117919288 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :pgimeno: what do you think < 1117919314 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :I think that it's useful to hold Turing tarpits as a [sub]category < 1117919341 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :and i definitely propose we invent a word for "turing-complete with memory constraint" < 1117919344 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :and that it's listed in the categorization list < 1117919347 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :and use that as a category :) < 1117919358 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :lament: that's FSA and is there < 1117919381 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :but FSA sounds almost insulting < 1117919389 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :heh < 1117919404 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :brainfuck is listed as a turing tarpit < 1117919419 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :together with "Usable" it will be meaningful enough I think < 1117919439 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :but most brainfuck specifications make it a FSA < 1117919446 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :including the original one < 1117919455 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :FSA? < 1117919463 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :finite-state automaton < 1117919469 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :ah < 1117919519 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :it's not enough to be a FSA < 1117919528 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :it has to be "easy to extend" < 1117919554 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :brainfuck, befunge, smetana can all be trivially extended to arbitrary size < 1117919618 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :Unbound FSA? < 1117919632 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :but that's not a sufficient condition either < 1117919649 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :brainfuck without loops is a FSA, right? < 1117919679 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :even FSA's can have loops... < 1117919693 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :brainfuck without loops is, um... a tuple of integers? :) < 1117919699 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :yes, but a "turing-complete with memory constraint" language must have loops < 1117919708 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :so not all FSA qualify < 1117919727 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :(by loops i mean some way of making it not halt, at the very least) < 1117919730 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :lament: i would tend to agree, but (as i mentioned before) i can't find *anything* in the literature about it < 1117919761 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :you know your language is nowhere near TC when you can determine if a program halts with current computational resources :) < 1117919796 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :(and in befunge you can already write a program that won't ever halt or repeat state) < 1117919921 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :how about "brainfuck-complete" < 1117920012 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :"brainfuck-complete with upper memory bound 80 cells" < 1117920023 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :"brainfuck complete with arbitrary memory size" < 1117920070 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :I'm not sure that's a serious name :) < 1117920097 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :how serious does it have to be? :) < 1117920154 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :the nice thing about it < 1117920164 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :I'm somewhat puzzled... if an algorithm is required to stop, and a Turing machine is required to run an algorithm, and a SMETANA program can implement any algorithm... how come SMETANA is not Turing-complete? < 1117920169 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :is that if you say "BF-complete with upper memory bound 40" < 1117920185 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :and everybdoy will know approximately what class of problem it can solve < 1117920220 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :pgimeno: semnta can't store an infinite number states.. some algorithm require infinite states < 1117920227 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :jix: no < 1117920233 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :ok not < 1117920237 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :jix: no algorithm requires infinite steps < 1117920248 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :jix: unless it doesn't halt, in which case it doesn't matter what it requires < 1117920263 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :any halting algorithm can be implemented in smetana. < 1117920270 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :if you come up with an algorithm that requires n steps, i can come up with one that requires n+1 < 1117920271 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :but you have to know memory requirements in advance. < 1117920288 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :smetana is brainfuck complete :) < 1117920301 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :oh, that's a point, lament < 1117920305 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :btw i'm going to use ruby/tk .. seems to be very simple < 1117920340 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :pgimeno: turing machine can do more than just algorithms, it seems < 1117920351 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :turing machines can hang, algorithms can't < 1117920355 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :I think that's THE point: given an arbitrary algorithm, you can't know in advance how much memory it will take < 1117920379 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :yep < 1117920403 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :the thing with "BF-complete with upper memory bound n" is that it's the same as "FSA with upper state bound m" or "lookup table with x entries" < 1117920417 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :where x >> m >> n, i imagine < 1117920442 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :er, maybe m > x actually < 1117920442 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :nope, some FSAs can't compute certain things (e.g. Brainfuck without loops) < 1117920453 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :? < 1117920470 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :cpressey: all bf-complete with upper bound languages are FSA < 1117920473 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :they *can*, they just need more states < 1117920474 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :cpressey: but the reverse is not true < 1117920490 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :or am i wrong? < 1117920504 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :what does "bf-complete" mean? < 1117920518 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :you can compile brainfuck to this language. < 1117920528 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :and run your program with memory size n. < 1117920557 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :so you are saying that: not all FSA are languages that can have brainfuck compiled into them? < 1117920572 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :uhm, I think I'm getting cpressey's point < 1117920581 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :cpressey: i think so.. is that wrong? < 1117920584 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :you mean brainfuck with finite tape? < 1117920588 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :yes < 1117920597 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :(and finite cells) < 1117920600 0 :fizzie!unknown@unknown.invalid PRIVMSG #esoteric :I would consider "BF-complete with upper memory bound n" is more like linear-bounded automata, not a finite state automaton. < 1117920619 0 :fizzie!unknown@unknown.invalid PRIVMSG #esoteric :I mean, a FSA must always terminate (for finite input). < 1117920634 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :fizzie: hey!! < 1117920642 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :that's exactly what we were looking for < 1117920655 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :ok, so the claim is: exists F, F is an FSA that cannot be the result of translating a (finite-tape) brainfuck program to an FSA < 1117920658 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :? < 1117920665 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :FSA must not always terminate < 1117920671 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :oh,m for finite input < 1117920672 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :yes < 1117920689 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :cpressey: it's not just that < 1117920690 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :hm < 1117920709 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :cpressey: it's that your language should be capable of expressing all the FSA corresponding to all the brainfuck programs with up to that memory size < 1117920750 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :lament: i'm sorry, that still sounds like "equivalent to an FSA" to me. < 1117920759 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :anyway < 1117920762 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :what fizzie said. < 1117920765 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :http://en.wikipedia.org/wiki/Linear_bounded_automaton < 1117920795 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :by the way, i'd prefer if wiki articles did not link directly to user or talk pages < 1117920803 0 :fizzie!unknown@unknown.invalid PRIVMSG #esoteric :As far as grammars go, linear-bounded automata (turing machine with a tape length limited to the input; what I would guess brainfuck-with-n-sized-memory) can recognize all context-sensitive grammars, IIRC. Type-1 grammars in the Chomsky hierarchy. < 1117920808 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :(so it is possible to mirror just the content, if anyone should later want to do that) < 1117920816 0 :fizzie!unknown@unknown.invalid PRIVMSG #esoteric :While finite state automata only recognize type-3 languages. < 1117920821 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :LBA sounds a lot closer < 1117920834 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :cpressey: but LBA seems to be equivalent to brainfuck complete :) < 1117920846 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :but LBA is already coined as a term :) < 1117920848 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :this is strange < 1117920857 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :it would seem that LBA is a subclass of FSA < 1117920862 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :i only wish there was a ref on wp < 1117920863 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :why aren't they? < 1117920871 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :not sure < 1117920888 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :graue: should there be entries for people (instead of linking directly to user pages?) < 1117920891 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :okay anyway < 1117920892 0 :fizzie!unknown@unknown.invalid PRIVMSG #esoteric :Why would they be? The grammars they can recognize are a superset of those FSA:s can. < 1117920906 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :fizzie: they have a finite number of states. < 1117920908 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :they can (e.g._ fail to halt, you mean? < 1117920916 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :cpressey, i suppose so < 1117920928 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :anyway LBA should definitely be a category < 1117920952 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :the language i'm writing atm is a LBA < 1117920956 0 :fizzie!unknown@unknown.invalid PRIVMSG #esoteric :If you want something more distinctive than just "turing-complete/not-turing-complete", why not use the chomsky hierarchy? < 1117920960 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :and most of the stuff that's now in "Turing complete" should migrate to LBA... which is kindof sad :( < 1117920963 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :incidentally, anyone want to see the perl script I use for Two Problems? < 1117920977 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :fizzie: I like that idea < 1117920985 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :CXI: yes < 1117921012 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :you implemented it in perl.. you should call it 3 problems.. < 1117921016 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :haha < 1117921023 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :LBA still seems not quite right... size of tape = function of input size. < 1117921034 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :this is compicated by the fact that many of these languages are interactive < 1117921050 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :http://members.dodo.com.au/~sgentle/2probs.pl < 1117921059 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :well, IO is supposedly irrelevant to turing-completeness < 1117921060 0 :fizzie!unknown@unknown.invalid PRIVMSG #esoteric :Anyway, every language an FSA recognizes can easily be recognized by an LBA (so L(FSAs) is a subset of L(LBAs)), and there are languages that can't be recognized by a FSA but can with a LBA (so L(FSAs) is a _proper_ subset of L(LBAs)). < 1117921074 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :heh < 1117921084 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :I should really fix that eye-bleedingly horrible bit < 1117921088 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :irrelevant to computation, yes < 1117921092 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :but not to communication :) < 1117921097 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :cpressey: but yeah, you're right < 1117921106 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :who the heck uses computers for computations anymore? < 1117921109 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :but that can be a separate category < 1117921114 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :heh < 1117921125 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :plus if you don't output anything your program is really easy to optimise < 1117921157 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :CXI: not true < 1117921161 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :CXI: because of the halting problem < 1117921198 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :what's "input" here? < 1117921204 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :CXI: consider a program that tries to express every number as a sum of two primes < 1117921215 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :well, you could call a halting program an optimisation of a non-halting program < 1117921218 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :and then you're safe < 1117921219 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :starting with 4 and going up < 1117921230 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :when it finds one it can't express, it halts < 1117921237 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :pgimeno: syntax is 2probs.pl sourcefilename arguments < 1117921243 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :go and optimize that, you'll win the fields prize and get a million dollars < 1117921248 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :http://members.dodo.com.au/~sgentle/99.2p if you missed it before < 1117921270 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :prints numbers from 1 to 99 < 1117921284 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :CXI: sorry, I'm postponing taking a look at your prog right now (will look at it later) < 1117921298 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :and also prints an error message that I've been too lazy to fix (this isn't really production-quality) :P < 1117921298 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :but shit < 1117921302 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :input is a valid point < 1117921335 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :nah... i don't think so. < 1117921344 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :you could store all input in the body of the program :) < 1117921350 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :oh, right < 1117921355 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :and disregard IO < 1117921358 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :I thought the input question was about two problems < 1117921359 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :my bad :) < 1117921389 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :wrt to IO there're three types of languages i think? < 1117921394 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :four < 1117921399 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :no IO < 1117921402 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :output only < 1117921412 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :non-interactive IO < 1117921414 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :interactive IO < 1117921444 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :perhaps the first three could be categories < 1117921454 0 :sp3tt!unknown@unknown.invalid PRIVMSG #esoteric :A Swedish site sells custom badges... I'm thinking about ordering one with "hello world" in brainfuck XD < 1117921501 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :nah.. order "you are dumb" in bf.. if someone asks you what it means ... :D < 1117921521 0 :ZeroOne!unknown@unknown.invalid PRIVMSG #esoteric :cpressey: what's that language called Version you've added to the language list? < 1117921565 0 :ZeroOne!unknown@unknown.invalid PRIVMSG #esoteric :it's rather hard to find information about esoteric programming languages, let alone a language with that kind of name. I hope you've got its homepage address somewhere written down... < 1117921591 0 :sp3tt!unknown@unknown.invalid PRIVMSG #esoteric :jix: good idea. < 1117921620 0 :sp3tt!unknown@unknown.invalid PRIVMSG #esoteric :Need to find a program that generates brainfuck that outputs a certain string... < 1117921649 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :sp3tt: do it manually .. generate delta values for the string and use multiplication to shorten the code < 1117921674 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :okay, added IO capabilities categories < 1117921684 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :ZeroOne: http://catseye.mine.nu:8080/projects/version/doc/version.html < 1117921716 0 :sp3tt!unknown@unknown.invalid PRIVMSG #esoteric :True... < 1117921740 0 :sp3tt!unknown@unknown.invalid PRIVMSG #esoteric :I have a BF interpreter in python around here somewhere... < 1117921752 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :heh < 1117921763 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :or do what I do, be lazy and generate output in binary instead < 1117921914 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :a la http://bur.st/~comet/xmas.b < 1117921926 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :yuck, /me merges lament's changes with his own ones < 1117922016 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :NB: I preferred "cell-based" instead of "tape-based" because that way it can be applied to fungeoids et al, which in my opinion share the same idea < 1117922061 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :er < 1117922075 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :i think i just overwrote your changes again < 1117922096 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :if there were any < 1117922098 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :you can't overwrite someone's changes < 1117922108 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :oops, I'll merge again < 1117922113 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :if someone has edited since you pulled up the edit form, it just gives you an edit form again < 1117922126 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :hm < 1117922132 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :then what is pgimento 'merging'? < 1117922133 0 :sp3tt!unknown@unknown.invalid PRIVMSG #esoteric :The program should output "Your brain is fucked" XD < 1117922136 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :I just didn't submit < 1117922137 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :pgimeno < 1117922138 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :oh < 1117922141 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :anyway < 1117922150 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :i just killed the entire turing-completeness class of categories < 1117922209 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :did we decide on abolishing the Turing tarpits category or keeping it? < 1117922217 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :i moved that one over < 1117922221 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :if we keep it, it could be a subcategory of Turing-complete, which might be good < 1117922224 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :it has nothing to do with computational complexity < 1117922237 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :besides most languages in it are probably not turing-complete :) < 1117922241 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :so we are keeping it, though? < 1117922242 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :e.g. brainfuck < 1117922250 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :why have you removed the turing completeness? < 1117922251 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :well, it's the only category that actually has something in it < 1117922255 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :bf is not turing-complete? < 1117922257 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :Brainfuck is Turing-complete with unbounded memory, and it is usually specified as such < 1117922265 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :pgimeno: i replaced it with "computational class" < 1117922266 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :even if the original implementation didn't do it that way < 1117922278 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :pgimeno: turing complete/linear bounded automata/finite state automata < 1117922288 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :what we were just discussing for an hour < 1117922293 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :oh, that's a renaming then :) < 1117922297 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :ok < 1117922301 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :pretty much < 1117922312 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :but it does get rid of the amazing "usable" and "not usable" categories :) < 1117922315 0 :fizzie!unknown@unknown.invalid PRIVMSG #esoteric :There's pushdown automata between those two last ones, but I'm not sure there would be many languages in that one. < 1117922331 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :thue is a LBA of course? < 1117922348 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :err < 1117922349 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :I think it's Turing-complete < 1117922352 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :yeah < 1117922353 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :nevermind < 1117922365 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :probably TC < 1117922378 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :is this classification called "Computational class"? < 1117922382 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :or "Computational complexity" < 1117922392 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :what should the category for languages of unknown class be named < 1117922414 0 :fizzie!unknown@unknown.invalid PRIVMSG #esoteric :I was going to utter "computational complexity" at one point, but I'm not quite sure now. < 1117922464 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :I had written: * Usable for writing programs // ** [[:Category:Usable]] // ** [[:Category:Unusable]] // ** [[:Category:Usability unknown]] < 1117922477 0 :fizzie!unknown@unknown.invalid PRIVMSG #esoteric :"Computational complexity" reminds perhaps too much of time/space-complexity, which is really a different issue. < 1117922491 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :[[Category:Unknown computational class]]? < 1117922508 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :usability is different from computational class < 1117922515 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :sounds OK < 1117922519 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :and i'm not sure if it's a good category anyway < 1117922519 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :yeah, sorry < 1117922528 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :who are we to decide what's usable :) < 1117922533 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :just ask any sane person < 1117922539 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :none of the languages on the wiki are usable :) < 1117922546 0 :fizzie!unknown@unknown.invalid PRIVMSG #esoteric :I did connotation-mapping (read: googled for it) and came up with pages about P != NP, so perhaps the '-- class' is better. < 1117922556 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :unusable is HQ9+ etc. < 1117922579 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :malbolge is usability unknown < 1117922591 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :as is sortle < 1117922603 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :that's also reflected in its computational class < 1117922613 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :i.e. it's not an LBA < 1117922626 0 :fizzie!unknown@unknown.invalid PRIVMSG #esoteric :The computational class for HQ9+ would be something even more restricted than FSA, wouldn't it? < 1117922628 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :graue: how about "open research questions" or similar? < 1117922642 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :that's fine too < 1117922650 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :then you would have to specify each time < 1117922651 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :what exactly the question is < 1117922658 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :there're different research questions < 1117922661 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :fizzie: i would imagine so < 1117922673 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :lament: it's just a category < 1117922680 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :HQ9+ has infinite states :) < 1117922798 0 :fizzie!unknown@unknown.invalid PRIVMSG #esoteric :I seem to recall some pushdown-automata-like language (single stack, no other real storage), but now I've forgotten it. How is befunge classified, btw? At least '93 has that 80x25 fixed size limit... < 1117922820 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :fizzie: b93 = pda afaik < 1117922826 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :no proof < 1117922830 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :does LBA have to have arbitrarily big storage? < 1117922849 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :lba tape size is a function of input size (according to wp) < 1117922857 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :so, um < 1117922857 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :maybe < 1117922859 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :so yes < 1117922860 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :definitive maybe < 1117922860 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :okay < 1117922868 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :hrm :( < 1117922875 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :then LBA is not a very good description at all :( < 1117922891 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :no, it's not < 1117922903 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :fuck. < 1117922906 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :a brainfuck program can do something to an infinite input with only a finite tape < 1117922919 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :"do something" = turn a's into b' or whatever < 1117922926 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :yeah < 1117922933 0 :fizzie!unknown@unknown.invalid PRIVMSG #esoteric :Well, it's a good description as far as grammars recognizable by the language are considered, but it's perhaps not a very good measure for real-world things. < 1117922949 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :brainfuck-complete then? :) < 1117922974 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :heheheh BANCStar! i remember BANCStar (DIMLY...) < 1117923012 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :how do you distinguish between a language like brainfuck that can turn all a's to b's < 1117923017 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :and a language that can't do anything else? :) < 1117923061 0 :fizzie!unknown@unknown.invalid PRIVMSG #esoteric :As far as real-world uses are considered, most people want more than a "yes/no" answer from their programs, too, so Chomsky hierarchy (which is about the strings accepted by the program) probably isn't that good a category. < 1117923062 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :lament: that appears to be an open research question :) < 1117923086 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :fizzie: yeah :( < 1117923097 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :well < 1117923102 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :we have to be fair to no-IO languages < 1117923108 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :smetana, iota, jot < 1117923141 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :I've just made a few changes: moved Turing tarpits as a subcategory of Turing complete, added String-rewriting paradigm, and usability (Usable by default; otherwise [[Category:Unusable for programming]] and [[Category:Usability unknown]]) < 1117923173 0 :sp3tt!unknown@unknown.invalid PRIVMSG #esoteric :I understand why brainfuck is named brainfuck <.< < 1117923179 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :damn, boo-yah < 1117923184 0 :fizzie!unknown@unknown.invalid PRIVMSG #esoteric :You could cheat and classify as Turing-complete all languages that are "turing-complete if not a simple memory space restriction of K, the changing of which would not change the language semantics _that_ much", but that's horribly unexact. < 1117923185 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :i ought to design and implement that someday < 1117923186 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :perhaps" usable for programming" is the best classification after all < 1117923205 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :fizzie: that's what i proposed < 1117923210 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :fizzie: "brainfuck-complete" < 1117923235 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :which is actually pretty exact if you specify brainfuck cells to contain 8 bits or whatever < 1117923243 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :i still think it (somewhat uninterestingly) comes down to a compression problem < 1117923267 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :a TM with a 1000-symbol tape is a FSM, but it is a much more compact representation < 1117923298 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :now, *why* it is a more compact representation - that is an interesting question < 1117923306 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :no kidding < 1117923319 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :every programmer seems to intuitively understand why, but where's the bloody formalism? < 1117923325 0 :fizzie!unknown@unknown.invalid PRIVMSG #esoteric :It's not really a FSM. (There's the halting thing, for one -- it can do state transitions without consuming input.) < 1117923335 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :ok, "FSM that might not halt" < 1117923341 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :man < 1117923347 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :these chomsky things are completely useless < 1117923348 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :or something close < 1117923353 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :as are the original turing things < 1117923357 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :because of their notion of "input" < 1117923398 0 :sp3tt!unknown@unknown.invalid PRIVMSG #esoteric :Sigh. I can't even construct a simple loop in bf. < 1117923407 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :sp3tt: +[] < 1117923411 0 :sp3tt!unknown@unknown.invalid PRIVMSG #esoteric :>++[<----->-]<. < 1117923428 0 :sp3tt!unknown@unknown.invalid PRIVMSG #esoteric :That should decrease the current memory cell with ten, right? < 1117923429 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :link for BogusForth seems to be dead < 1117923443 0 :fizzie!unknown@unknown.invalid PRIVMSG #esoteric :Assuming the next memory cell was zero, apparently. < 1117923468 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :okay screw it, let's just keep "usable" :) < 1117923477 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :and have the category:usable itself be an "open research question" :) < 1117923479 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :BF-complete was already used by Fraans Faase, btw < 1117923490 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :well, there you go < 1117923491 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :s/Fraans/Frans/ < 1117923495 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :it's a natural way to classify things :) < 1117923528 0 :fizzie!unknown@unknown.invalid PRIVMSG #esoteric :Does brainf*ck specify any limitations to program length, btw? < 1117923534 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :but not in that sense I'm afraid < 1117923549 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :not that I know, fizzie < 1117923553 0 :ZeroOne!unknown@unknown.invalid PRIVMSG #esoteric :should we have some Template:Stub like in Wikipedia? we could use one to mark articles that only have one sentence or so. < 1117923555 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :fizzie: no < 1117923558 0 :fizzie!unknown@unknown.invalid PRIVMSG #esoteric :Befugne (93) would (probably) not be brainf*ck-complete, then. < 1117923568 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :fizzie: yes. < 1117923576 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :so that's still a crappy definition :) < 1117923593 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :"brainfuck-complete with memory and code restriction" just doesn't sound very good < 1117923596 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :ZeroOne: looks like a good idea < 1117923631 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :how about HQ9+ complete :) < 1117923662 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :well, not HQ9+, but have a list of problems that a language should be able to do < 1117923674 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :the only side effect is allowing a language that does nothing but those problems < 1117923675 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :"code restriction" opens up a whole new can of worms < 1117923706 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :but apart from that, it seems pretty good.. < 1117923709 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :i'm much happier just leaving all the contentious stuff uncategorized, btw. < 1117923725 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :it will also give people things to do < 1117923740 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :implement the "qualification" programs in all the languages :) < 1117923789 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :what are our "qualification" programs? < 1117923795 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :99 bob? < 1117923799 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric : definitely :) < 1117923818 0 :fizzie!unknown@unknown.invalid PRIVMSG #esoteric :I always write a befunge interpreter, but perhaps that's not a good idea. :p < 1117923818 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :what does it qualify the language for? < 1117923835 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :maybe "99bob-complete" < 1117923835 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :99 bob using substaction and looping < 1117923846 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :well, 99 is not a great program < 1117923851 0 :ZeroOne!unknown@unknown.invalid PRIVMSG #esoteric :pgimeno: ok, here's the template in action: http://esoteric.voxelperfect.net/wiki/Ale < 1117923854 0 :fizzie!unknown@unknown.invalid PRIVMSG #esoteric :You probably can use an "approved by esowiki" stamp on the marketing brochures after that. < 1117923856 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :for some def'n of "subtract" and "loop" i suppose :) < 1117923865 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :but still < 1117923891 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :cool, ZeroOne < 1117923892 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :a bunch of math problems... number factorization.. sorting.. < 1117923914 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :none of it is relevant mathematically speaking < 1117923945 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :but in real world terms, it means a lot when something like Chess was implemented in befunge < 1117923956 0 :fizzie!unknown@unknown.invalid PRIVMSG #esoteric :Heh, and will we specify for how large inputs do these qualification programs need to work? The befunge qsort is pretty limited, for example, since all the data must fit on the playfield. < 1117924001 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :lament: TPK may be what you're looking for < 1117924015 0 :fizzie!unknown@unknown.invalid PRIVMSG #esoteric :Your (plural you) use of the "we" pronoun is contagious. < 1117924017 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :http://www.cs.fit.edu/~ryan/compare/ < 1117924031 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :i don't think the stub template is a good idea < 1117924039 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :it makes the site look messy and unfinished < 1117924049 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :just let stubs be stubs and if someone cares they'll be expanded < 1117924056 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :fizzie: note however that you can implement the actual algorithm in befunge < 1117924071 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :or, for example, in smetana < 1117924133 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :graue: the intention is to have a more or less detailed description of each language, not just a quick overview like now, right? < 1117924165 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :and it's just that really < 1117924170 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :it's not about the size of input < 1117924171 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :yes, but that'll happen when it happens < 1117924176 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :it's about being able to write non-trivial code < 1117924178 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :making the pages look a mess isn't going to speed it along < 1117924217 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :why is there so little math in all of this :( < 1117924259 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :graue but it would be good to create the sensation that the intention is detailed descriptions, and without the stub notice it seems like they're more or less complete < 1117924287 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :i like stub template < 1117924298 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :although, it's not necessary < 1117924299 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :almost everything is a stub now < 1117924305 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :yeah < 1117924314 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :it's fairly clear that more info can be added < 1117924320 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :yeah, but it would seem as if the intention is to have just short descriptions < 1117924325 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :and if no one does, well, we live < 1117924338 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :consider the following language: < 1117924339 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :we could add a note in the list < 1117924343 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :it's "seemingly turing-complete" < 1117924348 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :it has no interactive IO < 1117924350 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :"longer descs wanted!" etc < 1117924356 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :cpressey: yes, that's another way < 1117924361 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :when a program terminates, if the state is "hello world", it gets changed to "" < 1117924375 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :Is this turing-complete? < 1117924397 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :no matter what i do i can't get it to output hello world < 1117924428 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :lament: i've come across that before (actually ben did)... it seemed like a representation problem < 1117924437 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :you can output hello world in e.g. binary ascii < 1117924467 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :i think it came up because ben thought the original wierd couldn't output ascii 0 < 1117924482 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :which it could, but it still raised an interesting question < 1117924503 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :say (eg) the alphabet of symbols you can write is a subset of those that you can read < 1117924510 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :is that turingmachine still tc? < 1117924520 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :it is < 1117924526 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :i'd think so too < 1117924527 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :because a turingmachine is always tc < 1117924534 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :(unless the subset is like the null set or something) < 1117924536 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :you only need 0 and 1 < 1117924574 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :right, which makes me wonder about judging turing tarpits based on # of symbols (they can all be encoded in e.g. unary even, if you ignore the problem of "telling where the program stops") < 1117924580 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :ok, i officially give up and advocate to use "usable"/"unusable" < 1117924613 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :heh < 1117924619 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :tarpits are just small languages < 1117924632 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :yup < 1117924634 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :actually do they have to be small? < 1117924637 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :cpressey: any file can be coded in unary < 1117924638 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :i thought the requirement was < 1117924647 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :"everything is possible, but nothing of interest is easy" < 1117924660 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :that's the derivation < 1117924665 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :hehe < 1117924673 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :the meaning is "a Turing-complete language with few symbols/instructions" < 1117924727 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :yeah, "turing tarpit" is not well defined < 1117924744 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :it can't be < 1117924763 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :there's nothing magical about tarpits vs non-tarpits < 1117924772 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :it's more like a definition by enumeration of the currently accepted TTs < 1117924796 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :yep < 1117924853 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :pgimeno: yes, the "problem" is "where does it stop?" (i'm not saying it's a "real" problem... just that it might be, depending on how you look at things) < 1117924871 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :the problem with the TC stuff is that everybody uses TC to mean "almost TC" < 1117924892 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :nod < 1117924900 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :cpressey: stop in what sense? I don't get you here; if you have a file you know where it stops, and if you have a binary number you also do < 1117924901 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :eg on the smallfuck page < 1117924905 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :"Like Brainfuck, Smallfuck is Turing-complete. Provided you have an implementation that can initialize memory cells arbitrarily before running the program and print out their content when the program ends, you can use Smallfuck to make any kind of calculation." < 1117924907 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :err s/binary/unary/ < 1117924913 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :or, there's a bald claim to TC with no proof < 1117924939 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :when smallfuck is explicitly defined to have some memory limit < 1117924941 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :TC and implementations shouldn't mix < 1117924977 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :pgimeno: how do you know how it stops without having either a) a terminator symbol (which is not the same as your unary symbol) or b) a file size (which is stored how?) < 1117925020 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :cpressey: yeah, I agree about the terminator symbol; but translation to a file is made by storing the number with a '1' prepended < 1117925055 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :i.e. a one byte file is the digit 1 plus the 8 bits of the file < 1117925056 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :pgimeno: i don't quite follow - is '1' the file size? < 1117925067 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :oh < 1117925068 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :yet i keep having a feeling there's SOME sort of math behind this :( < 1117925073 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :but can you stor *that* in unary? < 1117925077 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :lament: me too < 1117925081 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :shrug < 1117925096 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :open research :) < 1117925130 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :cpressey: you can store in unary e.g. 257 which is 100000001, meaning the file with the ASCII character < 1117925230 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :but you need a terminator char if you use unary anyway < 1117925246 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :oh, ok - if you have a max file size (which all real filesystems do,) yes, i can see that < 1117925267 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :why a max file size? < 1117925291 0 :sp3tt!unknown@unknown.invalid PRIVMSG #esoteric :Ok, Brainfuck totally rocks, pwns, and is teh shit! < 1117925292 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :that's "the EOF problem" which also rises in compression theory < 1117925466 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :pgimeno: a max file size? well... all i meant was that in practice, you don't use bignums ;) < 1117925483 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :ACTION sees an "esoFS" approaching on the horizon :) < 1117925488 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :oh ok < 1117925490 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :haha < 1117925501 0 :sp3tt!unknown@unknown.invalid PRIVMSG #esoteric :++++++++++[>+++++++++<-] >-.>++[<+++++++++++>-]<.++++++.---.>++++++++[<---------->-]<--.>++++++++[<++++++++>-]<++.>++[<++++++++>-]<.>++[<-------->-]<-.++++++++.+++++.>++++++++[<---------->-]<++.>++++++++[<+++++++++>-]<+.>++[<+++++>-]<.>++++++++[<---------->-]<---.>+++++++[<++++++++++>-]<.>+++[<+++++>-]<.>++[<--------->-]<.++++++++.------.-.>++++++++[<-------->-]<---. < 1117925503 0 :sp3tt!unknown@unknown.invalid PRIVMSG #esoteric :w00t < 1117925523 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :calamari was working in one for his shell < 1117925573 0 :sp3tt!unknown@unknown.invalid PRIVMSG #esoteric :That prints "Your brain is fucked!" < 1117925581 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :lol esoFS < 1117925594 0 :sp3tt!unknown@unknown.invalid PRIVMSG #esoteric :Esoteric filesystem? LOL < 1117925603 0 :sp3tt!unknown@unknown.invalid PRIVMSG #esoteric :Chef-FS, imagine that. < 1117926190 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :i've been thinking of writing up an Esoteric Software License for interpreters i write < 1117926209 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :viral licenses have been done, but not polymorphic viruses! < 1117926237 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :hahaha < 1117926791 0 :sp3tt!unknown@unknown.invalid PRIVMSG #esoteric :XD A badge with green text on black background. < 1117926821 0 :sp3tt!unknown@unknown.invalid PRIVMSG #esoteric :And the text is a brainfuck program that outputs "Your brain is fucked". < 1117927855 0 :sp3tt!unknown@unknown.invalid PRIVMSG #esoteric :Night all. < 1117927882 0 :sp3tt!unknown@unknown.invalid QUIT :"Chatzilla 0.9.68a [Firefox 1.0.4/20050511]" < 1117928128 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :that's a very long program. < 1117928131 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :i bet it could be shorter. < 1117928248 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :cpressey: perhaps program growth vs. problem complexity growth has something to do with it < 1117928259 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :not sure what exactly those two would mean < 1117928279 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :(it = "turing-complete-likeness") < 1117928301 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :so yeah, "compression", asymptotically < 1117929916 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :i've designed turing-complete language with only 5 instructions < 1117929932 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :do tell. < 1117929940 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :wait.. i can reduce it by one < 1117929990 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :it's name is XUML < 1117930005 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :that's a start. < 1117930028 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :it has 4 instructions: X = flip bit value < 1117930047 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :U = User interact (takes argument) < 1117930081 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :hmm wait < 1117930120 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :L = Loop (takes argument) < 1117930126 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :M = Move (takes argument) < 1117930128 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :Yay, a language starting with X. at last :D < 1117930155 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :i just noticed my syntax definition is wrong < 1117930162 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :lament: yeah, something like that... there are still a few books that looked promising at the library that i didn't check out; i'll keep looking... < 1117930387 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :i won't be at all surprised if nobody ever researched this seriously < 1117930433 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :mainstream CS seems to look at these things from a very different perspective < 1117930464 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :ignoring interactive IO and such < 1117930819 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :it seems the basic concepts CS operates with (in this regards) are not exactly the basic concepts relevant to esolangers < 1117930824 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :*regad < 1117930826 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :*regard :) < 1117931074 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :new language, hooray, fanfare etc: http://www.oceanbase.org/graue/qdeql/ < 1117931150 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :that's turing complete? < 1117931205 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :urgh i don't want to write XUML programms < 1117931219 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :(and did you forget about reenqueuing the 0 after a \ ?) < 1117931224 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :lament, i haven't proved it, but it intuitively seems so < 1117931232 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :hm? < 1117931244 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :if the byte is zero during a \ it just gets lost < 1117931245 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :is there any way to extend the queue size ? < 1117931253 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :yeah, it's dynamic < 1117931265 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :starts out empty, then you add to it < 1117931304 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :\ lets you enlarge and shrink the queue :) < 1117931311 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :what does - do on an empty queue < 1117931320 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :enqueues 255 < 1117931324 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :okay < 1117931325 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :the boolfuck code: [[+]+] is LLLXXLXX in XUML < 1117931334 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :like it says, "dequeueing produces 0 if the queue is empty," so that's how it works < 1117931361 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :which is Loop(Flip Flip Loop(Flip) Flip) < 1117931368 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :jix, i like what i'm hearing < 1117931371 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :keep up the good work < 1117931425 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :you have to double flip (XX) because you cant place a subloop at the start of the parent loop < 1117931474 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :that is insane < 1117931494 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :i didn't wanted to add control characters < 1117931520 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :well, i meant insane in a good way < 1117931525 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :hehe < 1117931673 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :UXXUUXXXUXXUUXX prints a newline < 1117931865 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :but only if it's the last outputting command < 1117932413 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :auto converted (BF=>BOOF=>XUML) programs are going to be so fucked long < 1117932603 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :> is MMLXX and < is MLX < 1117932645 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :... < 1117932907 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :I want to add a category for languages where the source is not a text file, like Piet. But what to name it? non-text based languages? doesn't sound too good in my ears... < 1117932923 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :non-ascii ? < 1117932938 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :that would exclude some text-based langs < 1117932945 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :include I mean < 1117932946 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :oh right < 1117933053 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :languages whose input is not in the form of a character stream is perhaps a bit verbose ;) < 1117933630 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :non-textual? < 1117933718 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :yeah, that's better :) < 1117933882 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :about the categories: do we really need categories for deterministic or one-dimentional? < 1117933900 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :shouldn't we just assume they are, unless otherwise categorized? < 1117933928 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :++++++++++[>++++>++++++++++>+++++++<<<-]>>>++.<+.+++++++..+++.<++++.<+++[>----<-]>.>++++++++.--------.+++.------.--------.<<+++[>++++<-]>++.<++++++++++. < 1117933936 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :is autoconverted 14kb < 1117933983 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :but it outputs the same thing as the boolfuck=>xuml ULXULXULXXULXXULXULXXULXXULXXULXXULXXULXXULXULXXULXULXXULXULXULXXULXULXXULXXULXULXXULXULXULXXULXULXXULXXULXULXXULXXULXULXULXULXXULXXULXULXXULXULXULXXULXULXXULXXULXXULXULXULXULXULXULXULXXULXXULXULXXULXULXULXXULXXULXULXULXXULXXULXULXULXULXXULXXULXULXXULXULXXULXXULXULXXULXULXULXXULXULXULXXULXULXXULXXULXULXXULXULXULXXULXXULXULXXULXULXXULXXULXXULXULXULXULXXULXXULXULXULXXULXXULXXULX < 1117934009 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :the xuml handwritten version is even shorter < 1117934069 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :oh.. made some.. mistake in the autoconverter < 1117934074 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :kipple: Deterministic should indeed be the default, but one-dimensional is already the default < 1117934122 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :note that in http://www.esolangs.org/wiki/Esolang:Categorization there's not a category, meaning it's default < 1117934124 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :ah. that's what you've meant by not adding links for things like one-dimensional and Implemented? < 1117934134 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :yes < 1117934143 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :good < 1117934174 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :imperative and deterministic may be default too < 1117934181 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :btw, i don't think 2D langs should be a subcategory og multi-D langs < 1117934186 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :i think Implemented should be a category, though < 1117934197 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :who's going to want to search for Unimplemented languages? they're no fun < 1117934203 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :and there are a lot of them < 1117934214 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :and why not, kipple? makes sense to me < 1117934223 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :somebody looking for somehting to implement perhaps? < 1117934231 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :I don't see the benefit < 1117934238 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :maybe, but Implemented are generally more interesting, i think < 1117934244 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :agreed < 1117934265 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :do you see the drawback? i don't < 1117934287 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :multi-D-but-not-2D languages are special and can be easily found by looking in the base multi-D category < 1117934291 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :what's the problem with that? < 1117934292 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :I separated 2D and Multi = (3+)D, for the record < 1117934301 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :separated how? < 1117934303 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :just adds clutter to the multi-D page < 1117934316 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :no it doesn't, it only adds one category to that page < 1117934361 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :well, it's fine with me that way < 1117934364 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :well, true. lets keep it that way then < 1117934364 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :stuffing all the 2D langs on there would add more clutter < 1117934468 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :ok. I'm changing deterministic to default (removing category) < 1117934505 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :anybody disagree? < 1117934560 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :er < 1117934564 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :I was editing < 1117934585 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :ok. let me know when you're done then < 1117934682 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :done < 1117934796 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :btw, why is there an extra colon in the categories on that page? ( [[:Category:Nondeterministic]]) < 1117934822 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :because otherwise that page would also be added to the category < 1117935596 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :hmm, what counts as Implemented? < 1117935613 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :at least an implementation exists < 1117935615 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :what if only some features work, or the newest version of the spec isn't implemented, or the implementation is really buggy? < 1117935645 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :like, suppose the only Brainfuck interpreter supported +-<>., and [] support was "coming soon", implemented or no? < 1117935656 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :that's worth some notes in the text < 1117935672 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :I'd say implemented < 1117935689 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :me too, plus explain the situation in the text < 1117935693 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :fuzzy logic! < 1117935695 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :yes < 1117935936 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :do we need both Usability unknown and Unknown computational class? < 1117935962 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :well, Malbolge is Usability unknown and Finite state automata < 1117936035 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :hey! bitxtreme is a non-textual language, right? < 1117936061 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :isn't the source code binary? < 1117936088 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :true < 1117936132 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :well, now that category has at two languages! :D < 1117936140 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :Choon belongs there < 1117936147 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :oh wait, no it doesn't < 1117936153 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :source code only, right? < 1117936162 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :yeah < 1117936201 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :though it is a bit special < 1117936271 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :actually it's ascii < 1117936287 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :er, iso8859-1 < 1117936290 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :I know. I was talking about the output < 1117936325 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :I'm talking about bitxtreme < 1117936327 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :there's no zero-dimensional category for NULL to go in? < 1117936348 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :I didn't think one single language would qualify for a category < 1117936370 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :I do! < 1117936380 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :then go ahead :) < 1117936413 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :hmm. so bitxtreme is text based after all? darn < 1117936445 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :someone needs to make a new zero-dimensional language somehow, i guess < 1117936449 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :How should we categorize language level? is low / high enough? < 1117936454 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :but it's not like such a thing is possible < 1117936464 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :Homespring and ZOMBIE would be "very high" < 1117936533 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :a scale then: turing tarpit - low - medium - high - high as a kite ;) < 1117936561 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :hm < 1117936575 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :well, i'm going to sleep, you have fun categorizing articles < 1117936586 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :and maybe you can add Qdeql to the wiki if you feel like it < 1117936590 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :good night < 1117936593 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :nite < 1117936594 0 :graue!unknown@unknown.invalid QUIT :"Leaving" < 1117936672 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :I'm not for categorizing language level < 1117936679 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :why not? < 1117936712 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :hm, on second thought maybe it helps looking for "powerful" languages < 1117936757 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :I think high/low should be enough < 1117936763 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :oh, var'aQ is not still there < 1117936774 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :or was it var'aq ? < 1117936790 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :ACTION adds a stub < 1117936813 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :I also think we should have a category for strongly metaphored languages (Chef, Shakespeare, ZOMBIE) < 1117936826 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :ugh < 1117936840 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :ZOMBIE looks pretty regular in my opinion < 1117936850 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :but yes, there are a few more < 1117936853 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :ok, perhaps not ZOMBIE < 1117936869 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :or maybe it should be called Themed languages < 1117936879 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :bf2xuml conversion is so baaad < 1117936892 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :boolfuck2xuml is ok < 1117936912 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :bad as in slow, or bad as in does not work? < 1117936930 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :bad as in output is very long < 1117936968 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :[-] auto-converted is a 500 byte XUML code < 1117936988 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :yuck < 1117936995 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :you need an optimizing compiler < 1117937008 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :yes < 1117937026 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :but the bad part is the bf2boolfuck < 1117937074 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :[-] is in boolfuck (not autoconverted) [+]>[+]>[+]>[+]>[+]>[+]>[+]>[+]> and autoconft to XUML LXMLXLXMLXLXMLXLXMLXLXMLXLXMLXLXMLXLXMLX < 1117937826 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :g'nite < 1117937998 0 :jix!unknown@unknown.invalid QUIT :"Banned from network" < 1117938338 0 :kipple!unknown@unknown.invalid QUIT :Read error: 60 (Operation timed out) < 1117958399 0 :clog!unknown@unknown.invalid QUIT :ended < 1117958400 0 :clog!unknown@unknown.invalid JOIN :#esoteric < 1117963244 0 :kipple!~kipple@163.80-202-100.nextgentel.com JOIN :#esoteric < 1117966104 0 :puzzlet!unknown@unknown.invalid QUIT :Read error: 104 (Connection reset by peer) < 1117967259 0 :puzzlet!~puzzlet@61.247.148.38 JOIN :#esoteric < 1117967393 0 :puzzlet!unknown@unknown.invalid QUIT :Client Quit < 1117967397 0 :puzzlet!~puzzlet@61.247.148.38 JOIN :#esoteric < 1117967463 0 :puzzlet!unknown@unknown.invalid QUIT :Client Quit < 1117967466 0 :puzzlet!~puzzlet@61.247.148.38 JOIN :#esoteric < 1117967577 0 :CXI!unknown@unknown.invalid QUIT :"If you're reading this, it's probably x-chat's fault." < 1117967821 0 :puzzlet!unknown@unknown.invalid PRIVMSG #esoteric :what client CXI was using? < 1117967874 0 :CXI!Sanity@dialup-210.88.221.203.acc50-kent-syd.comindico.com.au JOIN :#esoteric < 1117967970 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :Xchat on WinDOS. < 1117968535 0 :sp3tt!~chatzilla@lite-148-133.umenet.net JOIN :#esoteric < 1117969270 0 :sp3tt_!~chatzilla@cust-148-133.elhandel.umeaenergi.se JOIN :#esoteric < 1117969782 0 :sp3tt!unknown@unknown.invalid QUIT :Read error: 60 (Operation timed out) < 1117970986 0 :jix!jix@p5489F5C2.dip.t-dialin.net JOIN :#esoteric < 1117971266 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :moin < 1117972710 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :XUML parser done < 1117974838 0 :sp3tt_!unknown@unknown.invalid PRIVMSG #esoteric :XUML? < 1117974847 0 :J|x!jix@p5489AC5E.dip.t-dialin.net JOIN :#esoteric < 1117974861 0 :jix!unknown@unknown.invalid QUIT :Nick collision from services. < 1117974885 0 :J|x!unknown@unknown.invalid NICK :jix < 1117974932 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :XUML interptreter done.. < 1117975121 0 :sp3tt_!unknown@unknown.invalid PRIVMSG #esoteric :What is XUML? < 1117975203 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :my tc language with only 4 instructions < 1117975208 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :X U M and L < 1117975248 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :and no other syntax elements (no () no [] no white-spaces no {}...) < 1117975424 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :moin < 1117979071 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :ACTION pages GregorR < 1117979453 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :wow autoconverted bf => XUML hello world is 12 kb < 1117979750 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :XLLLLMXXULXMMLXX is the first handwritten XUML program < 1117979764 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :an endless loop printing U:s < 1117979833 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :U = 01010101b < 1117979866 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :hehe < 1117979911 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :but xuml is little endian (because i want boolfuck => xuml conversion) so i need to start with a 1 < 1117979913 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :handling bits one by one is awkward < 1117979930 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :but i don't need + and - just X < 1117979992 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :I'm only justifying the 12 Kb < 1117980211 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :not autoconverted it is much shorter < 1117980430 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :XLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLMXULXULXULXXUXUXXULXXUXXULXXUXXULXXUXXULXXUXXULXXUXXULXXUXXULXXUXUXXULXULXXUXXULXULXULXXUXUXXULXULXXUXXULXULXXUXXULXXUXXULXULXULXULXMMLXX < 1117980439 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :prints XUML\nXUML\nXUML\n.... < 1117980572 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :i'm in france next week. no internet.. no #esoteric :'( ;) < 1117980628 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :cu < 1117980631 0 :jix!unknown@unknown.invalid QUIT :"Banned from network" < 1117982088 0 :graue!~piecrust@ip68-100-130-21.dc.dc.cox.net JOIN :#esoteric < 1117982181 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :hi graue < 1117982273 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :any clue of what kind of storage does [] use? < 1117982838 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :I mean [] a.k.a. Brackets < 1117983428 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :doesn't it say on the website? < 1117983553 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :it's too brief < 1117983762 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :does it have an interpreter or spec or anything? < 1117983820 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :yes < 1117983829 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :then that should tell you < 1117983830 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :interpreter < 1117983833 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :no spec < 1117983833 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :someone needs to add clunk: http://esoteric.sange.fi/essie2/download/clunk/ < 1117984280 0 :wooby!unknown@unknown.invalid PRIVMSG #esoteric :interesting < 1117984284 0 :wooby!unknown@unknown.invalid PRIVMSG #esoteric :reminds me of shrdlu < 1117984835 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :blagh, need to actually write this newsreader < 1117985006 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :woo, dodgy html parsing is a winner < 1117985311 0 :sp3tt_!unknown@unknown.invalid PRIVMSG #esoteric :Newsreader written in what? Brainfuck? < 1117985353 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :haha < 1117985358 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :worse, VB < 1117985553 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :graue: how do you rename a page? does it have to be deleted and the new one created? < 1117986009 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :http://esolangs.org/wiki/Special:Movepage < 1117986085 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :thanks < 1117986148 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :hum, then what? < 1117986206 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :"You have not specified a target page or user to perform this function on." < 1117986228 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :hmm < 1117986233 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :&target=pagename < 1117986297 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :it's a little silly - in theory there should be a link somewhere in the interface to do that < 1117986325 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :found it < 1117986354 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :it was not worth creating a redirection etc. < 1117986378 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :but now I don't know how to delete a page < 1117986568 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :you have to be an admin first < 1117986612 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :I'll leave that up to graue then (page: [[Category:Language]]) < 1117986685 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :CXI: you may be interested in this sed adder: http://www.formauri.es/personal/pgimeno/temp/addsed-r.txt < 1117986738 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :does your language work by replacing strings via regexps? < 1117986844 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :basically, yeah < 1117986899 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :nice, then it should be straightforward to adapt the adder to your language < 1117986935 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :well, it depends... :D < 1117986961 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :see, it actually stores the regexes in a list, goes through the list and rewinds every time it makes a replacement < 1117987006 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :oops, gtg, ttyl < 1117987012 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :alrighty, seeya < 1117990093 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :re < 1117990152 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :ACTION waves < 1117990155 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :does your lang admit \1, \2 etc.? < 1117990170 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :yeah... though it uses $1 $2 instead at the moment < 1117990177 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :I'll change it when I get around to cleaning up the code < 1117990185 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :k < 1117990223 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :right now I'm bashing away at this newsreader < 1117990303 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :when you say it rewinds, do you mean that it starts by the first RE of the list after each replacement? < 1117990313 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :yeah < 1117990352 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :think of it like a functional language with only one function :P < 1117990357 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :I don't think that's important then (for my adder) < 1117990433 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :what's the string's initial state? < 1117990444 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :is it user-given? < 1117990450 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :yeah < 1117990478 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :though incidentally you'd get stuck in a loop between s/2/11/ and s/11/2/ < 1117990501 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :what's the stop condition? < 1117990513 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :no patterns match :P < 1117990529 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :did I mention there's no /g flag? :P < 1117990538 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :yuck :) < 1117990578 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :still, it's easy to fix to adapt to these needs < 1117991087 0 :sp3tt_!unknown@unknown.invalid PRIVMSG #esoteric :G does what? < 1117991158 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :in a "s/regexp/replacement/g" sed statement, it replaces all occurences (as opposed to the first one when scanned from left to right) < 1117991233 0 :sp3tt_!unknown@unknown.invalid PRIVMSG #esoteric :Ah. < 1117991245 0 :sp3tt_!unknown@unknown.invalid PRIVMSG #esoteric :I want to read the 2P specs. < 1117991285 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :alright, I'll write one up quick-like < 1117991400 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :I was sorta putting it off because I wanted to know whether it could actually be useful < 1117991411 0 :sp3tt_!unknown@unknown.invalid PRIVMSG #esoteric :Thanks. < 1117991485 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :though keep in mind the interpreter won't actually match the spec until I fix it :P < 1117991582 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :useful as in "turing complete" or useful as in "easy to use"? I can tell you in advance that it's TC < 1117991593 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :ah, well then that's cool < 1117991596 0 :sp3tt_!unknown@unknown.invalid QUIT :Read error: 104 (Connection reset by peer) < 1117991597 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :easy to use, hell no :P < 1117991609 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :hehe < 1117991664 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :you'd better specify which REs are admitted < 1117991676 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :if possible, don't restrict them to be Perl REs, please < 1117991684 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :I won't < 1117991708 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :*phew* < 1117991716 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :I'm thinking maybe gnu regex < 1117991728 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :is perl regex that different? < 1117991735 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :Posix REs would be good < 1117991750 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :POSIX EREs that is < 1117991761 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :well, there are quite a few extensions < 1117991787 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :the problem is supporting them in non-Perl interpreters < 1117991991 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :hmm < 1117992088 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :what are \1 \2 \3 called anyway? back-replacements? < 1117992157 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :back references IIRC < 1117992180 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :but only when used within a RE < 1117992184 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :yeah < 1117992200 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :i.e. not in the RHS < 1117992204 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :ah... < 1117992221 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :maybe sed has another name < 1117992235 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :eh, I'll just define them in the spec as back-references :P < 1117992329 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :"The replacement may contain the special character & to refer to that portion of the patter space which matched, and the special escapes \1 through \9 to refer to the corresponding matching sub-expressions in the regexp." (from the sed man page) < 1117992540 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :s/patter/pattern/ < 1117992578 0 :ChanServ!unknown@unknown.invalid QUIT :Shutting Down < 1117992697 0 :ChanServ!ChanServ@services. JOIN :#esoteric < 1117992697 0 :irc.freenode.net!unknown@unknown.invalid MODE #esoteric :+o ChanServ < 1117993362 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :heh, actually < 1117993372 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :it might not be possible to write a fair few things in it < 1117993384 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :if only because there's no way to distinguish what the user initially entered and what you're returning < 1117993415 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :as in, writing something to add the letter s to any inputted string < 1117993449 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :and /(.*)/(.*)s/ would just loop forever < 1117993452 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :er < 1117993462 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :I mean /(.*)/\1s/ < 1117993484 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :ACTION considers making the interpreter add '>' to the front of the input < 1117993797 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :hmm, but then you could never have a program that outputs a > < 1117993805 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :at the start of the output, anyway < 1117993888 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :you can escape the input string somehow at the start < 1117993973 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :e.g. s/\\/\\\\/g then s/^/\\i/ < 1117994154 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :but the problem is if the program was meant to output a string with \i at the start < 1117994213 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :then that'd be matched by the expression you used to check for ^\i and the program would loop infinitely < 1117994216 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :unescape it at the end; the regexps should then write \\i at the start instead of \i < 1117994244 0 :sp3tt!~chatzilla@lite-148-133.umenet.net JOIN :#esoteric < 1117994256 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :ah... hmm, yeah, that works < 1117994271 0 :sp3tt!unknown@unknown.invalid PRIVMSG #esoteric :w00t, badge with brainfuck program on ordered :D < 1117994354 0 :sp3tt!unknown@unknown.invalid PRIVMSG #esoteric :And also badges with a gnu, one that says "Proud filesharer", and of course one that says "How about a nice cup of stfu?". XD < 1117994368 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :heh, classy < 1117994373 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :what's the brainfuck program? < 1117994389 0 :sp3tt!unknown@unknown.invalid PRIVMSG #esoteric :It prints "Your brain is fucked!" < 1117994400 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :that sounds like it'd be pretty long < 1117994440 0 :sp3tt!unknown@unknown.invalid PRIVMSG #esoteric :Not with some clever multiplication... < 1117994442 0 :sp3tt!unknown@unknown.invalid PRIVMSG #esoteric :++++++++++[>+++++++++<-]>-.>++[<+++++++++++>-]<.++++++.---.>++++++++[<---------->-]<--.>++++++++[<++++++++>-]<++.>++[<++++++++>-]<.>++[<-------->-]<-.++++++++.+++++.>++++++++[<---------->-]<++.>++++++++[<+++++++++>-]<+.>++[<+++++>-]<.>++++++++[<---------->-]<---.>+++++++[<++++++++++>-]<.>+++[<+++++>-]<.>++[<--------->-]<.++++++++.------.-.>++++++++[<-------->-]<---. < 1117994457 0 :sp3tt!unknown@unknown.invalid PRIVMSG #esoteric :Looks like this: http://www.knapp.nu/ShowBadge.aspx?id=2549463 < 1117994492 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :yeah, not so bad, I guess < 1117994524 0 :sp3tt!unknown@unknown.invalid PRIVMSG #esoteric :Should be here within 14 days :) < 1117994541 0 :sp3tt!unknown@unknown.invalid PRIVMSG #esoteric :Ordered one with the firefox logo on too. < 1117995139 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :how about writing that in qdeql? < 1117995179 0 :graue!unknown@unknown.invalid QUIT :"brb" < 1117995435 0 :sp3tt!unknown@unknown.invalid PRIVMSG #esoteric :qdegl? < 1117995986 0 :graue!~graue@ip68-100-130-21.dc.dc.cox.net JOIN :#esoteric < 1117996079 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :puzzlet: around? < 1117996090 0 :puzzlet!unknown@unknown.invalid PRIVMSG #esoteric :behind you < 1117996109 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :heh < 1117996155 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :just a note that in http://puzzlet.org/puzzlet/%EC%95%84%ED%9D%AC~Aheui in the links section there's a link redirecting to an "obsolete" page < 1117996169 0 :puzzlet!unknown@unknown.invalid PRIVMSG #esoteric :ah, i forgot < 1117996185 0 :puzzlet!unknown@unknown.invalid PRIVMSG #esoteric :even forgot to update those in Korean pages < 1117996270 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :ACTION wonders what each button will do in the JS interpreter < 1117996315 0 :puzzlet!unknown@unknown.invalid PRIVMSG #esoteric :ACTION plans to make an extra frontend in English < 1117996361 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :that would be very nice for non-korean speaking people :) < 1117996479 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :to me it could say "press here to download and install Windows" without me noticing < 1117996548 0 :puzzlet!unknown@unknown.invalid PRIVMSG #esoteric :which one? < 1117996559 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :any of the buttons < 1117996802 0 :puzzlet!unknown@unknown.invalid PRIVMSG #esoteric :ah now i get it < 1117996902 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :ACTION fears the wiki has gone category-crazy :) < 1117996924 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :what's the difference between {{Category:whatever}} and [[Category:whatever]] ? < 1117996930 0 :puzzlet!unknown@unknown.invalid PRIVMSG #esoteric :the wiki goes wikipediastic < 1117996973 0 :puzzlet!unknown@unknown.invalid PRIVMSG #esoteric :i'm not sure that {{Category:whatever}} is a valid syntax < 1117996976 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :{{}} is a template < 1117996979 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :[[]] is a link < 1117996984 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :oh, ok < 1117996987 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :thanks < 1117996987 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :so {{}} brings in the text from another article < 1117996992 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :np < 1117996998 0 :puzzlet!unknown@unknown.invalid PRIVMSG #esoteric :ah, it will work that way < 1117997157 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :yeah, i think a lot of the categories are really bad ideas < 1117997191 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :in particular, low-level and high-level (how do you define that with respect to so many different programming styles?), and almost all of the other categories should be subcategories of "languages" < 1117997264 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :how does a subcategory help with respect to a category? < 1117997279 0 :puzzlet!unknown@unknown.invalid PRIVMSG #esoteric :any there's going to need something like [[Category:Languages by storage types]] and so on < 1117997287 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :it means we don't have to put [[category:languages]] on practically every single page < 1117997318 0 :puzzlet!unknown@unknown.invalid PRIVMSG #esoteric :graue: because the list will do the complete list of languages < 1117997332 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :wp has "article which should be a category" category... that way a topic can start life as an article, then eventually become a category when it's clear that it needs to be... maybe that model would work better than trying to categorize everything immediately < 1117997364 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :that's a good idea < 1117997479 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :I think that categories are a good way of getting an idea of what a language is like to start with < 1117997537 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :is it imperative? is it non-deterministic? etc. < 1117997594 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :of course that could belong to the description but using categories helps in making a cross-reference list at the same time < 1117997710 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :about the inclusion of most or all categories as subcategories of the Languages one, I don't know how to list e.g. all languages that way < 1117997831 0 :CXI!unknown@unknown.invalid NICK :coredumpage < 1117997852 0 :coredumpage!unknown@unknown.invalid NICK :CXI < 1117998122 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :for example, currently Turing tarpits is a subcategory of Turing complete, but you can't examine a list of all Turing-complete languages that includes Turing tarpits without entering each subcategory < 1117998159 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :is there a way around that? < 1117998204 0 :puzzlet!unknown@unknown.invalid PRIVMSG #esoteric :[[List of Turing tarpits]]? < 1117998255 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :that would require manual editing of just another list < 1117998328 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :adding a language to a subcategory does not automatically add it to its parent category < 1117998664 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :so you can't examine a list of all Turing-complete languages that includes Turing tarpits without entering the subcategory < 1117998671 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :is it that hard to enter a subcategory? < 1117998690 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :that's not the problem < 1117998739 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :if all the current categories are subcategories of the Languages category, you can't have a list of Languages without entering every category < 1117998752 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :yes you can, by going to esolangs.org/wiki/Language_list < 1117998807 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :what's the use of that page which can't be done with a Languages category? < 1117998834 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :it doesn't require global modifications < 1117998843 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :for a category, you have to edit every page in the category < 1117998909 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :so what's a good non-esoteric high-level language i should learn? objective-c? java? ruby? erlang? < 1117999039 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :er... define "good" < 1117999087 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :you don't think any of those are good? < 1117999139 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :"good for what" is the question < 1117999156 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :java is quite more popular than the rest < 1117999184 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :but I don't know if popularity is meaningful for you < 1117999249 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :well, good for programming in < 1117999265 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :i don't care if it's buzzword-compliant or not, if that's what you mean < 1117999305 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :i don't want to do BOP in a strongly-hyped language < 1117999390 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :good speed-wise, ease-wise, self-explanatory-wise...? do you require it to be scriptable? have good string handling? etc. < 1117999520 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :what languages do you prefer? < 1117999523 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :graue: depends why you want to learn it (sort of like pgimeno said)... i can only say which non-eso languages i personally admire < 1117999526 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :erlang and lua < 1117999592 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :what's cool about erlang? < 1117999602 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :I quite like ruby < 1117999614 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :receiving messages based on patterns < 1117999629 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :at least, imo < 1117999654 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :is it (can it be) relatively fast? (not necessarily C-speed, but usable for some real-time stuff) < 1117999675 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :graue: it's billed as a "soft real-time" language (fwiw) < 1117999724 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :speed is, hmm, ok, in my experience... certainly acceptable for the things i use it for < 1117999733 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :it doesn't do so well on most shootouts though < 1117999742 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :although i'm not sure how much i trust the shootouts anyway < 1117999763 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :have you ever used Icon? < 1117999798 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :briefly. not for anything serious. i decided to go with lua instead, which has some similar features < 1117999828 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :icon was way ahead of its time... < 1117999936 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :i guess i'll study erlang in some more depth < 1117999964 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :*pitches in* give ruby a look too :P < 1117999998 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :what is the downside of ruby? < 1118000006 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :speed < 1118000014 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :it's so popular there must be a group of people who hate it < 1118000032 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :i'd like to hear from those people before spending much time on ruby, but it is interesting < 1118000054 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :heh, I'm not sure how easy it'd be to find any of those people < 1118000054 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :i'm not so big a fan of ruby, but i don't have any particular thing against it < 1118000086 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :I'm pretty quick to condemn a language, but I haven't been able to find much wrong with ruby at all < 1118000093 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :the syntax was a little strange at first < 1118000223 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :oh, erlang can load code into running systems, that's cool < 1118000881 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :graue: btw i suspect qdeql needs 2 queues < 1118000885 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :for TC < 1118000912 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :you have the problem (i think) of the length of the queue being unknown at any given point < 1118000944 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :so how do you (e.g.) know you've cycled through the entire thing if you e.g. want to get at a cell in the very middle < 1118000951 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :that's just a guess though < 1118001748 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :isn't that equivalent to the problem of the position of the tape pointer in brainfuck? < 1118001915 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :it seems to me that it should be possible to keep track of the length of the queue in a byte (or two, or three, or an unbounded number of bytes) that is kept accessible at all times < 1118002718 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :hmmm < 1118002757 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :i'm just not sure how you keep it accessible at all times < 1118002774 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :the tape in bf doesn't wrap around; you don't need to know the current length of it to navigate it < 1118002779 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :it seems like in a queue, you would < 1118002791 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :maybe if it was a deque < 1118002820 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :(then you could go "left" and "right" like in bf or a TM) < 1118003108 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :oh < 1118003109 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :hmm < 1118003111 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :my initial idea was a deque, someone in here said it could be done with just a queue < 1118003124 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :you might be right < 1118003316 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :maybe if you could test or subtract from the byte at the front of the queue without displacing it, something like that might make the difference? < 1118003321 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :it would certainly be easier to use < 1118003635 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :just write an UTM in it and you'll be sure it's TC :) (sorry, I was afk) < 1118003720 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :about the languages, I faced a similar decision some weeks ago and I decided to learn Python (not in your list though) < 1118003736 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :well, a seperate counter would clearly work, but is almost cheating (a FSA + 2 counters = TC, apparently) < 1118004019 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :cpressey: is there an specification of SQUISHY? < 1118004045 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :pgimeno: heh. um... the original? no. Squishy2K? yes, somewhere... < 1118004080 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :http://catseye.mine.nu:8080/projects/squishy2k/doc/squishy2k.txt < 1118004097 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :yeah, I was reading about Squishy2k < 1118004145 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :the original was more like thue-using-EBNF < 1118004150 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :but it was only an idea < 1118004160 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :I was wondering if it's worth creating a SQUISHY entry in the wiki, as the predecessor of Thue < 1118004195 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :i don't think so... it really wasn't that significiant < 1118004357 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :was Thue based on SQUISHY? < 1118004472 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :hey pgimeno, i tried to learn python before but i really found it confusing and counterintuitive < 1118004511 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :it seemed unclear what was or wasn't by reference, "deep copies" and "shallow copies" left my brain all fucked, so i stopped working on it < 1118004589 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :also, it seemed that there were exceptions for things that should be "compile-time" errors (e.g., the inconsistent indentation exception) so i was afraid i'd have to spend a lot of time fighting off silly exceptions, rather than solving the problem at hand < 1118004713 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :I haven't faced deep vs shallow, but for the indentation problem I guess it's a "well-formedness" checking feature but it's detected at "compile time" i.e. when the script is loaded and parsed into tokens < 1118005009 0 :sp3tt!unknown@unknown.invalid PRIVMSG #esoteric :graue: you mean python fucked up your brain less that bf? < 1118005015 0 :sp3tt!unknown@unknown.invalid PRIVMSG #esoteric :o.0 How's that possible? < 1118005023 0 :sp3tt!unknown@unknown.invalid PRIVMSG #esoteric :More than bf* < 1118005681 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :there isn't a comparison there < 1118005769 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :as a language bf is very simple and easy to learn; i'm familiar with exactly how every one of its features works < 1118005801 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :in python, and this is a problem i've had trying to learn other high-level languages, the language is doing crazy stuff behind my back that i don't understand < 1118005823 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :pgimeno: no, thue was based on, ummm, a [semi-]thue grammar :) < 1118005840 0 :wooby!unknown@unknown.invalid QUIT : < 1118005967 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :graue: yeah, you have a point there; but still, for quick'n'easy scripts (rather than big projects) I find it useful < 1118006034 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :cpressey: I asked because it's listed as the successor of SQUISHY in several places < 1118006180 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :hmm, i usually do quick'n'easy script type things in C < 1118006214 0 :CXI!unknown@unknown.invalid QUIT :Connection timed out < 1118006237 0 :wooby!~wooby@cpe-065-191-186-247.nc.res.rr.com JOIN :#esoteric < 1118006380 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :pgimeno: hmm, well - not in any strong sense... the idea might have sparked the idea of having a minimal string-rewriting language < 1118006448 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :ok, thanks < 1118006566 0 :CXI!Sanity@dialup-13.105.221.203.acc51-kent-syd.comindico.com.au JOIN :#esoteric < 1118007240 0 :graue!unknown@unknown.invalid QUIT :"Leaving" < 1118007462 0 :wooby!unknown@unknown.invalid QUIT : < 1118007726 0 :sp3tt!unknown@unknown.invalid QUIT :"Chatzilla 0.9.68a [Firefox 1.0.4/20050511]" < 1118008461 0 :heatsink!~heatsink@c-24-61-94-111.hsd1.nh.comcast.net JOIN :#esoteric < 1118009018 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :Hey all < 1118009047 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :hi GregorR < 1118009064 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :How goes? < 1118009077 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :GregorR: is ORK based in Sorted! or SON-OF-UNBABTIZED? < 1118009093 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :No, I haven't even heard of them :P < 1118009103 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :oh ok :) < 1118009129 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :is it based on something at all? < 1118009177 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :Nope < 1118009249 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :so, where do you draw the line between "based on" and "inspired by"? < 1118009287 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :Well, the fact that I hadn't heard of either of those makes it pretty unlikely that it was "inspired by" :P < 1118009315 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :yeah, I was talking in general, regarding categorizing in the wiki :) < 1118009336 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :Well, lesse ... < 1118009344 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :C++ is based on C, but Java is only inspired by C++. < 1118009365 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :Because while C++ borrows the majority (actually, all) of C's syntax, Java does not borrow the majority of C++'s syntax. < 1118009372 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :However, "the majority" is not a razor-sharp line. < 1118009381 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :Plus, it does 8-D < 1118009451 0 :wooby!~wooby@cpe-065-191-186-247.nc.res.rr.com JOIN :#esoteric < 1118009722 0 :lindi-!unknown@unknown.invalid QUIT :Read error: 54 (Connection reset by peer) < 1118009954 0 :lindi-!~lindi@kulho150.adsl.netsonic.fi JOIN :#esoteric < 1118011008 0 :wooby!unknown@unknown.invalid QUIT : < 1118011305 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :lament: do you have a link to your Smallfuck-to-SMETANA compiler? Googling for "smallfuck" is, uh... unproductive < 1118011462 0 :heatsink!unknown@unknown.invalid PRIVMSG #esoteric :smetana? Like the those who do not learn from the past are condemned to repeat it person? < 1118011505 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :well, it was originally Smetana like the composer, but I'm open to other interpretations :) < 1118011596 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :"The Bartered Bride" is probably what he's most known for < 1118011672 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :Moldau is one of my favorite classical pieces < 1118011721 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :google claims that the guy who said that quote was named George Santayana, btw. (but google claims a lot of things...) < 1118012059 0 :heatsink!unknown@unknown.invalid PRIVMSG #esoteric :oh yeah < 1118012071 0 :heatsink!unknown@unknown.invalid PRIVMSG #esoteric :yea, I like moldau vltava too < 1118012108 0 :heatsink!unknown@unknown.invalid PRIVMSG #esoteric :that's probably why I rmembered the name. < 1118013036 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :hum, an algorithm written in Chef having bugs must be quite disgusting < 1118013092 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :isn't that true for most esolangs? < 1118013149 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :well, imagine a Fibonacci Numbers with Caramel Sauce with bugs X-P < 1118013348 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :well, the perl implementation doesn't make it easier with it's uninformative error messages :) < 1118013591 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :just imagine one of these in the caramel sauce: http://images.google.com/images?q=bugs < 1118013629 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :haha < 1118013632 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :(though some would be actually interesting) < 1118013642 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :well, some of them would be kind of kinky ;) < 1118014948 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :fwiw, I could argue that the 3 queues in the NULL language mean it's not *really* zero-dimensional... < 1118014975 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :doesn't the dimensional aspect refer to the code, not the data structures? < 1118014999 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :well, ok. it could have 0-dimensional code < 1118015056 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :but we should probably have a separate queue-based category. < 1118015291 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :categorization of esolangs is like counting the number of colours in the rainbow < 1118015331 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :btw kipple, i added an outline of a proof of turing-completeness to the kipple page < 1118015341 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :I saw it. nice < 1118015459 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :I'm not very familiar with theory of computation, so I wouldn't know how to write such things. < 1118015464 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :I consider the brainfuck interpreter proof enough < 1118015589 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :cpressey: I was looking for such a way of classifying the languages like this. I was using my bookmarks but it was not enough. The categories that characterize each language are IMO very valuable. < 1118015739 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :kipple: oh, there's a bf interpreter written in kipple? i wasn't aware... yeah, that's excellent proof too, i'll note it < 1118015763 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :IIRC it was the second program ever written in kipple :) < 1118015781 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :http://rune.krokodille.com/lang/kipple/samples/bfi.k < 1118015820 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :pgimeno: well, what i mean is, once you have a category established, one of the most valuable new esoteric languages that can be designed, is one that defies classification under that category :) < 1118015988 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :well, yeah but still I think it's good to have them < 1118016000 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :me too < 1118016080 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :heh. Befunge is now in 9 categories..... < 1118016485 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :it's very categorical < 1118017224 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :isn't TMMLPTEALPAITAFNFAL a joke language? < 1118017266 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :(as in "totally unusable except as a joke") < 1118017272 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :no idea < 1118017299 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :ah, that one. < 1118017356 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :well, it is probably turing-complete... though perhaps not always :) < 1118017431 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :if it is turing complete all days, is it turing complete? < 1118017444 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :ACTION doesn't like the idea of separating joke languages from the rest < 1118017454 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :me neither < 1118017942 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :nite all < 1118018021 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :nite < 1118027777 0 :heatsink!unknown@unknown.invalid QUIT :"Leaving" < 1118028075 0 :puzzlet!unknown@unknown.invalid PRIVMSG #esoteric :pgimeno, how about like listing all turing-complete languages on [[Turing-complete]]? < 1118028289 0 :kipple!unknown@unknown.invalid QUIT :Read error: 60 (Operation timed out) < 1118036584 0 :malaprop!unknown@unknown.invalid QUIT :"sleep" < 1118041520 0 :graue!~graue@ip68-100-130-21.dc.dc.cox.net JOIN :#esoteric < 1118041543 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :do SMITH and Muriel count as self-modifying? < 1118042423 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :cpressey: hey < 1118042440 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :cpressey: do you want it? < 1118043292 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :god < 1118043310 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :on [[Turing complete]], smallfuck is mentioned as a minimal example of turing-complete language < 1118043834 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :it is < 1118043864 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :well no < 1118043887 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :i should probably explicitly state somewhere that smallfuck implementations must have a memory size limit < 1118043896 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :or, change my mind and allow them to be infinite. < 1118043989 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :probably the latter. < 1118044455 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :what the hell haha < 1118044456 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :i read through all the mailing list discussion on the subject and don't remember seeing that < 1118044456 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :http://esoteric.voxelperfect.net/wiki/Ale < 1118044486 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :"stupid" is the term the author uses (see link) < 1118044502 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :i just wanted to make a page so someone could flesh it out later < 1118044515 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :we need a logo < 1118044525 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :or is that flower thing a logo < 1118044527 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :we need a PD Piet program to use as a logo < 1118044534 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :the flower thing is the mediawiki logo, so it sucks < 1118044535 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :PD? < 1118044540 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :public domain < 1118044542 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :ahh < 1118044555 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :also it should do something cool < 1118044561 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :yes < 1118044621 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :with a proper command set, a language with only one bignum should be TC < 1118044623 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :that would be cool < 1118044640 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :no < 1118044641 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :i mean < 1118044643 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :not necessarily < 1118044649 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :that language could simply be Brainfuck < 1118044658 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :and that's not cool at all < 1118044660 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :no it couldn't < 1118044671 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :it would operate on the digits of the bignum :) < 1118044671 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :[ only knows "0 or not-zero" < 1118044682 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :then it could be, yes < 1118044686 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :exactly < 1118044708 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :do you know of a graphics editor that'd be good for piet? < 1118044712 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :no < 1118044747 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :in fact, if you write one, release it as free software, because i don't know of any decent bitmap editors for working with pixels < 1118044794 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :hm < 1118044799 0 :clog!unknown@unknown.invalid QUIT :ended < 1118044800 0 :clog!unknown@unknown.invalid JOIN :#esoteric < 1118045033 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :the only interpreter is in perl!? awww < 1118045130 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :you lack perl? < 1118045138 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :i hate perl < 1118045139 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :oh < 1118045140 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :cool < 1118045144 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :there's a txt2gif converter < 1118045148 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :excellent < 1118045149 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :http://www.majcher.com/code/piet/ < 1118045156 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :(a piet-specific one) < 1118045214 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :and i can't download it, it's 403 < 1118045249 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :does the wayback machine possibly have a copy from before it became 403'd? < 1118045289 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :oh, okay, it's part of the release < 1118045290 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :great < 1118045299 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :http://www.majcher.com/code/piet/Releases/Piet-Interpreter-0.03.tar.gz < 1118045356 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :cool < 1118045386 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :so what would a logo program do? < 1118045454 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :something that it can do while looking nice < 1118045468 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :the fibonacci program on the piet website looks nice i think < 1118045531 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :you think we can get some copyright renunciation out of the guy? < 1118045558 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :seems likeley < 1118045563 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :hm < 1118045576 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :why does it have to be public domain anyway? < 1118045675 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :because there's a blanket statement that anything on the wiki is, just to avoid complicating things < 1118045720 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :i guess you could say the logo is not content, but if it's an esolang program, people might think otherwise < 1118045721 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :you think it'd make a good logo? < 1118045723 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :http://www.dangermouse.net/esoteric/fibbig.gif < 1118045730 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :it would work < 1118045760 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :it's just the right size < 1118045812 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :i can email the guy < 1118045885 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :sure, go ahead < 1118045923 0 :lindi-!unknown@unknown.invalid PRIVMSG #esoteric :graue: why not use 3-clause BSD license or MIT license? < 1118045955 0 :lindi-!unknown@unknown.invalid PRIVMSG #esoteric :graue: those at least state that there is no warranty < 1118046186 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :those licenses don't solve the problem of you having to acknowledge, "Parts copyright (c) 2004 'Bob1233'. Parts copyright (c) 2005 'Graue', Parts copyright (c) 2005 '68.133.119.11'" etc for every nontrivial page < 1118046194 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :i'll add something stating that there is no warranty < 1118046554 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :okay, i sent the guy an email < 1118046691 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :by the way, what was it you found, again, about a language with a single queue being TC? < 1118046739 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :i made such a language (http://www.oceanbase.org/graue/qdeql/) and implied that it was TC, and cpressey is not convinced < 1118046810 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :i have never found nor said anything about that < 1118046827 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :all i did was ask you if it was really TC < 1118046833 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :cause i'm not convinced either < 1118046997 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :damn, am i confusing you with someone else in this channel? < 1118047005 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :someone said that < 1118047041 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :i guess you are < 1118047417 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :how stupid of me < 1118048604 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :man, piet is a cool idea but too painful < 1118048612 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :i don't feel like installing perl modules :( < 1118048644 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :maybe you can pay someone $50 an hour to convert it to ruby then < 1118048675 0 :lindi-!unknown@unknown.invalid PRIVMSG #esoteric :graue: how does wikipedia handle this? < 1118048712 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :it doesn't < 1118048739 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :i imagine that wikipedia itself is violating the FDL immensely just by continuing to exist < 1118048749 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :graue: but the ruby version would also require the same module < 1118048757 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :lament: convert the code in the module < 1118048774 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :the module is on the Sylvain guy's site < 1118048825 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :graue: the module is ImageMagick and isn't in Perl at all... < 1118048839 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :i'm just lazy, really < 1118049010 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :oh < 1118049040 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :and cheap, too < 1118049044 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :you know what would be awesome < 1118049050 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :a language that uses musical notation < 1118049057 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :any exist? < 1118049062 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :heh, yeah, that would be great < 1118049065 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :not to my knowledge < 1118049128 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :choon does'nt even come close < 1118049277 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :i'd be interested in a language that used natural language to control it, but in a totally unnatural way, so that any grammatically correct english sentence was a program < 1118049306 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :there's a research project it could be built on that analyzes sentences, "link grammar" or something like that, it's called < 1118049665 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :ok that's it i'm designing a music-based language < 1118049672 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :it's gonna be the best ever < 1118049727 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :programs will be polyphonic compositions in the style of Bach. < 1118050572 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :does atonal music crash? < 1118050595 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :okay, make that "potentially in the style of bach" :) < 1118050611 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :but they'll be polyphonic < 1118050634 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :that's a must, and i'm trying to figure out how to make that into a useful programming paradigm < 1118050668 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :is it too obvious to make each voice a thread? < 1118050688 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :well yeah < 1118050699 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :but what to do with that later? < 1118050705 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :there must be some incentive to use more than one thread < 1118050727 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :to use 2 to 4 threads at most times < 1118050733 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :so now your challenge is "design language that is useful for computation if, and only if, multiple threads are used" < 1118050742 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :the music part is solved < 1118050804 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :pretty much. < 1118050830 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :they don't have to be threads though < 1118050843 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :i was thinking of having some sort of assembly < 1118050847 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :how about if the only program state is based on which thread is running what code right now? < 1118050855 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :where one voice is an operation < 1118050862 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :and other voices are parameters < 1118050877 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :can that produce good music? < 1118050895 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :don't see why not < 1118050927 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :do you plan to use the tonal system? < 1118050931 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :but it's against the nature of polyphony to designate one thread as special < 1118050941 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :i.e. have one "melody" aka "operation" thread < 1118050953 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :yes < 1118050982 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :yeah, tonal system or something like that < 1118050992 0 :puzzlet!unknown@unknown.invalid PRIVMSG #esoteric :fugue programming language! < 1118050993 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :intervals are significant rather than notes < 1118050995 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :puzzlet: yes < 1118051035 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :make enough room for expression, i.e. major and minor third in any direction is the same instruction < 1118051035 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :naturally i'll have to answer your language with a twelve-tone programming language < 1118051051 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :so i guess no, no tonal system :) < 1118051075 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :if you have a concept of major and minor third you are using the tonal system < 1118051094 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :not really < 1118051097 0 :puzzlet!unknown@unknown.invalid PRIVMSG #esoteric :tonal system is like, you have major or minor. < 1118051109 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :not really, since they're always measured from the current note < 1118051110 0 :puzzlet!unknown@unknown.invalid PRIVMSG #esoteric :the opposite of atonal system < 1118051117 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :there's no tonal center < 1118051143 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :i'm just saying, "up 3 steps or up 4 steps is the same instruction" < 1118051152 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :but it's based on intervals, and that is the tonal system < 1118051165 0 :puzzlet!unknown@unknown.invalid PRIVMSG #esoteric :not exactly. < 1118051180 0 :puzzlet!unknown@unknown.invalid PRIVMSG #esoteric :atonal system is based on intervals indeed < 1118051189 0 :puzzlet!unknown@unknown.invalid PRIVMSG #esoteric :i mean either < 1118051248 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :the tonal system is based on interval content, whereas, for contrast, the twelve-tone system is based on interval order < 1118051273 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :i can't comment on the atonal system, but it would not be possible to meaningfully use the twelve-tone system in this language < 1118051285 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :i don't get it < 1118051358 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :well, that's okay < 1118051364 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :i don't mind programming in the tonal system < 1118051381 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :but the reason i'm not getting it is because you're not making any sense! < 1118051453 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :the reason i am ceasing my argument is because i don't believe i can explain it effectively! < 1118051457 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :okay < 1118051510 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :in the twelve-tone system, you take all 12 notes of the chromatic scale, shuffle them into a random permutation, and then add registral details by assigning them to different octaves and such < 1118051521 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :it's based on all twelve tones being there all the time, more or less < 1118051525 0 :puzzlet!unknown@unknown.invalid PRIVMSG #esoteric :no that's serial music < 1118051546 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :are we calling the same thing two different names? < 1118051559 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :what i described exists and is called twelve-tone music < 1118051594 0 :puzzlet!unknown@unknown.invalid PRIVMSG #esoteric :but calling every music other than twelve-tone music "tonal" is wrong < 1118051639 0 :puzzlet!unknown@unknown.invalid PRIVMSG #esoteric :tonal music is based on tonality, the major chord. < 1118051677 0 :puzzlet!unknown@unknown.invalid PRIVMSG #esoteric :and i belive that other side of the music is called "atonal", which twelve-tone music is part of < 1118051796 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :atonal music is actually a subset of the intersection of tonal and twelve-tone music, according to noted composer Charles Wuorinen, whose book i have just consulted on the subject < 1118051796 0 :puzzlet!unknown@unknown.invalid PRIVMSG #esoteric :and beside that, atonal music includes other mechanisms like whole-tone scale music < 1118051837 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :Wuorinen sees "tonal" as part of "diatonic" and "12-tone" as part of "chromatic" < 1118051847 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :so perhaps this esolang idea is based on diatonic music, then < 1118051871 0 :sp3tt!~chatzilla@cust-148-133.elhandel.umeaenergi.se JOIN :#esoteric < 1118051889 0 :sp3tt!unknown@unknown.invalid QUIT :Client Quit < 1118051896 0 :sp3tt!~chatzilla@cust-148-133.elhandel.umeaenergi.se JOIN :#esoteric < 1118051923 0 :puzzlet!unknown@unknown.invalid PRIVMSG #esoteric :diatonic music is based on scale < 1118051962 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :graue: no < 1118051971 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :it is based on chromatic < 1118051977 0 :puzzlet!unknown@unknown.invalid PRIVMSG #esoteric :but the idea of melody moving by interval is free from any scale, and not falls in 12-tone < 1118051981 0 :puzzlet!unknown@unknown.invalid PRIVMSG #esoteric :also. < 1118052003 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :yeah, it's just chromatic < 1118052009 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :but the programmer is free to make it as tonal as he likes < 1118052042 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :in particular, whatever the other instructions are < 1118052044 0 :puzzlet!unknown@unknown.invalid PRIVMSG #esoteric :becuase he/she can choose from major and minor 3rd interval < 1118052058 0 :puzzlet!unknown@unknown.invalid PRIVMSG #esoteric :, for example. < 1118052061 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :i have decided to make major/minor second a "skip the next interval" instruction < 1118052101 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :(an instruction like that is necessary so the voice stays within some reasonable frequency range) < 1118052105 0 :puzzlet!unknown@unknown.invalid PRIVMSG #esoteric :lament: do going-up and going-down indicate different instructions? < 1118052111 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :no, don't think so < 1118052121 0 :puzzlet!unknown@unknown.invalid PRIVMSG #esoteric :good < 1118052126 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :which leaves room for very few instructions really < 1118052155 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :but that's ok since they'll have arguments < 1118052187 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :you say a skip the next interval instruction, how about skipping the next n intervals? < 1118052202 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :that's too much < 1118052206 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :why? < 1118052216 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :just make the next interval (after the skipped one) again a second < 1118052228 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :you can write a lot with that < 1118052236 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :(i just tried :)) < 1118052249 0 :puzzlet!unknown@unknown.invalid PRIVMSG #esoteric :lament: how do you plan about note duration? < 1118052254 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :not meaningful < 1118052278 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :(otherwise it will be practically impossible to make it sound good) < 1118052368 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :dunno what storage model could work < 1118052377 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :perhaps each voice has its own memory or something < 1118052392 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :a stack... < 1118052673 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :what, the parameters have memory different from the operation's memory? < 1118052699 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :i have no clue < 1118052759 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :anyway good night < 1118052873 0 :puzzlet!unknown@unknown.invalid PRIVMSG #esoteric :good night < 1118052875 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :good night < 1118052993 0 :graue!unknown@unknown.invalid QUIT :"Leaving" < 1118054106 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :moin < 1118054121 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric : we need a PD Piet program to use as a logo < 1118054156 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :I used the hello.png Piet program with permission from the author; he was very happy that it was used for something < 1118054209 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :(used in ) < 1118054238 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric : do you know of a graphics editor that'd be good for piet? < 1118054257 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :maybe npiet works: http://www.bertnase.de/npiet/ < 1118054337 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric : by the way, what was it you found, again, about a language with a single queue being TC? < 1118054425 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :fizzie gave this link: http://jackson.cs.miami.edu/~burt/papers/1993.1/Saq-JAIIO-2.ps < 1118055225 0 :puzzlet!unknown@unknown.invalid PRIVMSG #esoteric :i got http://puzzlet.org/html/jsaheui_en.html done < 1118055298 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :cool < 1118055448 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :now I know what button to press, thanks :) < 1118055502 0 :puzzlet!unknown@unknown.invalid PRIVMSG #esoteric :my pleasure < 1118056030 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :I find it still a bit hard to use < 1118056047 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :especially since I can't type Hangul < 1118056311 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :what was the link to the language description, again? < 1118056467 0 :puzzlet_!~puzzlet@61.247.148.38 JOIN :#esoteric < 1118056740 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :well, all I could try is Hello, world < 1118056985 0 :puzzlet_!unknown@unknown.invalid PRIVMSG #esoteric :what os do you use? < 1118057005 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :windows in this case < 1118057097 0 :puzzlet_!unknown@unknown.invalid PRIVMSG #esoteric :can you configure to use Korean input system? < 1118057127 0 :puzzlet!unknown@unknown.invalid QUIT :Read error: 110 (Connection timed out) < 1118057134 0 :puzzlet_!unknown@unknown.invalid NICK :puzzlet < 1118057206 0 :DMM!DMM@203-206-51-20.dyn.iinet.net.au JOIN :#esoteric < 1118057209 0 :puzzlet!unknown@unknown.invalid PRIVMSG #esoteric :there are external Hangul input system like saenaru and ngs, but i'm worrying either of them haven't been translated into English.. < 1118057216 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :I'm afraid not, and even if I can, I'm afraid of doing it and not being able to return to normal < 1118057224 0 :DMM!unknown@unknown.invalid PRIVMSG #esoteric :evening all < 1118057238 0 :puzzlet!unknown@unknown.invalid PRIVMSG #esoteric :evening? familiar timezone :) < 1118057242 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :hi < 1118057248 0 :DMM!unknown@unknown.invalid PRIVMSG #esoteric :Sydney :-) < 1118057253 0 :puzzlet!unknown@unknown.invalid PRIVMSG #esoteric :South Korea < 1118057278 0 :DMM!unknown@unknown.invalid PRIVMSG #esoteric :I just got an email about the esolang wiki... < 1118057305 0 :puzzlet!unknown@unknown.invalid PRIVMSG #esoteric :if you use X window system, i recommend to use nabi. < 1118057305 0 :puzzlet!unknown@unknown.invalid PRIVMSG #esoteric :http://nabi.kldp.net/ < 1118057305 0 :puzzlet!unknown@unknown.invalid PRIVMSG #esoteric :as the Hangul input system < 1118057305 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :yup, lament sent it if I'm right < 1118057358 0 :puzzlet!unknown@unknown.invalid PRIVMSG #esoteric :gotta go for a dinner < 1118057422 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :DMM: thanks for your permission to use the hellobig.png as a logo, btw < 1118057430 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :s/logo/image/ < 1118057459 0 :DMM!unknown@unknown.invalid PRIVMSG #esoteric :wow, I'm still writing my reply granting permission... :-) < 1118057494 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :sorry, I mean here: http://www.formauri.es/personal/pgimeno/compurec/EsotericLanguages.png < 1118057502 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :that was quite a while ago < 1118057504 0 :DMM!unknown@unknown.invalid PRIVMSG #esoteric :oh! right :-) < 1118057511 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :argh < 1118057518 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :http://www.formauri.es/personal/pgimeno/compurec/EsotericLanguages.php < 1118057768 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :by the way, I have abused the idea on your BIT language and made up Bitxtreme: http://www.formauri.es/personal/pgimeno/prog/esoteric/Bitxtreme.php < 1118057780 0 :DMM!unknown@unknown.invalid PRIVMSG #esoteric :oooh < 1118057874 0 :DMM!unknown@unknown.invalid PRIVMSG #esoteric :rofl... I like the file extension < 1118057929 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :actually it's a joke language to ironize about the lack of space for writing complex programs in some space-limited languages, especially Malbolge < 1118057988 0 :DMM!unknown@unknown.invalid PRIVMSG #esoteric :heh... that's great. I like the fact you zip all four sample programs for convenience... < 1118058031 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric ::) < 1118058172 0 :DMM!unknown@unknown.invalid PRIVMSG #esoteric :does zip really make a 562 byte file out of those? < 1118058211 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :that's what it did when I compressed them < 1118058265 0 :DMM!unknown@unknown.invalid PRIVMSG #esoteric :cool < 1118058562 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :btw, I'm not sure if you're aware that there's been a recent incorporation of 99bob in Chef to de 99bob page < 1118058565 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :s/de/the/ < 1118058684 0 :DMM!unknown@unknown.invalid PRIVMSG #esoteric :I heard from the guy who was writing it, didn't know he'd finished < 1118058814 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :there are two versions actually by two different people who submitted them independently and within a few hours < 1118058950 0 :DMM!unknown@unknown.invalid PRIVMSG #esoteric :wow, that's a nice program :-) < 1118059068 0 :DMM!unknown@unknown.invalid PRIVMSG #esoteric :the sous-chef one < 1118059468 0 :DMM!unknown@unknown.invalid PRIVMSG #esoteric :ACTION heads off... getting late here < 1118059512 0 :DMM!unknown@unknown.invalid PART #esoteric :? < 1118060167 0 :sp3tt!unknown@unknown.invalid PRIVMSG #esoteric :Noooo... I missed David Morgan-Mar :( < 1118060415 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :I'm sorry, sp3tt < 1118060438 0 :sp3tt!unknown@unknown.invalid PRIVMSG #esoteric :Stupid lunch... < 1118060626 0 :sp3tt!unknown@unknown.invalid PRIVMSG #esoteric :I wonder what the most complex program written in shakespeare is... < 1118062579 0 :kipple!~kipple@163.80-202-100.nextgentel.com JOIN :#esoteric < 1118063235 0 :puzzlet!unknown@unknown.invalid PRIVMSG #esoteric :back. < 1118063252 0 :puzzlet!unknown@unknown.invalid PRIVMSG #esoteric :maybe i could provide a graphical Hangul input system for that interpreter... < 1118067238 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :While totally unrelated to esoteric programming, to me this is exciting, so I shall scream it out... I IMPLEMENTED ENCRYPTION INTO DIRECTNET!!!! YAAAAAAAAAAAAAAAAY! < 1118067290 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :what is directnet? what encryption? < 1118069152 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :I answered myself about directnet. < 1118070431 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :so, what's the status of the logo? < 1118070523 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :I played a bit with paint shop pro, and a some spoofs of the MediaWiki logo < 1118070529 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :http://rune.krokodille.com/lang/esologo1.png < 1118070536 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :http://rune.krokodille.com/lang/esologo2.png < 1118070539 0 :malaprop!~ph@ppp-68-251-59-237.dsl.chcgil.ameritech.net JOIN :#esoteric < 1118070563 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :the MediaWiki logo: http://esoteric.voxelperfect.net/w/skins/common/images/wiki.png < 1118070717 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :argh. "made some spoofs", i meant to say < 1118071006 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :kipple: apparently DMM replied to lament by email < 1118071071 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :I like esologo2.png more < 1118071173 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :put them all on one page: file://slartibartfast/rune/www/lang/logos.html < 1118071269 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :I like the idea of using a Piet program, but the ones I've seen so far are a bit ugly, IMHO < 1118071278 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :er, check that last URL :) < 1118071292 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :ha. sorry < 1118071320 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :http://rune.krokodille.com/lang/logos.html < 1118071328 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :added two more < 1118071611 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :I still like the last one more than the rest < 1118071657 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :ACTION is reading the Piet spec... < 1118071790 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :seen the npiet link I've given above? < 1118071805 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :no < 1118071836 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :http://www.bertnase.de/npiet/ < 1118071881 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :it comes with a tcl/tk editor < 1118071911 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :nice :) < 1118072043 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :nice code gallery on that page too < 1118072107 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :yup < 1118077661 0 :sp3tt!unknown@unknown.invalid QUIT :"Chatzilla 0.9.68a [Firefox 1.0.4/20050511]" < 1118077708 0 :sp3tt!~chatzilla@lite-148-133.umenet.net JOIN :#esoteric < 1118078088 0 :comet_11!Sanity@dialup-13.105.221.203.acc51-kent-syd.comindico.com.au JOIN :#esoteric < 1118078131 0 :CXI!unknown@unknown.invalid QUIT :Read error: 104 (Connection reset by peer) < 1118085338 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :hola < 1118085464 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :hola < 1118085563 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :здравÑтвулте! (or so says Babelfish) < 1118085576 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :so yeah, DMM replied to me as i'm sure you're aware < 1118085598 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :pgimeno: that's strange, it's fine but one letter is misspelled < 1118085613 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :oh < 1118085613 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :can't be a grammar-based typo either < 1118085626 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :probably wrong dict or something < 1118085654 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :the program i asked DMM about to use is a logo isn't helloworld btw < 1118085659 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :it's the fibonacci one < 1118085671 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :but the npiet page says the program is broken... < 1118085703 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :I didn't notice that < 1118085718 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :http://www.bertnase.de/npiet/picture.html < 1118085782 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :oh, I see < 1118085800 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :I'm not sure what that means exactly < 1118085812 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :me neither < 1118085841 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :it seems npiet and piet reference implementation don't interpret the piet specification the same way < 1118085996 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :indeed that's noted and there's an example with the differences < 1118086043 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :(at the bottom of the page you've given) < 1118086081 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :quite < 1118086315 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :in malbolge, the discrepancies between the spec and the interpreter were resolved in favor of the interpreter < 1118087105 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :hm, has anybody looked at Aura? < 1118087203 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :it seems that all that exists is an undocumented interpreter < 1118087493 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :lament: yes please < 1118087500 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :(now i need to catch up on this log) < 1118087571 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :c < 1118087698 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :graue: re: do SMITH and Muriel count as self-modifying? ... in a loose sense, I'd say say... yes... but the sense is very loose (Muriel program need to make modified copies of themselves to do interesting stuff, and SMITH only really needs to append to itself, not (strictly) modify... < 1118087779 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :re one bignum... my understanding is an FSA + two counters (bignums) is TC. < 1118087801 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :(so maybe a rational bignum...?) < 1118088189 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :okay < 1118088199 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :http://z3.ca/~lament/smetana_sf.tar.gz < 1118088267 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :aura seems interesting < 1118088274 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :i wonder if it can possibly be useful < 1118088627 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :lament: ty < 1118088676 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :yay! < 1118088693 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :lament: it's in my to-look list < 1118088839 0 :sp3tt!unknown@unknown.invalid QUIT :"Chatzilla 0.9.68a [Firefox 1.0.4/20050511]" < 1118088882 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :-lilo/Wallops- Hmmm, check the links on ftp://ftp.debian.org/debian/dists , perhaps congratulations are in order! < 1118088901 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :apparently Sarge is finally out < 1118088990 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :if it is, it's insanely hard to program < 1118088995 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :but i don't think so < 1118089020 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :the interpreter is a pain to read < 1118089036 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :it's pretty simple < 1118089071 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :instructions are taken by character mod 8, if I understand it correctly < 1118089075 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :yes < 1118089195 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :ACTION hates programs made up of just one-letter vars < 1118089237 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :ACTION goes away < 1118089253 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :later < 1118094260 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :From: Lode Vandevenne < 1118094262 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :The university page will indeed be gone in a few years, too bad, it's such < 1118094262 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :handy free webspace. < 1118094262 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :Feel free to host a copy of it for preservation. Normally I'll also have my < 1118094262 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :own webspace one day, but not yet, so it's a good idea to make a copy. < 1118094286 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :ACTION commits his page into the svn repos < 1118094315 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :(Lode Vandevenne is the author of gammaplex) < 1118095293 0 :comet_11!unknown@unknown.invalid NICK :CXI < 1118098024 0 :graue!~graue@ip68-100-130-21.dc.dc.cox.net JOIN :#esoteric < 1118098094 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :new db backup at http://esoteric.voxelperfect.net/db/esolang-050606.sql.bz2 < 1118098147 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :graue: Ah, been wanting to ask you. What's the schedule for those? Daily or weekly? And for the files repos? < 1118098223 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :graue: nice < 1118098231 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :the schedule is whenever i make them < 1118098237 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :about the files, what was the update frequency? < 1118098273 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :I thought the point of this scheme was to eliminate the possibility of losing everything because someone loses interest? How about a cron job instead? < 1118098304 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :malaprop: I was just about to say that ;) < 1118098336 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :We create this thing so that it can sort of automatically back itself up, and now we're relying on humans? No offense graue, but you are human. < 1118098374 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :well, i'm insulted! < 1118098391 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :And for dates, YYYYMMDD has the benefit of being ISO and common. < 1118098415 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :graue: PATHETIC FLESH-BAG!!! < 1118098421 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric ::P < 1118098425 0 :lindi-!unknown@unknown.invalid QUIT :Read error: 113 (No route to host) < 1118098561 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :graue: Would you like a hand setting up cron jobs? < 1118098766 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :no thanks, i can do it < 1118098794 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :i'm trying to figure out how to allow anonymous svn read access so you can back up the files repo < 1118098884 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :Having svn read access does not allow you to recreate the repository, you'll need to take an 'svnadmin dump'. < 1118098958 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :I don't think that history is needed < 1118098988 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :If it's in svn, I want the history. I know someone will definitely end up using it. < 1118099043 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :well, I think it's svn just because it can't be ftp, so it's svn used as ftp < 1118099083 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :pgimeno: I know. But since it's in version control, it's just a matter of time until someone uses versioning. < 1118099126 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :maybe, but I hope not... < 1118099163 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :pgimeno: It'll probably happen about a day after the first person who wasn't here for the planning discussion is given access. < 1118099274 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :Gotta run, can pick up the discussion in ~2.5h. < 1118099287 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :later malaprop < 1118099783 0 :lindi-!~lindi@kulho150.adsl.netsonic.fi JOIN :#esoteric < 1118100168 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :the history isn < 1118100170 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :'t needed < 1118100534 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :graue: I commited some files a while ago; when are they expected to show up? < 1118100600 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :a while ago = 1.5 h ago < 1118100629 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :they are expected to show up within 6.5 hours then < 1118100646 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :k < 1118100704 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :about the svn: how do I get access? anonymous read access would be nice, but I'd like write access... < 1118100795 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :is there a generic user account for this project, or do we get personal? < 1118100963 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :it's personal < 1118101168 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :kipple: read my private message < 1118101190 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :sorry. not paying attention... ;) < 1118101795 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :anyone should now be able to "svn co http://esoteric.voxelperfect.net/svn/esofiles/" and get everything < 1118101891 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :works nice :) < 1118101924 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :cool! < 1118101992 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :indeed it's accessible via browser: http://www.esolangs.org/svn/esofiles/ < 1118102017 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :very cool indeed < 1118102028 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :but if you open an HTML file it shows the source, and that doesn't have dates, filesizes... < 1118102070 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :yeah < 1118102072 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :cpressey, want an account for writing with? < 1118102192 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :graue: sure < 1118102225 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :question: do I have to set file permissions for files I add, or does svn take care of that? < 1118102344 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :svn doesn't handle permissions, just executable < 1118102344 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :hmm. I ran svn commit but nothing seem to happen.. < 1118102364 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :ok, so I have to set read access to all on every file I add? < 1118102369 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :first try svn status and see what you have < 1118102433 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :read access? nope, it doesn't handle permissions; files are files and must be readable by your client, that's all < 1118102434 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :? esoarchive/kipple/src < 1118102434 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :? esoarchive/kipple/impl/kipple1.01.zip < 1118102454 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :(that was from svn status) < 1118102456 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :do you want to add the whole src/ tree with all of its contents? < 1118102495 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :i just want to commit the files I added... < 1118102506 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :you haven't added the files yet :) < 1118102540 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :ACTION sends pm to kipple for a primer on handling svn < 1118102645 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :you need to use "svn add whateverfilename" on new files, and "svn mkdir someplace" to make new directories < 1118102723 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :I have got it now < 1118102744 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :though I made the directory through Samba, not svn... < 1118102831 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :yeah, it works if it already exists and you svn add it < 1118102847 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :basically that's what svn mkdir does: it creates the dir and adds it < 1118102912 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :thanks for the help. added some kipple just to test it < 1118102946 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :just be sure to update before you commit < 1118102970 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :oops. I have to do that as well? < 1118103014 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :it will avoid future problems (when overwriting files that are not up to date) < 1118103141 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :and please use a meaningful commit message when possible (for example: added Kipple implementation) < 1118103174 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :btw, i've just created a new esolang (first one in a couple of years) < 1118103182 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :http://catseye.webhop.net/projects/beturing/ < 1118103205 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :cool < 1118103226 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :2d tape! haha. that's cool < 1118103227 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :nice! < 1118103250 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :2D tape? that reminds me of the turmites < 1118103321 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :ah yeah.. i dimly remember a "turmite" program from my Amiga days... < 1118103393 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :http://mathworld.wolfram.com/Turmite.html < 1118103394 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :cool < 1118103476 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :yeah < 1118103479 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :wow < 1118103848 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :what's the wire crossing problem? < 1118103898 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :does it have any resemblance to the problem of crossing wires in wireworld? < 1118104203 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :the wire-crossing problem is (very informally) that languages like Befunge seem to need an "#" operator, or some other operator that can jump over things. < 1118104224 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :otherwise your paths of execution can't cross, and you can't write some interesting programs < 1118104227 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :(this is all conjecture) < 1118104238 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :kind of like light cycles in Tron, maybe...? :) < 1118104261 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :i've been googling for related stuff in the past few minutes, and i found this < 1118104263 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :http://planetmath.org/?op=getobj&from=objects&name=PlanarGraph < 1118104264 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :that's why you should use 3d ;) < 1118104295 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :there's no problem in 3d, so what's the fun in that? :) < 1118104326 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :does there exist a language where you write code in 3d? < 1118104404 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :graph theory is fun < 1118104428 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :kipple, Trefunge < 1118104453 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :so, what kind of file format does it use? < 1118104590 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :text files < 1118104600 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :with directives that say "advance the Z dimension" < 1118104616 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :i don't think it's ever been implemented... maybe it has < 1118104634 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :it uses a single 2d text file? < 1118104689 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :heh < 1118104702 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :exarkun was working on a 3d befunge < 1118104709 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :somebody else has also made one < 1118104719 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :theres one in basic somewhere i think < 1118104728 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :with graphical representation < 1118104741 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :kipple: yes < 1118104754 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :befungeGL? something like that < 1118104777 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :glfunge < 1118104785 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :then it's not what I was talking about. I meant where you WRITE code in 3 dimensions (as opposed to a 2d text file) < 1118104797 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :I think that somebody (not me 8-D) needs to make a 2D programming language that is NOT esoteric. < 1118104813 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :I don't know how, I think that for one you'd have to use a spreadsheet to edit it non-esoterically. < 1118104908 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :kipple, make a program that edits trefunge in 3D and saves source code in a text file < 1118104917 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :it's just a matter of representation < 1118104945 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :kipple: you're talking about editors, not languages, then? < 1118104951 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :cpressey: how do you like my smallfuck stuff :) < 1118104973 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :cpressy. languages < 1118104995 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :where the source code is 3 dimensional < 1118105017 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :lament: it's quite impressive, especially the compiled output ;) < 1118105022 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :kipple: you have to store the source code SOMEHOW < 1118105027 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :sure < 1118105032 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :kipple: in 1'dimensional memory < 1118105048 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :one way could be to use multiple text files per program < 1118105062 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :well, text files are technically 1d, no? < 1118105075 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :newlines are a convention that says "increment the y dimension" < 1118105076 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :well, ok... < 1118105089 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :funge just has another convention, there are lines that say "incrememnt the z dimension" < 1118105095 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :ok < 1118105115 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :http://www.di.fc.ul.pt/~jpn/gv/4dttt.htm - is this a 2D game just because the playfield is shown in 2D? < 1118105176 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :anyway, thunderstorms are here so i'm going to save my computer, brb later < 1118105177 0 :graue!unknown@unknown.invalid QUIT :"Leaving" < 1118105245 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :cool < 1118105250 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :thunderstorms < 1118105288 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :are cool < 1118105296 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :i think im finished with my music language < 1118105308 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :im just trying to figure out if it's any fun or not < 1118105308 0 :wooby!~wooby@cpe-065-191-186-247.nc.res.rr.com JOIN :#esoteric < 1118105620 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :now I get what the wire crossing problem is < 1118105713 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :my brain was stuck thinking turmite-wise, that the state was internal to the machine rater than given by the position of the code head < 1118105745 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :GregorR: http://atlas.usafa.af.mil/dfcs/bios/mcc_html/raptor.html ... ? :) < 1118105845 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :pgimeno: hmm.. well, it's not like a turmite (not even much like befunge.) the only state (besides the contents of the playfield) is the positions of the code head and the data head < 1118105869 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :but the wire-crossing problem shows up in other places too, i'm sure (and they may be better places to study it) < 1118105879 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :like wierd, probably REVERSE < 1118105883 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :probably wireworld < 1118105901 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :except i don;t think wireworld is TC < 1118105910 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :no? < 1118105910 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :unless there have been advances since i played with it last < 1118105922 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :I thought it was crystal clear < 1118105944 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :wireworld can cope with wire crossing by using four xor gates < 1118105957 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :hm < 1118105960 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :it's been a while < 1118105962 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :I have designed a wire crossing with wireworld < 1118105991 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :yeah, they definately exist < 1118105992 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :http://karl.kiwi.gen.nz/CA-Wireworld.html#WW-4 < 1118106032 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :i guess it is TC, if you can make a clock, logic gates, and registers < 1118106046 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :errrm < 1118106054 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :sans infinite tape. < 1118106149 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :damn < 1118106150 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric ::) < 1118106520 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :kipple: there is also this: http://ryujin.kuis.kyoto-u.ac.jp/ylab/yamakaku/Visulan/ < 1118106530 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :(site can be VERY slow.) < 1118106536 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :i don't remember how it's edited, though. < 1118106550 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :nice example of a rewriting language, regardless < 1118106600 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :cpressey: btw, I havent' managed to use ALPACA (perl problems) < 1118106695 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :my knowledge of perl is null < 1118106759 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :can you run it without problems? < 1118106760 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :cpressey: looks interesting :) < 1118106835 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :pgimeno: um... i haven't tried in a while. i'll look at it in a bit. < 1118106859 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :i'm actually wondering if wireworld's unlimited space counts as "tape" or < 1118106862 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :not < 1118106885 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :you can make wireworld forms as big as you like... but you can make fsm's as big as you like too < 1118106889 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :that's about the same question as if unlimited size in smetana counts as tape or not < 1118106895 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :wireworld forms can't grow < 1118106903 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :I know < 1118106906 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :nor can smetana programs or beta-juliet programs < 1118106932 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :life, otoh, can < 1118106943 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :yeah < 1118106956 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :so i wonder what all these wonderful "turing machine in wireworld" articles are about? < 1118106973 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :this, for example, looks interesting: http://pages.prodigy.net/nylesheise/train_set.html < 1118107017 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :I think that they have an infinite wire < 1118107052 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :yes < 1118107067 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :so, "they can't grow" is no limitation < 1118107076 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :if your "space" looks like this: http://pages.prodigy.net/nylesheise/langton_5.gif you can make one of those Turmites < 1118107101 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :well, ... i'm still undecided but at least the problem seems clearer < 1118107105 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :i'll probably be off now < 1118107131 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :see y'all latere < 1118107134 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :later, even... < 1118107143 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :bye then < 1118107146 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :I'm off too < 1118107153 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :g'nite all < 1118112516 0 :graue!~graue@ip68-100-130-21.dc.dc.cox.net JOIN :#esoteric < 1118113607 0 :kipple!unknown@unknown.invalid QUIT :Read error: 110 (Connection timed out) < 1118113875 0 :GregorR!unknown@unknown.invalid QUIT :Remote closed the connection < 1118113892 0 :pgimeno!unknown@unknown.invalid QUIT :Read error: 104 (Connection reset by peer) < 1118114151 0 :graue!unknown@unknown.invalid QUIT :"Leaving" < 1118114629 0 :pgimeno!pgimeno@124.Red-80-59-211.pooles.rima-tde.net JOIN :#esoteric < 1118116027 0 :GregorR!~GregorR@c-24-21-138-66.hsd1.or.comcast.net JOIN :#esoteric < 1118118014 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :pgimeno: i just tried alpaca.pl... it works for me... what part of it isn't working for you? < 1118119582 0 :malaprop!unknown@unknown.invalid QUIT :"sleep" < 1118125759 0 :wooby!unknown@unknown.invalid QUIT : < 1118126410 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :woohoo < 1118126440 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :or something < 1118131199 0 :clog!unknown@unknown.invalid QUIT :ended < 1118131200 0 :clog!unknown@unknown.invalid JOIN :#esoteric < 1118133833 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :heh < 1118133842 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :if you can have wireworld with "infinite wire" < 1118133850 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :you can also have a smetana program with infinite instructions < 1118133950 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :the only problem then is that programs won't terminate < 1118133959 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :you'd have to have something like "Goto step -1" to terminate your program < 1118134061 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :wireworld is definitely very pretty, though :) < 1118134139 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :http://www.quinapalus.com/wires11.html < 1118134145 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :pure sex < 1118134469 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :whoa < 1118134490 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :ACTION is amazed < 1118134521 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :dunno what's more technically impressive, that thing or the life turing machine < 1118134525 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :probably the latter < 1118134537 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :but they both look so amazing. < 1118134875 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :life turing machine? you mean Conway's Life, right? < 1118134895 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :cpressey: still around? < 1118134974 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :yeah, that thing < 1118135001 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :the annoying thing is that after they do something like that, it's completely pointless to do anything with wireworld (or life) :( < 1118135076 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :heh, yeah, almost impossible to beat < 1118135214 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :where have you found about Life? < 1118135230 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :er.. everybody knows about it? < 1118135255 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :ah, ok < 1118135303 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :I was wondering if you saw a graphic so amazing as the wireworld one < 1118135309 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :yes < 1118135317 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :http://rendell.server.org.uk/gol/tm.htm < 1118135469 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :whoa (again) < 1118135476 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :I see < 1118135740 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :cpressey: $ perl ../../../src/alpaca.pl redgreen.alp redgreen.pl < 1118135741 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :Unknown 'strict' tag(s) 'vars refs subs' at ../../../src/alpaca.pl line 19 < 1118135741 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :BEGIN failed--compilation aborted at ../../../src/alpaca.pl line 19. < 1118136029 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :(perl 5.8.4 if that matters) < 1118136385 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :removing the 'use strict' line seems to work < 1118142460 0 :kipple!~kipple@163.80-202-100.nextgentel.com JOIN :#esoteric < 1118149319 0 :wooby!~wooby@cpe-065-191-186-247.nc.res.rr.com JOIN :#esoteric < 1118149706 0 :malaprop!~ph@ppp-68-251-59-237.dsl.chcgil.ameritech.net JOIN :#esoteric < 1118149896 0 :wooby!unknown@unknown.invalid QUIT : < 1118153940 0 :CXI!unknown@unknown.invalid QUIT :"If you're reading this, it's probably x-chat's fault." < 1118153951 0 :CXI!Sanity@dialup-13.105.221.203.acc51-kent-syd.comindico.com.au JOIN :#esoteric < 1118154537 0 :puzlet!~puzzlet@61.247.148.38 JOIN :#esoteric < 1118154561 0 :puzlet!unknown@unknown.invalid PART #esoteric :? < 1118155894 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :Wowsa. < 1118155900 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :ACTION just watched that Wireworld go. < 1118157309 0 :sp3tt!~chatzilla@lite-148-133.umenet.net JOIN :#esoteric < 1118162325 0 :Keymaker!~a@wire74.adsl.netsonic.fi JOIN :#esoteric < 1118162497 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :'ello < 1118162504 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :i'm back! < 1118162506 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric ::) < 1118164404 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :Keymaker: Did you write a polygot quine? < 1118164410 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :shh! < 1118164413 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :i'm almost done! < 1118164422 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :i was trying to keep it as surprise < 1118164452 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :(and to note; i have been away from 4th till today 18:45 when i arrived on this channel today) < 1118164474 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :just wait ;) < 1118164494 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :I look forward to seeing it. < 1118164499 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :ok < 1118165509 0 :CXI!unknown@unknown.invalid QUIT :Connection timed out < 1118170255 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :phew.. < 1118170262 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :now there isn't much left < 1118171178 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :ACTION Programs now a program to convert some data.. < 1118171825 0 :CXI!Sanity@dialup-98.88.221.203.acc50-kent-syd.comindico.com.au JOIN :#esoteric < 1118171913 0 :graue!~graue@ip68-100-130-21.dc.dc.cox.net JOIN :#esoteric < 1118171986 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :ACTION goes to eat some pizza, will be back soon.. < 1118172131 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :cpressey, in the Beturing documentation, you say "...a Beturing machine is incapable of having a state transition diagram that is a planar graph." < 1118172138 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :shouldn't that be "that is NOT a planar graph"? < 1118173212 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :i think i may have just disproved the "universal Turing machines need state diagrams that are nonplanar graphs" conjecture: http://www.oceanbase.org/graue/archway/archway.txt < 1118174398 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :graue: yes, that's how it should read < 1118174475 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :and i think i agree with your conclusion... based on an outline of a smallfuck interpreter in beturing i got half-done last night before falling asleep < 1118174563 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :pgimeno: that's really weird... i'm using 5.005_03... < 1118174656 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :it's possible they changed the 'strict' module for 5.8 < 1118174684 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :anyway, deleting it should do no harm < 1118174692 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :I'm afraid that's the cause < 1118174748 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :that's one of the reasons i don't like perl anymore :) they couldn't even bother to bump the major revision number for incompatible changes < 1118175082 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :seems that this would be correct syntax now: use strict vars,refs,subs (but then, a lot of warnings or errors appear) < 1118175236 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :thanks < 1118175258 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :that works for me in 5.005, weird... i guess i was just doing it wrong the whole time?!? < 1118175343 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :all I know about Perl is that its syntax resembles C, vars start with $ and regexps are widely used, so I'm not the right one to ask :) < 1118175406 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :the description "write-only language" fits... :) < 1118175549 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :the "esoteric programming language" article on wikipedia once listed Perl as a prominent example < 1118175668 0 :sp3tt!unknown@unknown.invalid PRIVMSG #esoteric :Heh. < 1118175685 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric ::D < 1118175702 0 :sp3tt!unknown@unknown.invalid PRIVMSG #esoteric :I saw a guestbook, it was on the l33t page, and there was a field named "What esoteric languages have you used?" < 1118175733 0 :sp3tt!unknown@unknown.invalid PRIVMSG #esoteric :One answer was: "Brainfuck, befunge, malbolge, perl - oh wait that's not esoteric is it?" < 1118175748 0 :sp3tt!unknown@unknown.invalid PRIVMSG #esoteric :And another simply read: "English". < 1118175791 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :ACTION dies < 1118175797 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :nooooooo < 1118175806 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :ACTION hunts small bug < 1118175827 0 :sp3tt!unknown@unknown.invalid PRIVMSG #esoteric :And speaking of different languages, I was looking through the documents for subjects you can take in the Swedish equivalent of high school. < 1118175841 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :hey what happened to that math language of yours? < 1118175864 0 :sp3tt!unknown@unknown.invalid PRIVMSG #esoteric :The page for Programming B listed the following languages: Perl, PHP, C++, Python, Java, and other. < 1118175870 0 :sp3tt!unknown@unknown.invalid PRIVMSG #esoteric :I hope other includes BF. < 1118175892 0 :sp3tt!unknown@unknown.invalid PRIVMSG #esoteric :http://rename.noll8.nu/sp3tt/mathspec.txt < 1118175897 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :i hope it includes XUML, Qdeql, and "math" < 1118175917 0 :sp3tt!unknown@unknown.invalid PRIVMSG #esoteric :Code examples: http://rename.noll8.nu/sp3tt/hw.math, http://rename.noll8.nu/sp3tt/beer.math < 1118175919 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :are you still working on this? < 1118175926 0 :sp3tt!unknown@unknown.invalid PRIVMSG #esoteric :Yes, kind of. < 1118175950 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :sp3tt; you're from sweden? < 1118175953 0 :sp3tt!unknown@unknown.invalid PRIVMSG #esoteric :Yes. < 1118175957 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :ok < 1118175961 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :hi Keymaker, how was the bike ride? < 1118175969 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :not mention it :) < 1118175976 0 :sp3tt!unknown@unknown.invalid PRIVMSG #esoteric :And you are from Finland. < 1118175978 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :it was half-success < 1118175979 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :yeah < 1118175984 0 :sp3tt!unknown@unknown.invalid PRIVMSG #esoteric :If your hostmask isn't faked. < 1118175998 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :like when we were at ~30 km we were all wet because of rain < 1118175999 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :and cold < 1118176004 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :so we decided to turn < 1118176013 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :and did so, and got home ~1.30 am < 1118176031 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :and then we decided to use car instead and got to our target ~4.20 am < 1118176033 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric ::) < 1118176037 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :oh < 1118176049 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :but there was good 60 kms.. < 1118176057 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :(that almost finished me) < 1118176108 0 :sp3tt!unknown@unknown.invalid PRIVMSG #esoteric :Good night all. < 1118176114 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :'nite < 1118176132 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :sp3tt: nite, I'll comment about my impression later < 1118176153 0 :sp3tt!unknown@unknown.invalid PRIVMSG #esoteric :Ok, it isn't finished though. < 1118176169 0 :sp3tt!unknown@unknown.invalid PRIVMSG #esoteric :The interpreter can only print stuff so far >.< < 1118176200 0 :sp3tt!unknown@unknown.invalid PRIVMSG #esoteric :http://rename.noll8.nu/sp3tt/mathlang.py < 1118176223 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :k < 1118176586 0 :graue!unknown@unknown.invalid QUIT :"Leaving" < 1118177278 0 :sp3tt!unknown@unknown.invalid QUIT :Read error: 110 (Connection timed out) < 1118177830 0 :wooby!~wooby@cpe-065-191-186-247.nc.res.rr.com JOIN :#esoteric < 1118178105 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :YEAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA < 1118178109 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :found the bug.. < 1118178215 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :Heh, I know that feeling. < 1118178222 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric ::) < 1118178226 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :it'll be soon up < 1118178230 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :wait ~10 mins < 1118178937 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :rghh < 1118178941 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :small bug < 1118178953 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :takes a bit time more.. < 1118179504 0 :cmeme!unknown@unknown.invalid QUIT :Connection timed out < 1118179583 0 :cmeme!~cmeme@216.184.11.2 JOIN :#esoteric < 1118179808 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric ::( < 1118179815 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :still some bug < 1118179830 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :rggggggghhhhhh < 1118179846 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :ACTION dives into program < 1118179890 0 :fizzie!unknown@unknown.invalid PRIVMSG #esoteric :Remember to check for underwater obstructions before diving. < 1118179898 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric ::) < 1118181028 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :bug fixxed < 1118181043 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :i'm almost done, hopefully, this time :) < 1118181282 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :with that polyglot quine thingy? < 1118181368 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :w00000000000000000t! < 1118181371 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :done done done done hahahahaha < 1118181372 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric ::) < 1118181384 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :i'll update bf-hacks.org now < 1118181870 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :here it is: < 1118181871 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :http://www.bf-hacks.org/hacks/pgq.b < 1118181886 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :as it says on the page, i'll try to make it shorter sometime and add more languages < 1118181943 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :as it says on the page as well, it's made with simple technique < 1118181944 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :WOw, that's crazy. DId you generate that somehow or is it by hand? < 1118181962 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :the other part is made by hand < 1118181963 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :but not the < 1118181966 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :data that has < 1118181972 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :d[i]=0x...... < 1118181990 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :i made a program that converts input to that form < 1118182013 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :Well, congrats. < 1118182013 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric ::) < 1118182016 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :cheers < 1118182032 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :the bugs i had were something annoying stuff that i just didn't notice < 1118182053 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :like that there was one cell increased by two in brainfuck version and i didn't notice that < 1118182066 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :and other stupid stuff.. < 1118182069 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric ::) < 1118182120 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :while i was away i got some idea for an esoteric programming language < 1118182142 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :i'll try think more about it now < 1118182570 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :m < 1118182571 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :hm < 1118182584 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :so i just made an esoteric language < 1118182592 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :what kind of? < 1118182598 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :not sure < 1118182601 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :ok < 1118182602 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :factorial: < 1118182602 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :tell more < 1118182603 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :5(>(1-)#1-) < 1118182603 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :1 # >+ ! < 1118182603 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric : > < 1118182628 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :hmm < 1118182637 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :how does it work? < 1118182716 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :first 9 fibonacci numbers: < 1118182717 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :9(< #1-) < 1118182718 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :1 !#< < 1118182718 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :1 < + < 1118182748 0 :graue!~graue@ip68-100-130-21.dc.dc.cox.net JOIN :#esoteric < 1118182754 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :hey graue < 1118182758 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :hey < 1118182766 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :check out my factorial program :) < 1118182777 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :5(>(1-)#1-) < 1118182777 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :1 # >+ ! < 1118182777 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric : > < 1118182783 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :the idea is this: < 1118182795 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :each line controls a separate stack < 1118182821 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :instructions < and > access data from neighDbouring stacks < 1118182831 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :neighbouring < 1118182841 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :that sounds clever :) < 1118182862 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :i'm not sure how fun it actually is < 1118182877 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :the idea is to use this as a base for a language built on music notation < 1118182879 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :so the stacks run in parallel? < 1118182892 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :yeah < 1118182908 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :< gets data from the stack above (with wraparound) < 1118182916 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :> gets data from the stack below (with wraparound) < 1118182918 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :this: < 1118182920 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :< < 1118182920 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :> < 1118182943 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :will add to both stacks the top value on the other swap < 1118182944 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :err < 1118182946 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :*other stack < 1118182958 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :oh cool < 1118182960 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :i.e. they're executed "simultaneously" < 1118182998 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :nothing gets popped though. And maybe i should change that. < 1118183095 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :maybe so < 1118183112 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :as it is, i'm not even sure how to swap top values < 1118183142 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :(without the use of a third stack) < 1118183244 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :even with the third stack it's not trivial :( < 1118183283 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :with the use of the third stack, swapping values in the first two: < 1118183286 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric : #< < 1118183288 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :#< < 1118183289 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :< < 1118183344 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :where # means drop < 1118183359 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :in music notation, < is a rising third < 1118183383 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :and # is unison < 1118183504 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :http://z3.ca/~lament/prelude.txt < 1118183506 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :http://z3.ca/~lament/prelude.py < 1118183628 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :note that it's practically trivial to compile Brainfuck to Prelude < 1118183640 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :you need two voices < 1118183649 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :[ becomes ( in the first voice < 1118183653 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :] becomes ) < 1118183665 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :+ becomes 1+ < 1118183669 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :- becomes 1- < 1118183707 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :< becomes < 1118183709 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :# < 1118183709 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :< < 1118183726 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :> becomes < 1118183727 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :> < 1118183728 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :# < 1118183747 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :, becomes ? and . becomes ! < 1118183811 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :that's not good < 1118183824 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :if it's trivial to compile brainfuck to it, no one will write in it; they'll just write in brainfuck < 1118183836 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :but Prelude is a lot easier to write in < 1118183852 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :because you're not limited to two stacks < 1118183862 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :oh, okay then < 1118183864 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :three seems like a good number < 1118183868 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :for general use < 1118183876 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :but you can have as many as you wish < 1118183886 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :brainfuck is trivial to compile to C as well < 1118184180 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :lament: shouldn't "- pop two values, add them and subtract." be "- pop two values, subtract them and push." ? < 1118184207 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :hahahaha < 1118184210 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :yes < 1118184237 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :when you say "# drop last value", you mean the top of the stack, right? < 1118184240 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :sorry, i wrote the spec in like 15 minutes and didn't enjoy it at all < 1118184243 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :yes < 1118184272 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :yeah. writing specs is not too much fun.. < 1118184278 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :indeed < 1118184280 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :also "voice above" and "voice below" is "with wraparound < 1118184290 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :so if you have only two voices, < and > do the same thing < 1118184304 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :interesting language :) < 1118184317 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :and three is a convenient number of voices because each one can access both others < 1118184318 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :Keymaker: nice polyglot quine! < 1118184335 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :cheers :) < 1118184388 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :actually i'll probably change < and > to ^ and v < 1118184398 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :i like < and > < 1118184406 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :^ and v make much more sense < 1118184412 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :yes < 1118184416 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :they look uglier < 1118184421 0 :ChanServ!unknown@unknown.invalid QUIT :ACK! SIGSEGV! < 1118184437 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :i was just vary of using v because i was contemplating string literals < 1118184444 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :but screw that < 1118184475 0 :ChanServ!ChanServ@services. JOIN :#esoteric < 1118184475 0 :irc.freenode.net!unknown@unknown.invalid MODE #esoteric :+o ChanServ < 1118184488 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :how about: ^ or < and v or > < 1118184521 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :nah. stick to one of them < 1118184532 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :okay. ^ and v then < 1118184575 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :ACTION changes the spec and the interpreter < 1118184639 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric : does the ^ and v alter the stack above/below ,or just peek at it? < 1118184717 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :just peek < 1118184729 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :im not sure which way would be better < 1118184741 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :but i think just peeking encourages more cooperation between the voices < 1118184750 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :i.e. the other voice has to drop the value if it needs to < 1118184811 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :Keymaker: wow, a pretty nice quine! < 1118184830 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :thanks < 1118184853 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :tried it in both langs, it wrocks! :) < 1118184876 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :hehe < 1118185214 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :umm, the spec says "! output a character", but it outputs it as a number < 1118185258 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :yeah < 1118185276 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :change NUMERIC_INPUT to False in the interpreter < 1118185284 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :it's uhhh... for debugging purposes :) < 1118185303 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :maybe you should just add another operator.... < 1118185308 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :maybe it'll have both numeric and non-numeric < 1118185322 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :but then one of them would have to correspond to a seventh < 1118185326 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :and that's a bigass interval < 1118185339 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :huh? you lost me there.... < 1118185361 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :the main point of Prelude is to be a text representation of Fugue < 1118185377 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :which is the same language, but using music as source code < 1118185389 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :with different intervals corresponding to different instructions < 1118185394 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :that's why voices are called voices < 1118185431 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :(i doubt it makes much sense to actually implement Fugue) < 1118185467 0 :fizzie!unknown@unknown.invalid PRIVMSG #esoteric :"That sounds nice." (Gahh, what a horrible 'pun'.) < 1118185505 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :ahh < 1118185508 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :stop the punishment < 1118185953 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :nice language :) just made a hello world < 1118186048 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :time for 99 bottles of beeer! :) < 1118186067 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :kipple: show :) < 1118186083 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :keymaker: I thought it was quines that was your thing... :) < 1118186092 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :or digital roots < 1118186123 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :lament: well, actually it's only Hello (I cheated) < 1118186134 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :99999999+++++++H9992++++e7+l l3+o < 1118186134 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric : v! v! v!v! v! < 1118186152 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :hmm. that didn't look good in my client < 1118186218 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :looks fine here < 1118186234 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric ::) < 1118186244 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :i'm sure it could be more compact though :) < 1118186256 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :yeah < 1118186267 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :i should try to look at this programming language.. < 1118186277 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :Keymaker: and make a quine < 1118186279 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric ::) < 1118186303 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric ::) < 1118186384 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :kipple: maybe i should add string mode after all? < 1118186407 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :ok < 1118186423 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :then maybe I'll wait until you've decided until I try to do 99bob ;) < 1118186428 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :haha < 1118186458 0 :fizzie!unknown@unknown.invalid PRIVMSG #esoteric :Good old fibonacci: < 1118186458 0 :fizzie!unknown@unknown.invalid PRIVMSG #esoteric :1(v+ < 1118186458 0 :fizzie!unknown@unknown.invalid PRIVMSG #esoteric :1 !v v) < 1118186464 0 :fizzie!unknown@unknown.invalid PRIVMSG #esoteric :Gah, my paste botched. < 1118186466 0 :fizzie!unknown@unknown.invalid PRIVMSG #esoteric :Let's try that again < 1118186470 0 :fizzie!unknown@unknown.invalid PRIVMSG #esoteric :1(v+ < 1118186474 0 :fizzie!unknown@unknown.invalid PRIVMSG #esoteric :1 !v < 1118186476 0 :fizzie!unknown@unknown.invalid PRIVMSG #esoteric : v) < 1118186490 0 :fizzie!unknown@unknown.invalid PRIVMSG #esoteric :Using the "numeric output" thing. < 1118186530 0 :fizzie!unknown@unknown.invalid PRIVMSG #esoteric :It's iterative. I usually do recursive, but that'd be too non-trivial. < 1118186542 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :oooh < 1118186554 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :dense :) < 1118186592 0 :fizzie!unknown@unknown.invalid PRIVMSG #esoteric :For a fibonacci, it's pretty small indeed. < 1118186604 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :the bottom stack keeps growing? < 1118186611 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :is the file extension .p ? < 1118186619 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :i'm sure .p is used < 1118186624 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :ok < 1118186624 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :by thousands of different languages < 1118186628 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :I used .pre < 1118186628 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :'doh < 1118186631 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :ok < 1118186631 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :i had .pre < 1118186637 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric ::) < 1118186671 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :so it seems like most programs would either have to be bloated with # instructions < 1118186680 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :or have huge memory leaks < 1118186684 0 :fizzie!unknown@unknown.invalid PRIVMSG #esoteric :I used .prel :p < 1118186711 0 :fizzie!unknown@unknown.invalid PRIVMSG #esoteric :And yes, it has a huge memory leak. What more do you expect from a 4x3 block of code. :p < 1118186711 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :oh well... huge memory leaks it is :) < 1118186767 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :implement gc < 1118186816 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :most modern languages do :) < 1118186818 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :hm, how would that work < 1118186834 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :it wouldn't, as it is not a real memory leak < 1118186845 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :yeah :) < 1118186851 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :I was just kidding anyway < 1118186851 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :the data is on the stack, and could still be used by the program < 1118186866 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :kipple: unless somebody writes an extremely smart compiler < 1118186869 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :i can't get kipple's hello working :(/ < 1118186880 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :Keymaker: change to non-numeric output < 1118186885 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :how < 1118186890 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :edit the interpreter < 1118186909 0 :fizzie!unknown@unknown.invalid PRIVMSG #esoteric :Merf, that prelude fib is denser than the simple befunge fib: < 1118186911 0 :fizzie!unknown@unknown.invalid PRIVMSG #esoteric :100p1>00g\:0v < 1118186913 0 :fizzie!unknown@unknown.invalid PRIVMSG #esoteric : ^ .:+p0< < 1118186941 0 :fizzie!unknown@unknown.invalid PRIVMSG #esoteric :Two stacks really make a difference. :p < 1118186953 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :three < 1118186974 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :but that befunge fib only prints the first 100, right? that's different < 1118186985 0 :fizzie!unknown@unknown.invalid PRIVMSG #esoteric :Uh, no, it loops indefinitely. < 1118187001 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :ah, of course < 1118187038 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :I just saw the number 100, and forgot all about befunge :) < 1118187043 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :haha < 1118187070 0 :fizzie!unknown@unknown.invalid PRIVMSG #esoteric :Although (with most interpreters) it has problems when the number goes >255, since the playfield cell is only one byte. < 1118187084 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :hm < 1118187090 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :i never specified the data type size < 1118187099 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :the interpreter uses bignums < 1118187110 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :i like bignums though < 1118187115 0 :fizzie!unknown@unknown.invalid PRIVMSG #esoteric :I noticed. It's nice for scientific purposes. < 1118187338 0 :fizzie!unknown@unknown.invalid PRIVMSG #esoteric :Usually I've written a befunge interpreter after fib, but I think I'll skip that for now. < 1118187344 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :aww < 1118187369 0 :fizzie!unknown@unknown.invalid PRIVMSG #esoteric :If it had functions, maybe. :p < 1118187387 0 :fizzie!unknown@unknown.invalid PRIVMSG #esoteric :Besides, it's 0140am again and I need to be at work "tomorrow"-morning again. < 1118187391 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :brainfuck should be easy to interpret < 1118187401 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :i don't get this working < 1118187403 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :two stacks for the program, two more for memory < 1118187447 0 :fizzie!unknown@unknown.invalid PRIVMSG #esoteric :A prelude->midi converter would be nice, too. < 1118187476 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :well no < 1118187481 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :Fugue would also have note durations < 1118187493 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :and some choice as to which exact interval you use < 1118187517 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :prelude lacks that information < 1118187546 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :it could be converted into Fugue but the result certainly wouldn't sound good. < 1118187559 0 :wooby!unknown@unknown.invalid PRIVMSG #esoteric :heh, also cool would be some kind of midi parser... where a midi is the program < 1118187569 0 :wooby!unknown@unknown.invalid PRIVMSG #esoteric :so you could program in cakewalk :) < 1118187587 0 :fizzie!unknown@unknown.invalid PRIVMSG #esoteric :Or program with a musical instrument. < 1118187721 0 :wooby!unknown@unknown.invalid PRIVMSG #esoteric :or maybe a program that applies arbitrary "operators" to a piped-in mp3 or wav, and adjusts the rules until it spits out "Hello World" < 1118188586 0 :fizzie!unknown@unknown.invalid PRIVMSG #esoteric :Do the 'lines' (physical-lines-of-source, not logical-lines-of-code) for voices need to be equally long? < 1118188678 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :no < 1118188692 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :they're padded with whitespace at the end to make them of equal length < 1118188727 0 :fizzie!unknown@unknown.invalid PRIVMSG #esoteric :'k. < 1118188735 0 :fizzie!unknown@unknown.invalid PRIVMSG #esoteric :(Started to write the befunge interpreter after all.) < 1118188749 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :oh god :) < 1118188769 0 :fizzie!unknown@unknown.invalid PRIVMSG #esoteric :I probably won't finish this, much as I didn't finish the sed befunge interpreter. :p < 1118188921 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :dang. I was so convinced there was a bug in the interpreter < 1118188935 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :then I realized I had just confused ^ and v .... < 1118188975 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :that seemed more intuitive to me :) < 1118189067 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :^ and v are "get from", not "put in" < 1118189071 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :if that's what you mean. < 1118189085 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :yeah < 1118189098 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :I was thinking it indicated the direction the value travels < 1118189184 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :but there's probably a bunch of bugs in the interpreter anyway < 1118189418 0 :fizzie!unknown@unknown.invalid PRIVMSG #esoteric :Heh, this will be very much non-dense, this befunge thing. < 1118189451 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :how many voices? < 1118189483 0 :fizzie!unknown@unknown.invalid PRIVMSG #esoteric :Let's just say "lots". < 1118189508 0 :fizzie!unknown@unknown.invalid PRIVMSG #esoteric :At least 11. :p < 1118189529 0 :fizzie!unknown@unknown.invalid PRIVMSG #esoteric :(I probably won't need more, though.) < 1118189541 0 :fizzie!unknown@unknown.invalid PRIVMSG #esoteric :(Well, maybe a few.) < 1118189578 0 :fizzie!unknown@unknown.invalid PRIVMSG #esoteric :Most of the time a lot of them will be silent. < 1118189831 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :cellular automata are cool < 1118189845 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :like, really cool < 1118189848 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :fizzie: you could always put a bunch of collectively-nop operations < 1118189848 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :super cool < 1118189899 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :fizzie: which in Fugue would be something like "push number/pop" < 1118189926 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :(push number - a second. then any interval, corresponding to the actual number. Then pop - a unison) < 1118189966 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :then again, voices that are silent most of the time could be assigned particularly ominous instruments < 1118189985 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :like bells or whatever :) < 1118190111 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :kinda neat when your program requires a symphonic orchestra to perform. < 1118190389 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :a python question; < 1118190404 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :is there any way to count the amount of cells/whaterver there is in list? < 1118190799 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :len(list) < 1118190825 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :thanks < 1118190901 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :mmm python < 1118190975 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric ::) < 1118191006 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :I get paid to code in Python all day and it makes me very happy. < 1118191013 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :oooh < 1118191015 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :awesome < 1118191023 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :yes < 1118191420 0 :fizzie!unknown@unknown.invalid PRIVMSG #esoteric :Whee, my befunge program "12345@" prints out (a stack dump, at the end of the interpreter) 5, 4, 5, 1 and exits. :) :) < 1118191480 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :from a review of a topology textbook: "The beginner may be troubled as to the way connectedness is defined, since it is defined as the negation of disconnectedness" < 1118191483 0 :fizzie!unknown@unknown.invalid PRIVMSG #esoteric :With 13 voices. http://www.befunge.org/~fis/bef.prel if you want to see it, but it's very much work-in-progress (only supports > direction at-the-moment, no _| or anything). < 1118191558 0 :fizzie!unknown@unknown.invalid PRIVMSG #esoteric :Uh, "123+45@" was the program, I mean. < 1118191595 0 :fizzie!unknown@unknown.invalid PRIVMSG #esoteric :Oh, and the program input only reads 2000 bytes and assumes they form a 80x25 grid, and wrapping is not supported. :p < 1118191621 0 :fizzie!unknown@unknown.invalid PRIVMSG #esoteric :I used perl -e 'print "123+45@", " " x 7999;' > test.bef to create the input. < 1118191659 0 :fizzie!unknown@unknown.invalid PRIVMSG #esoteric :I'll improve it to read actual lines when I have some Free Time (tm). < 1118191940 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric ::) < 1118191952 0 :fizzie!unknown@unknown.invalid PRIVMSG #esoteric :The topmost three voices select which parts of code to run, based on the current-command on the stack of the third voice, voices 4 and 5 contain the playfield, voices 6 and 8 are quite temporary, voices 7 and 9 hold the current IP and delta, voice 10 contains a '1' to drive the main loop (or 0 after a '@'), voice 11 has the befunge stack and voices 12 and 13 are temporary. < 1118192035 0 :fizzie!unknown@unknown.invalid PRIVMSG #esoteric :It seems I've implemented only the befunge commands #, $, *, +, -, [0-9] and @. Will do the rest later. < 1118192044 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :ok < 1118192064 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :by the way; any way to print a character in python so that it would not make new line as well? < 1118192105 0 :fizzie!unknown@unknown.invalid PRIVMSG #esoteric :putch() perhaps. < 1118192123 0 :fizzie!unknown@unknown.invalid PRIVMSG #esoteric :(Disclaimer: I don't do python.) < 1118192162 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :i'll try < 1118192190 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :didn't like it < 1118192192 0 :fizzie!unknown@unknown.invalid PRIVMSG #esoteric :Seems that ending a 'print' statement with a , (comma) would also work. < 1118192208 0 :fizzie!unknown@unknown.invalid PRIVMSG #esoteric :"A "\n" character is written at the end, unless the print statement ends with a comma. This is the only action if the statement contains just the keyword print." < 1118192242 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :also sys.stdout.write() < 1118192288 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :now this works < 1118194627 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :is INTERCAL a Turing tarpit? < 1118194649 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :is Befunge a Turing tarpit? < 1118194707 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :Turing tarpit? < 1118194737 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :befunge? I would say no. way too many unnessecary instructions < 1118194812 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :I don't think INTERCAL qualifies either. < 1118194863 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :malaprop: http://esoteric.voxelperfect.net/wiki/Turing_tarpit < 1118194894 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :I think Befunge is just for fun. < 1118194943 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :*sigh* when will I ever learn to spell necessary.... :( < 1118195262 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :me goes sleep < 1118195264 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :me tired < 1118195272 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :clock 3:51 am < 1118195277 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :me too < 1118195280 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :good nite :) < 1118195283 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :nite < 1118195286 0 :Keymaker!unknown@unknown.invalid PART #esoteric :? < 1118195362 0 :wooby!unknown@unknown.invalid QUIT : < 1118198232 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :My new language: #esolang < 1118198241 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :Here, let me test it. < 1118198254 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :somebody.write("Hello, World!\n"); < 1118198258 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :(it may take a while to go) < 1118198267 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :Hello, World! < 1118198271 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :GregorR: this channel is #esoteric < 1118198285 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :it worked! < 1118198298 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :GregorR: I think you're going to have trouble with recursion. < 1118198320 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :And if you write a working 99 bottles program, we'll have to kickban you. < 1118198635 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :lament: The name is a conjunction of #esoteric and lang :P < 1118198725 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :for every i from 99 down to 2: somebody.write(i + " bottles of beer on the wall, " + i + " bottles of beer!\nTake one down, and pass it around, " + (i - 1) + " bottles of beer on the wall!\n"; < 1118198735 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric ::P < 1118198741 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :Oh, forgot the ) at the end < 1118198745 0 :graue!unknown@unknown.invalid QUIT :Read error: 60 (Operation timed out) < 1118198745 0 :kipple!unknown@unknown.invalid QUIT :Operation timed out < 1118198777 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :GregorR: Hm, you expect us to be dynamically typed and just convert i from int to str for you? That's kinda presumptuous. < 1118198783 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :XD < 1118199053 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :PLUS, it's nondeterministic! < 1118203889 0 :graue!~graue@ip68-100-130-21.dc.dc.cox.net JOIN :#esoteric < 1118205379 0 :malaprop!unknown@unknown.invalid QUIT :"sleep" < 1118207118 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :graue: hey < 1118207124 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :so will you change the logo? < 1118208159 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :did you make a new one? < 1118208262 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :no < 1118208293 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :then i have nothing to change it to < 1118208324 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :the Piet fibonacci numbers program < 1118208337 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :http://www.dangermouse.net/esoteric/fibbig.gif < 1118208365 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :did the author agree to PD-ize that? < 1118208367 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :yes < 1118208369 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :oh < 1118208373 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :i missed that detail < 1118208374 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :okay then < 1118208380 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :he replied to my email, and also came here < 1118208410 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :wait, isn't that the program that has a bug? < 1118208445 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :http://www.bertnase.de/npiet/picture.html < 1118208492 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :do you know perl? < 1118208551 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :a bit < 1118208587 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :then perhaps you can get the original interpreter to run and check if it has a bug or not :) < 1118208634 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :i don't know that much perl :) < 1118208638 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :i.e. this is most likely not a bug but a discrepancy between npiet and original piet < 1118208763 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :well, "original piet" was implemented in perl by Marc Majcher, who is not the author of the fibonacci program < 1118208853 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :it would be weird for it to have a bug < 1118208866 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :there's a fairly detailed explanation of the program on http://www.dangermouse.net/esoteric/piet.html < 1118208873 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :with a trace < 1118208910 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :npiet trace is here: http://www.bertnase.de/npiet/fib-trace-big.png < 1118208980 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :i know < 1118209582 0 :wooby!~wooby@cpe-065-191-186-247.nc.res.rr.com JOIN :#esoteric < 1118209707 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :i rather like kipple's spoofs, especially the last two < 1118210559 0 :wooby!unknown@unknown.invalid QUIT : < 1118210789 0 :graue!unknown@unknown.invalid QUIT :"Leaving" < 1118217390 0 :sp3tt!~chatzilla@cust-148-133.elhandel.umeaenergi.se JOIN :#esoteric < 1118217599 0 :clog!unknown@unknown.invalid QUIT :ended < 1118217600 0 :clog!unknown@unknown.invalid JOIN :#esoteric < 1118220765 0 :Keymaker!~a@wire74.adsl.netsonic.fi JOIN :#esoteric < 1118220898 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :i'm 18 now. today is my birthday < 1118221113 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :congratulations < 1118221532 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :http://www.efnet-math.org/Meta/sine1.htm < 1118221634 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :cheers < 1118223300 0 :Keymaker!unknown@unknown.invalid PART #esoteric :? < 1118229254 0 :pgimeno_!pgimeno@124.Red-80-59-211.pooles.rima-tde.net JOIN :#esoteric < 1118229255 0 :pgimeno!unknown@unknown.invalid QUIT :Read error: 131 (Connection reset by peer) < 1118230864 0 :kipple!~kipple@163.80-202-100.nextgentel.com JOIN :#esoteric < 1118233522 0 :sp3tt_!~chatzilla@lite-148-133.umenet.net JOIN :#esoteric < 1118233975 0 :sp3tt!unknown@unknown.invalid QUIT :Read error: 145 (Connection timed out) < 1118238828 0 :malaprop!~ph@ppp-68-251-59-237.dsl.chcgil.ameritech.net JOIN :#esoteric < 1118239208 0 :sp3tt_!unknown@unknown.invalid NICK :sp3tt < 1118242640 0 :sp3tt_!~chatzilla@lite-148-133.umenet.net JOIN :#esoteric < 1118243133 0 :sp3tt!unknown@unknown.invalid QUIT :Read error: 60 (Operation timed out) < 1118246798 0 :Keymaker!~Not@wire74.adsl.netsonic.fi JOIN :#esoteric < 1118246844 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :hm < 1118248479 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :ACTION leaves < 1118248484 0 :Keymaker!unknown@unknown.invalid QUIT :"Freedom!" < 1118250163 0 :cmeme!unknown@unknown.invalid QUIT :Connection reset by peer < 1118250181 0 :cmeme!~cmeme@216.184.11.2 JOIN :#esoteric < 1118256630 0 :cmeme!unknown@unknown.invalid QUIT :Read error: 131 (Connection reset by peer) < 1118256751 0 :cmeme!~cmeme@216.184.11.2 JOIN :#esoteric < 1118256767 0 :cmeme!unknown@unknown.invalid QUIT :Remote closed the connection < 1118256812 0 :cmeme!~cmeme@216.184.11.2 JOIN :#esoteric < 1118256939 0 :cmeme!unknown@unknown.invalid QUIT :Remote closed the connection < 1118257010 0 :cmeme!~cmeme@216.184.11.2 JOIN :#esoteric < 1118257013 0 :cmeme!unknown@unknown.invalid QUIT :Remote closed the connection < 1118257056 0 :cmeme!~cmeme@216.184.11.2 JOIN :#esoteric < 1118258307 0 :pgimeno_!unknown@unknown.invalid NICK :pgimeno < 1118259419 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :Keymaker: happy birthday! < 1118259470 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :he's not here ... < 1118259530 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :I'm hopefully talking to him via the log < 1118259553 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :he uses to read it < 1118261255 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :lament: very interesting the sin(1deg) expansion, I already knew a different sin(3deg) one (plus I've just found one without any imaginary part) < 1118261390 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :(actually muMATH found it but anyway) ;) < 1118261695 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :SIN(#PI/180) == -3/4/(-27/8 (4 - (7 + 6^(1/2) (5 + 5^(1/2))^(1/2) + 5^(1/2))^(1/2))^(1/2)/2^(3/2) + (2187/32 - 729/128 (7 + 6^(1/2) (5 + 5^(1/2))^(1/2) + 5^(1/2))^(1/2))^(1/2)/2)^(1/3) + (-27/8 (4 - (7 + 6^(1/2) (5 + 5^(1/2))^(1/2) + 5^(1/2))^(1/2))^(1/2)/2^(3/2) + (2187/32 - 729/128 (7 + 6^(1/2) (5 + 5^(1/2))^(1/2) + 5^(1/2))^(1/2))^(1/2)/2)^(1/3)/3 < 1118261715 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric ::) < 1118263295 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :not much interest in #math apparently < 1118265695 0 :sp3tt_!unknown@unknown.invalid QUIT :"Chatzilla 0.9.68a [Firefox 1.0.4/20050511]" < 1118266050 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :there are so many new esolangs these days, it's hard to keep up... < 1118266070 0 :Keymaker!~a@wire74.adsl.netsonic.fi JOIN :#esoteric < 1118266077 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :hello < 1118266080 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :thanks pgimeno :) < 1118266087 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :happy birthday :) < 1118266094 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :cheers < 1118266098 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric ::) < 1118266160 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :i was making a new language today < 1118266165 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :in spain you reach independency from parents at 18, don't know in your country < 1118266170 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :really? < 1118266174 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :yes < 1118266179 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :(and same here in finland) < 1118266186 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :but < 1118266186 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :same here < 1118266188 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric ::) < 1118266195 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :i'm not sure does it work < 1118266198 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :i mean the method < 1118266204 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :i must investigate it more < 1118266224 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :what is it like? < 1118266240 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :categories? ;) < 1118266242 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :all stuff isn't clear, here is something :) < 1118266247 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :wait, i'll type < 1118266345 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :i'll probably call the language "snack", that is, because the interpreter eats the source code. execution of program will be finished when the whole code is removed/eaten. :) the interpreter i've been working on is made with python because it seems to be really cool and fun language. anyways, i'm not sure will this method work: < 1118266351 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :(wait more, typing..) < 1118266447 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :like when the program is started, the whole program code is stored into memory. when the code is executed, '#' sets toggle to 1 or 0, depending its value (in the beginning it's always 0). '?' instruction, executed if toggle is 1, will place the entire programs source to that place < 1118266484 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :when the program is loaded, it will be put on stack, and when reading instructions they are popped from it (and that way removed) < 1118266532 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :anyways; this piece of code #?# (when got to '?') would result the program be ##?# at that point < 1118266555 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :i'm not sure what to make the other instructions be, or anything.. not sure if this will work. < 1118266557 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric ::) < 1118266615 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :so program execution is from right to left? < 1118266660 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :yes < 1118266690 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :imagine it as stack, filled with program source from left to right < 1118266706 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :(i'll be back in 5 mins, eat something!) < 1118266709 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :hum, not much instructions to do anything I guess < 1118266713 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :k < 1118267147 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :yes < 1118267162 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :that is problem :p < 1118267174 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :i haven't planned any < 1118267179 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :i know it would need more < 1118267233 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :another idea was to make language that would let user switch between program memory and memory memory :) < 1118267243 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :that was user could do self modifying code < 1118267253 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :and so on < 1118267294 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :that would probably not-delete the instructions after executing them < 1118267297 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :dunno < 1118267390 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :about python; anyone know how i can make 2d arrays? < 1118267423 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :hum < 1118267449 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :re instructions: I can't help you with that < 1118267457 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :that's ok < 1118267463 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :[[1, 2, 3], [2, 4, 9]] < 1118267473 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :thanks < 1118267479 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :how do i use them? < 1118267491 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :like for example access some x,y? < 1118267503 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :[[1, 2, 3], [2, 4, 9]][1][2] < 1118267528 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :lists are 0-based, btw. < 1118267535 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :? < 1118267538 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :what that means? < 1118267553 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :first element in a list is accessed with [0], not [1] < 1118267559 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :yeah < 1118267564 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :that i knew < 1118267576 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :1-based would be confusing < 1118267635 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :0-based vs. 1-based is an arbitrary decision in a language without pointers < 1118267747 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :I planned to implement a trick for my malbolge interpreter, then I went for straight list and now that the malbolge programs are growing I'm regretting it < 1118267749 0 :fizzie!unknown@unknown.invalid PRIVMSG #esoteric :"0-based is more natural: I mean, who's ever heard of anyone who'd start counting from 1?" < 1118267780 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric ::) < 1118267994 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :rgh.. can't get this working.. < 1118268006 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :data = [[],[]] < 1118268006 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :data[[8],[5]]=33 < 1118268006 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :print data[[8],[5]] < 1118268018 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :what i'm doing wrong? < 1118268047 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :In Python a list doesn't have an element [8] without also elements [0-7] < 1118268068 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :Perhaps what you want is a dictionary indexed by tuple. < 1118268090 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :like for example i would like 2d array like: < 1118268109 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :int stuff[500][500]; in c < 1118268144 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :Do: data = {}; data[(8, 4)] = 33; < 1118268147 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :that'll work as you want < 1118268222 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :yes! < 1118268225 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :exactly < 1118268227 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :thanks < 1118268319 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :Remember, in Python everything is an object. Tuples are immutable objects, and dictionaries can be indexed by any immutable object, whether that's an int or a tuple. < 1118268540 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :btw, my trick was to use a tuple of 1-element lists so that the content of the tuple was changeable but random access was quick < 1118268613 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :pgimeno: dictionary access is constant time. < 1118268644 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :yeah but it needs hashing which is not so fast as indexed access < 1118268696 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :Ya, but it's not a weird use of a dict. :) What were you writing that was so time-sensitive? < 1118268714 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :a malbolge interpreter :) < 1118268750 0 :fizzie!unknown@unknown.invalid PRIVMSG #esoteric :Everything is time-insensitive when the amount of operations goes past few millions or so. < 1118268762 0 :fizzie!unknown@unknown.invalid PRIVMSG #esoteric :s/in// < 1118268780 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :Ya, I figured he was either doing something fast or big, was just curious. < 1118268788 0 :fizzie!unknown@unknown.invalid PRIVMSG #esoteric :s#in/#-in/-# < 1118268808 0 :fizzie!unknown@unknown.invalid PRIVMSG #esoteric :I sure hope I won't need to fix _that_ regexp too. < 1118268846 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :doh, now I get it :) < 1118268865 0 :fizzie!unknown@unknown.invalid PRIVMSG #esoteric :(That second one is supposed to be applied on the first.) < 1118268872 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :yah < 1118268927 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :I finally used a list but even the cat program is slow... list access seems to be O(n), not O(1) < 1118268942 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :Ya, list access is linear time. < 1118269010 0 :fizzie!unknown@unknown.invalid PRIVMSG #esoteric :Does that language have arrays? < 1118269023 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :there's an array package but I'm reluctant to using third party libraries if avoidable < 1118269028 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :Python does not, no. < 1118269044 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :Sets, tuples, lists, dictionaries. < 1118269068 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :there are, but it's a third party language extension < 1118269184 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :anyway this should work: stuff=ysize*(xsize*([0],),) < 1118269192 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :then stuff[y][x][0] is every element < 1118269293 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :I'm off, bye < 1118269313 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :bye < 1118269341 0 :calamari!~calamari@dialup-4.240.241.88.Dial1.Phoenix1.Level3.net JOIN :#esoteric < 1118269348 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :hi < 1118269352 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :hi < 1118269358 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :ACTION can get online again.. yay :) < 1118269368 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :hi malaprop < 1118269462 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :welcome online! :) < 1118269488 0 :fizzie!unknown@unknown.invalid PRIVMSG #esoteric :It's alive! (Read: welcome.) < 1118271046 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :this is strange. looks like the voxelperfect web server treats files differently based on whether or not they contain comments: http://esoteric.voxelperfect.net/files/kipple/src/ < 1118271085 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :some files (the ones including # comments) seem to be classified as text files, while the rest do not... < 1118271118 0 :fizzie!unknown@unknown.invalid PRIVMSG #esoteric :It could be some heuristic based on first line. < 1118271127 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :annoying < 1118271154 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric ::) < 1118271161 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :mmmh.. esoteric servers.. < 1118271321 0 :fizzie!unknown@unknown.invalid PRIVMSG #esoteric :Depending on the server you could possibly work around it. If it (is apache and has mod_cern_meta enabled || othewise supports cern httpd metadata thing), you can add a directory .web and there files foo.k.meta and Content-type: text/plain into the files. < 1118271372 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :well, i'm off to nature (read: night photographin') < 1118271373 0 :fizzie!unknown@unknown.invalid PRIVMSG #esoteric :And possibly adding a "DefaultType text/plain" to .htaccess of that directory could also work. < 1118271378 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric ::) bye < 1118271388 0 :Keymaker!unknown@unknown.invalid PART #esoteric :? < 1118271406 0 :fizzie!unknown@unknown.invalid PRIVMSG #esoteric :Bye, and I want a camera that doesn't have a stoopid 15-sec max limit of exposure time. < 1118271553 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :here is my latest contribution to insanity: http://esoteric.voxelperfect.net/wiki/BF_instruction_minimalization < 1118272167 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :latest EsoShell: http://lilly.csoft.net/~jeffryj/EsoShell < 1118272274 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :I'm pretty sure that'll be good enough to be called the real 1.00 < 1118272294 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :so if I need to change anything I'll update the version number from here on out :) < 1118272512 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :looks nice < 1118272743 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :kipple: thanks :) < 1118272787 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :do you have other languages planned? < 1118273034 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :btw, the brainfuck interpreter outputs numbers, not chars..... < 1118273115 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :ACTION tries it < 1118273152 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :indeed.. wonder how that happened :) < 1118273186 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :do you use System.out.print() with an int as argumen? < 1118273321 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :fixed < 1118273328 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :must have been debugging something at the time < 1118273348 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :I took the (char) cast off the print for some reason :) < 1118273452 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :I don't have any current plans to add new languages.. but anyone else is welcome to < 1118273471 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :The API is fairly straightforward < 1118273592 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :Basically, all you do to add a language is have your class extend "Program" and put the class file in the Programs directory. Well, I guess you'd also want to edit the help program so people know about it :) < 1118273642 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :Wish I knew a way to have Java automatically tell me the accessible files.. too many security restrctions < 1118273666 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :yeah, applets are very restricted (for good reasons, though!) < 1118273676 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :definitely < 1118273683 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :just frustrating sometimes < 1118273721 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :if the directory is browseable with HTTP you can get it that way < 1118273829 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :are you speaking in general, or would you happen to know which class I can use? < 1118273845 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :in general < 1118273969 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :Gaaah, stop talking!!! I can't keep up with the logs ;) < 1118275596 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :hi GregorR < 1118275618 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :lol.. autocomplete gave away my laziness :) < 1118278303 0 :calamari!unknown@unknown.invalid QUIT :brown.freenode.net irc.freenode.net < 1118278303 0 :cmeme!unknown@unknown.invalid QUIT :brown.freenode.net irc.freenode.net < 1118278306 0 :cpressey!unknown@unknown.invalid QUIT :brown.freenode.net irc.freenode.net < 1118278315 0 :cmeme!~cmeme@216.184.11.2 JOIN :#esoteric < 1118278566 0 :cpressey!nobody@d154-20-76-195.bchsia.telus.net JOIN :#esoteric < 1118278811 0 :calamari!~calamari@dialup-4.240.241.88.Dial1.Phoenix1.Level3.net JOIN :#esoteric < 1118281647 0 :heatsink!~heatsink@c-24-61-94-111.hsd1.nh.comcast.net JOIN :#esoteric < 1118284690 0 :calamari!unknown@unknown.invalid QUIT :Read error: 110 (Connection timed out) < 1118285796 0 :kipple!unknown@unknown.invalid QUIT :Read error: 110 (Connection timed out) < 1118293083 0 :heatsink!unknown@unknown.invalid QUIT :"Leaving" < 1118294950 0 :calamari!~calamari@dialup-4.240.69.102.Dial1.Phoenix1.Level3.net JOIN :#esoteric < 1118295179 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :hi < 1118295377 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :ACTION eats calamari. < 1118295381 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :Mmmmmmmmmmmmmmmmmmmmmmmmmmmm, squid. < 1118295394 0 :malaprop!unknown@unknown.invalid QUIT :"sleep" < 1118295650 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :brb < 1118296160 0 :calamari!unknown@unknown.invalid QUIT :Read error: 145 (Connection timed out) < 1118297300 0 :calamari!~calamari@dialup-4.240.114.76.Dial1.Phoenix1.Level3.net JOIN :#esoteric < 1118297308 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :re < 1118297331 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :hi < 1118297367 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :hi pgimeno, how's it going? :) < 1118297393 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :fine, except that a mosquito woke me up earlier than I wish < 1118297408 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :have you been away or something? < 1118297418 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :where do you live? no mosquitos in Tucson, AZ right now :) < 1118297425 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :Spain < 1118297451 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :pgimeno: yeah, I walked into the kitchen and the room was full of gas.. had to get off to call maintenance < 1118297473 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :yuck, sounds dangerous < 1118297507 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :yeah.. I'm not very familiar with gas stoves yet.. I've had electric all my life < 1118297554 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :I've tried esoshell but even 'help' fails to work... I don't know what happens < 1118297570 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :brb < 1118298076 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :pgimeno: yeah, that's weird.. < 1118298106 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :I wonder if I can write a Java 1.1 version of the applet... I should try it < 1118299229 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :cool, got a test button working in AWT.. now on the rest of the application :) < 1118299253 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :Ah, good ooooooooooooooool' AWT < 1118299330 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :especially the ooooooooool' part ;) < 1118299339 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :Hence the preponderance of 'o's ;) < 1118299430 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :this is java 1.4, for the record < 1118299466 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :I'm running Java pre-alpha 0.1, will it work for me? < 1118299638 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :hehe < 1118299661 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :SO, who wants to form the #esoteric chat room on DirectNet? 8-D < 1118300054 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :GregorR: are we moving? :) < 1118300068 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :No, I'm just trying to get users :'( < 1118300091 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :ACTION likes freenode < 1118300101 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :DirectNet isn't IRC :P < 1118300113 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :oh really? what is it? < 1118300122 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :It's DirectNet 8-D < 1118300125 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :heh < 1118300137 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :It's my instant messaging and chat system (shameless plug points +1) < 1118300834 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :ACTION goes to work < 1118301769 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :hmm it works.. kinda :) < 1118301821 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :ACTION attempts to remove a duplicate set of unwanted scrollbars < 1118302435 0 :lindi-!unknown@unknown.invalid PRIVMSG #esoteric :calamari: btw, a tricky keyevent bug has been fixed in gnu classpath and now esoshell can be used with it < 1118302456 0 :lindi-!unknown@unknown.invalid PRIVMSG #esoteric :there's still some repaint problem though, but it does not render it unusable < 1118302597 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :lindi-: cool! :) < 1118302622 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :I'm not quite sure that I < 1118302635 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :'ll be able to restrict the cursor w/ AWT.. but I'm trying < 1118302991 0 :lindi-!unknown@unknown.invalid PRIVMSG #esoteric :calamari: why AWT? < 1118303019 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :lindi-: the applet does not seem to work at all with IE.. I'm hoping now it will < 1118303030 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :I should try it :) < 1118303068 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :also, I want to try to get it working for pgimeno < 1118303091 0 :lindi-!unknown@unknown.invalid PRIVMSG #esoteric :pgimeno? < 1118303109 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :yeah < 1118303620 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :hmm, I don't get it.. still doesn't work in IE < 1118303999 0 :clog!unknown@unknown.invalid QUIT :ended < 1118304000 0 :clog!unknown@unknown.invalid JOIN :#esoteric < 1118304794 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :well, it's running in IE, kinda < 1118305266 0 :sp3tt!~chatzilla@lite-148-133.umenet.net JOIN :#esoteric < 1118305349 0 :lindi-!unknown@unknown.invalid PRIVMSG #esoteric :i have no idea what pgimeno is < 1118305482 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :lindi-: pgimeno is a guy that hangs out in here :) < 1118305491 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :me, concretely ;) < 1118305493 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :re < 1118305502 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :pgimeno: hi :) < 1118305510 0 :lindi-!unknown@unknown.invalid PRIVMSG #esoteric :calamari: ah :) < 1118305514 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :thanks for the effort, calamari < 1118305538 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :pgimeno: try this (I'm very curious) http://lilly.csoft.net/~jeffryj/EsoShell-AWT/ < 1118305560 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :It looks terrible and doesn't work right.. but maybe it'll load? < 1118305630 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :it does load indeed and it looks terrible indeed ;) < 1118305681 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :cool.. it's "working" in IE < 1118305691 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :you have to click where the cursor should be :) < 1118305890 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :StringBuffer didn't have a delete method until Java 1.2.. lol < 1118305928 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :I bet there are plenty of these little 1.2+ bugs hiding everywhere < 1118305976 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :I repeat that this is 1.4 < 1118306064 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :pgimeno: IE doesn't seem to like it unless it's 1.1 or below < 1118306076 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :ACTION tries < 1118306099 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :I mean the Java methods < 1118306109 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :maybe iut's the way I'm compiling it < 1118306155 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :hm, I see, IE does not load anything < 1118306175 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :really? works here (ie 6) < 1118306250 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :okay, now they work in reverse: EsoShell/ works in IE while EsoShell-AWT does not (IE 6.0.2600.0000.whatever, Java 1.4.2_06) < 1118306514 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :snapshot: http://www.formauri.es/personal/pgimeno/temp/esoshell.png < 1118306551 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :the truncation is there in the original < 1118306816 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :yeah thats the awt version.. I didn't bother fixing the size yet < 1118306837 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :k < 1118306904 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :what I'm trying to find out is whether I can actually run 1.2+ functions in IE.. I have Java1.4 installed so the answer should be yes < 1118306951 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :if so, then I can probably use the original Swing stuff < 1118307108 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :is bf supposed to work? < 1118307149 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :in the Swing version, yes < 1118307188 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :there are lots of awt bugs right now < 1118307232 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :"write once, run everywhere"... ha < 1118307649 0 :lindi-!unknown@unknown.invalid PRIVMSG #esoteric :pgimeno: sure, just use gnu classpath :) < 1118307907 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :I think I found my problem, at least.. it may be using Microsoft Java and not Sun < 1118307915 0 :sp3tt_!~chatzilla@lite-148-133.umenet.net JOIN :#esoteric < 1118307951 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :yay for qemu < 1118308207 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :lindi-: gcj must have come a long way since the last time I used it if it can run Swing apps now < 1118308407 0 :sp3tt!unknown@unknown.invalid QUIT :Read error: 145 (Connection timed out) < 1118310450 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :cool.. my Java install was broken.. even http://kidsquid.com/EsoShell works in IE6 now.. boy is Sun Java slow compared to the Microsoft JIT.. took about 10 minutes to load the applet in qemu < 1118310624 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :I guess MS preloads stuff to create the illusion that it loads faster < 1118310679 0 :fizzie!unknown@unknown.invalid PRIVMSG #esoteric :This box has Sun's jdk-1.5/5.0/whatever, and it loads in a ~second. < 1118310701 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :man, google maps is so awesome < 1118310707 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :pgimeno: or it's so old that it only can use java 1.1 ;) < 1118310732 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :fizzie: yeah, same with my linux machine.. it's only slow in the emulator < 1118310822 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :pgimeno: any idea how to add the applet to the wiki? < 1118310834 0 :fizzie!unknown@unknown.invalid PRIVMSG #esoteric :lament; it seems to lack this thing called Europe. < 1118310870 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :hmm, I'm not sure that's possible directly < 1118310878 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :yeah, but i'm in america < 1118310888 0 :lindi-!unknown@unknown.invalid PRIVMSG #esoteric :calamari: it has < 1118310895 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :but it's just so completely amazing < 1118310919 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :you can switch to satellite view and get from anywhere to anywhere by scrolling the thing < 1118310950 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :the quality gets very shitty outside populated areas though :( < 1118310995 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :calamari: try asking graue < 1118311078 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :Mt. St. Helens < 1118311079 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :http://maps.google.com/maps?ll=46.197510,-122.187195&spn=0.212173,0.276031&t=k&hl=en < 1118311091 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :for spain we have http://sigpac.mapa.es/fega/visor/ < 1118311188 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :oh man los angeles is fucking HUGE < 1118311225 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :pgimeno: oh that's right.. hafta beg to upload files, don't I? hehe < 1118311268 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :well, you can get svn write permissions but that's not a wiki page by itself < 1118311298 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :http://maps.google.com/maps?ll=46.197510,-122.187195&spn=0.212173,0.276031&t=k&hl=en < 1118311342 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :i mean < 1118311343 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :http://maps.google.com/maps?ll=51.208649,-73.164825&spn=0.848694,1.104126&t=k&hl=en < 1118311515 0 :DMM!DMM@203-206-252-109.dyn.iinet.net.au JOIN :#esoteric < 1118311572 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :hi DMM < 1118311577 0 :DMM!unknown@unknown.invalid PRIVMSG #esoteric :evening < 1118311932 0 :DMM!unknown@unknown.invalid PRIVMSG #esoteric :I read about Homespring for the first time today. Wow... that just blew me away :-) < 1118312056 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :we've been wondering which of npiet or the perl interpreter is more correct according to the piet specs < 1118312107 0 :DMM!unknown@unknown.invalid PRIVMSG #esoteric :oh... I haven't looked at them myself. What's the difference? < 1118312212 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :please see http://www.bertnase.de/npiet/picture.html < 1118312215 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :(bottom) < 1118312256 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :oh hi dmm < 1118312280 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :DMM: graue is afraid to use your fibonacci program as the logo < 1118312289 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :DMM: because the npiet page says it has a bug and doesn't work < 1118312307 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :(the page pgimeno just gave a link to) < 1118312314 0 :DMM!unknown@unknown.invalid PRIVMSG #esoteric :I intended the npiet behaviour of sliding in a straight line < 1118312351 0 :DMM!unknown@unknown.invalid PRIVMSG #esoteric :hmmm, there may be a bug :-( < 1118312363 0 :DMM!unknown@unknown.invalid PRIVMSG #esoteric :It's hard to code in when you don't have an interpreter :-) < 1118312426 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :so you never actually checked the program? < 1118312481 0 :DMM!unknown@unknown.invalid PRIVMSG #esoteric :not with an interpreter. There was none when I wrote them. I traced them by hand. < 1118312587 0 :DMM!unknown@unknown.invalid PRIVMSG #esoteric :it might just need a black codel instead of the white one above the yellow block < 1118312967 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :I've just tried that and it prints 112 and exits < 1118312968 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :hmmm < 1118312973 0 :DMM!unknown@unknown.invalid PRIVMSG #esoteric :hmm < 1118312980 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :hm < 1118312980 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :does Prelude qualify as a turing tarpit? < 1118313002 0 :calamari!unknown@unknown.invalid QUIT :Read error: 110 (Connection timed out) < 1118313004 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :it has 19 instructions < 1118313009 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :ten of which push numbers 0..9 < 1118313016 0 :DMM!unknown@unknown.invalid PRIVMSG #esoteric :pgimeno: please feel free to debug it properly :-) < 1118313109 0 :DMM!unknown@unknown.invalid PRIVMSG #esoteric :112 implies it's traversing the loop once and then falling out < 1118313151 0 :DMM!unknown@unknown.invalid PRIVMSG #esoteric :might need changing of the yellow codel below the blue loop entry point to another colour < 1118313435 0 :DMM!unknown@unknown.invalid PRIVMSG #esoteric :I just like making the languages... actually coding in them isn't nearly as much fun. :-) < 1118313447 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric ::) < 1118313547 0 :DMM!unknown@unknown.invalid PRIVMSG #esoteric :I have some cool ideas for more non-textual languages < 1118313585 0 :DMM!unknown@unknown.invalid PRIVMSG #esoteric :I'm kind of surprised that Piet seems to be the first one < 1118313637 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :I'd like to see a graphical language with graphical output < 1118313642 0 :DMM!unknown@unknown.invalid PRIVMSG #esoteric :I want to do a Tetris-based one, where you drop different blocks into a well, and when the rows disappear, the configuration of colours in the row causes operations to occur < 1118313669 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :there're non-textual languages < 1118313682 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :aardappel made a bunch i believe < 1118313692 0 :DMM!unknown@unknown.invalid PRIVMSG #esoteric :oooh < 1118313762 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :a Tetris-based lang could be NP-complete to code in :) < 1118313911 0 :DMM!unknown@unknown.invalid PRIVMSG #esoteric :indeed he has. A lot of tree-based ones though... < 1118314007 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :reference for Tetris NP-completeness: http://theory.lcs.mit.edu/~edemaine/papers/Tetris_TR2002/ < 1118314192 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :hm < 1118314196 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :ACTION creates http://esoteric.voxelperfect.net/wiki/Popular_problem < 1118314206 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :not sure if the article name is any good < 1118314406 0 :DMM!unknown@unknown.invalid PRIVMSG #esoteric :good article. Yeah, there's no obvious name for it < 1118314517 0 :DMM!unknown@unknown.invalid PRIVMSG #esoteric :ACTION ponders a quine in Piet... < 1118314547 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :hm < 1118314557 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :you never specify the format of input < 1118314590 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :it's "any lossless graphics format", pretty much? < 1118314591 0 :DMM!unknown@unknown.invalid PRIVMSG #esoteric :numbers or characters :-) < 1118314601 0 :DMM!unknown@unknown.invalid PRIVMSG #esoteric :oh, that... yeah, basically < 1118314630 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :i'm actually working (sort of) on a language where source code is polyphonic music < 1118314644 0 :DMM!unknown@unknown.invalid PRIVMSG #esoteric :although ideally it's really just the colours. The encoding into a graphics format is just a way of representing the program, not the program itself. :_) < 1118314662 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :i'm so confused as to what format i would use that i doubt i'll ever implement it < 1118314674 0 :DMM!unknown@unknown.invalid PRIVMSG #esoteric :oooh... I thought of a music-based language just yesterday. But I guess I'll let you do it first :-) < 1118314675 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :i'll just write programs and play them on the piano :) < 1118314686 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :well, i already have one as it happens :) < 1118314700 0 :DMM!unknown@unknown.invalid PRIVMSG #esoteric :documented? < 1118314701 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :just not sure if it's good enough < 1118314702 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :no < 1118314703 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :well < 1118314707 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :have a look at Prelude < 1118314720 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :http://esoteric.voxelperfect.net/wiki/Prelude < 1118314733 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :Fugue will be the same, except with different intervals corresponding to different instructions < 1118314746 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :each "voice" is indeed a separate voice < 1118314750 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :note duration doesn't matter < 1118314787 0 :DMM!unknown@unknown.invalid PRIVMSG #esoteric :interesting < 1118315030 0 :DMM!unknown@unknown.invalid PRIVMSG #esoteric :I was thinking of a language based on actual music. Where the note, duration, key, time signature, etc are important < 1118315046 0 :DMM!unknown@unknown.invalid PRIVMSG #esoteric :you'd write it on a stave < 1118315064 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :well, there's no reason to have EVERYTHING be important < 1118315074 0 :DMM!unknown@unknown.invalid PRIVMSG #esoteric :well no... < 1118315105 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :Fugue you write on a stave. But the only thing that matters are the intervals (and the number of voices) < 1118315178 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :music notation is just way too packed with different kinds of info < 1118315182 0 :puzzlet!unknown@unknown.invalid PRIVMSG #esoteric :wow, now you got the complete spec? < 1118315195 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :for Fugue? on < 1118315197 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :*no < 1118315209 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :well < 1118315219 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :i can just tell you the provisional list of intervals < 1118315243 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :i'm just afraid my provisional list sucks < 1118315632 0 :puzzlet!unknown@unknown.invalid PRIVMSG #esoteric :ACTION is trying to learn Prelude < 1118315687 0 :DMM!unknown@unknown.invalid PRIVMSG #esoteric :I got some TV to watch... later guys < 1118315710 0 :puzzlet!unknown@unknown.invalid PRIVMSG #esoteric :lament: about ^ and v, does it pop the top value from current voice? < 1118315716 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :puzzlet: no < 1118315721 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :it doesn't pop anything at all < 1118315726 0 :DMM!unknown@unknown.invalid PART #esoteric :? < 1118315742 0 :puzzlet!unknown@unknown.invalid PRIVMSG #esoteric :only ! and # would pop the top value? < 1118315744 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :yeah < 1118315819 0 :puzzlet!unknown@unknown.invalid PRIVMSG #esoteric :ah, i get it < 1118315846 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :my thinking about a music-based language is that only note increases/decreases count as instructions; that allows for maximum expressiveness IMO < 1118315862 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :That's how Fugue will work. < 1118315874 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :nice! < 1118315881 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :I should just release the damn spec actually. < 1118315885 0 :puzzlet!unknown@unknown.invalid PRIVMSG #esoteric :i like the () idea, looks like a pair of repeat bars < 1118315894 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :In fact, how about I do that. < 1118315959 0 :puzzlet!unknown@unknown.invalid PRIVMSG #esoteric :what is your plan to notate down the music into a file? < 1118315972 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :No plans at all < 1118315978 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :I'm not planning to implement Fugue :) < 1118315994 0 :puzzlet!unknown@unknown.invalid PRIVMSG #esoteric :that's sad < 1118316033 0 :puzzlet!unknown@unknown.invalid PRIVMSG #esoteric :i wish to write a meta-code, which itself is a true fugue.. < 1118316076 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :haha < 1118316108 0 :puzzlet!unknown@unknown.invalid PRIVMSG #esoteric :if Fugue code is written on midi, midi format doesn't have repeat bars. < 1118316138 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :why not write an implementation? just write a Fourier analyzer to interpret the sound coming to the soundcard; you could even whistle the programs < 1118316158 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :puzzlet: actually repeating a sound when the program is in a loop is kinda silly. < 1118316176 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :pgimeno: you can't very well whistle three-part polyphony < 1118316205 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :with the help of two other guys, you can :) < 1118316206 0 :puzzlet!unknown@unknown.invalid PRIVMSG #esoteric :that's why we should do a pair programming < 1118316211 0 :puzzlet!unknown@unknown.invalid PRIVMSG #esoteric :or trio programming < 1118316277 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :programming in pairs is part of the "xtreme programming" philosophy < 1118316296 0 :puzzlet!unknown@unknown.invalid PRIVMSG #esoteric :i know. i was joking :) < 1118316322 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :hahaha < 1118316337 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :so, instead of handing the keyboard one to the other, they could both whistle at the same time < 1118316365 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :that can increase the production of code < 1118316716 0 :fizzie!unknown@unknown.invalid PRIVMSG #esoteric :I guess I should implement the rest of my Prelude Befunge interpreter. < 1118316778 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :okay < 1118316782 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :http://esoteric.voxelperfect.net/wiki/Fugue < 1118317353 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :interesting, indeed < 1118317392 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :though it needs too much information in my opinion < 1118317424 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :imagine the BF quine that starts with a lot of +++++++>++++>++++++++... < 1118317476 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :so write a symphony < 1118317518 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :note that ++++++++ is just three notes in Fugue < 1118317561 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :any third and an ascending minor sixth < 1118317561 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :I was thinking in the line of "note increment wrt the last" = 1; "note decrement wrt the last" = 0; "same note" = "repeat last symbol", and a minimalistic two-symbol language like whirl, iota or jot < 1118317594 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :oh < 1118317604 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :might work but notes would soon go out of range < 1118317610 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :audible range, that is < 1118317627 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :no, because you can always correct < 1118317634 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :by pushing a number and popping it < 1118317643 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :oh, then that's OK < 1118317652 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :i.e. any third + any interval whatever + repeat last note < 1118317681 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :you've forgotten to include it in the main list, btw < 1118317688 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :include what? < 1118317696 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :Fugue < 1118317699 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :oh < 1118317727 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :do we really need both the main list and category:language < 1118317765 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :Fugue is definitely harder to write nice-sounding music in than a language like you proposed < 1118317784 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :my idea was that the main list hold short one-line descriptions of each language < 1118317792 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :but who ever sad writing music should be easy :) < 1118317796 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :*said < 1118317835 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :I remember someone saying that most songs can be distinguished by coding the increments/decrements of notes in them < 1118317872 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :that's what suggested me the idea < 1118317970 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :bbl < 1118318082 0 :puzzlet!unknown@unknown.invalid PRIVMSG #esoteric :lament, how do you define ' ' in Fugue? < 1118318105 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :there is no ' ' < 1118318113 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :you can have pauses < 1118318119 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :or long notes < 1118318134 0 :puzzlet!unknown@unknown.invalid PRIVMSG #esoteric :then do note lengths matter? < 1118318166 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :only in that they establish what comes before what. < 1118318175 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :(or simultaneously with) < 1118318254 0 :puzzlet!unknown@unknown.invalid PRIVMSG #esoteric :ah < 1118318824 0 :kipple!~kipple@163.80-202-100.nextgentel.com JOIN :#esoteric < 1118321123 0 :Keymaker!~Not@wire74.adsl.netsonic.fi JOIN :#esoteric < 1118321145 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :. < 1118321215 0 :fizzie!unknown@unknown.invalid PRIVMSG #esoteric :.. < 1118321243 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :[.>] < 1118321388 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :++ < 1118321473 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :[-] < 1118321475 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric ::p < 1118321527 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :i'm reading about pygame < 1118321532 0 :puzzlet!unknown@unknown.invalid PRIVMSG #esoteric :it's confusing when there are + and - signs all over what others say. < 1118321540 0 :puzzlet!unknown@unknown.invalid PRIVMSG #esoteric :[20:47:57] +.. < 1118321541 0 :puzzlet!unknown@unknown.invalid PRIVMSG #esoteric :[20:48:25] +[.>] < 1118321541 0 :puzzlet!unknown@unknown.invalid PRIVMSG #esoteric :[20:50:50] +++ < 1118321541 0 :puzzlet!unknown@unknown.invalid PRIVMSG #esoteric :[20:52:15] -[-] < 1118321562 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :w+h-a-t ++do +y-ou+ ++me-a+n++? < 1118321641 0 :puzzlet!unknown@unknown.invalid PRIVMSG #esoteric :it seems it's server's problem < 1118321693 0 :puzzlet!unknown@unknown.invalid PRIVMSG #esoteric :i see + and - signs everwhere in freenode, and even ACTION's don't look as what they should look. < 1118321758 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :that's strange < 1118321770 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :hm < 1118321784 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :I think it must be because of your IRC client < 1118321791 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :yeah < 1118321816 0 :puzzlet!unknown@unknown.invalid PRIVMSG #esoteric :i use irssi. i checked rawlog, but there are the signs there too < 1118321869 0 :puzzlet!unknown@unknown.invalid PRIVMSG #esoteric :and it just came out to happen yesterday when i restarted the client. no changes to configuration < 1118322351 0 :fizzie!unknown@unknown.invalid PRIVMSG #esoteric :Uh, strange. I don't see any +s. < 1118322360 0 :fizzie!unknown@unknown.invalid PRIVMSG #esoteric :(This is irssi, too.) < 1118323694 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :anyone know where i could find this file pygame-1.6.win32-py2.4.exe (windows pygame)? < 1118323699 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :can't download from official site < 1118323721 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :(404) < 1118323803 0 :fizzie!unknown@unknown.invalid PRIVMSG #esoteric :Well, http://www.willmcgugan.com/pygame-1.6.win32-py2.4.exe for example. < 1118323805 0 :fizzie!unknown@unknown.invalid PRIVMSG #esoteric :Says google. < 1118323865 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :google? is that some new search engine? < 1118323869 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :anyways, thanks < 1118323913 0 :puzzlet!unknown@unknown.invalid PRIVMSG #esoteric :Keymaker, you must be kidding < 1118324035 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :? < 1118324042 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :never heard of any google before < 1118324131 0 :puzzlet!unknown@unknown.invalid PRIVMSG #esoteric :http://www.google.com/ < 1118324403 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :i was joking ;) < 1118324521 0 :puzzlet!unknown@unknown.invalid PRIVMSG #esoteric :you scared me < 1118324843 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric ::) < 1118324856 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :Since Keymaker just found the internet yesterday ;) < 1118325010 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric ::) < 1118326450 0 :lament!unknown@unknown.invalid QUIT :Read error: 110 (Connection timed out) < 1118327012 0 :malaprop!~ph@ppp-68-251-59-237.dsl.chcgil.ameritech.net JOIN :#esoteric < 1118327059 0 :lament!~lament@S010600110999ad06.vc.shawcable.net JOIN :#esoteric < 1118332343 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :kipple: seen movie "hawaii, oslo" < 1118332347 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :? < 1118332427 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :yes < 1118332444 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :ah < 1118332447 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :was it good? < 1118332455 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :it was ok < 1118332462 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :ok < 1118332479 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :why? are you gonna watch it? < 1118332504 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :i just thought because it starts screening here and there reads it was huge success in norway < 1118332508 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :and maybe < 1118332542 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :it was a bit overrated IMHO. It got extremely good reviews here < 1118332550 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :ok < 1118332555 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :the story sounds interesting < 1118332616 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :or should i perhaps go to see "white noise"? < 1118332622 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :some new horror movie < 1118332633 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :don't know anything about that one < 1118332816 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :yeah < 1118332864 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :it sounds a bit cliché.. < 1118332878 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :or dunno :) < 1118332897 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :movies just tend to be cliché today because everything's done before < 1118334076 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :ok.. i'll go to see movie "hostage" < 1118334081 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :at 20:30 < 1118334711 0 :sp3tt_!unknown@unknown.invalid PRIVMSG #esoteric :ACTION wrote a 4 page PDF on brainfuck >.< < 1118334716 0 :sp3tt_!unknown@unknown.invalid PRIVMSG #esoteric :I was bored. < 1118334979 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric ::) < 1118335000 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :upload it somewhere, i'd like to read it later when it get back home < 1118335044 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :(i need to leave now because i booked the movie ticket from web so i need to get it before 19:30) < 1118335047 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :'bye < 1118335053 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :doh, Piet is troublesome in that inserting or removing an instruction means changing the whole program < 1118335057 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :later Keymaker < 1118335061 0 :Keymaker!unknown@unknown.invalid QUIT :"I've seen this déjà vu before.." < 1118335103 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :that's the issue of incremental instructions < 1118335189 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :it's easier to write a new program than to modify an existing one < 1118335233 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :I wanted to fix the fibonacci Piet program but I think that writing another one will be easier < 1118335301 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :I think that one which prints "ESOTERIC" will be OK to be used as a logo < 1118337848 0 :sp3tt_!unknown@unknown.invalid NICK :sp3tt < 1118338399 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :this Piet program prints "ESO": http://www.formauri.es/personal/pgimeno/temp/eso-big.png < 1118338541 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :pgimeno: nice < 1118338554 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :I'm sorry, I'm not much of an artist < 1118339183 0 :sp3tt!unknown@unknown.invalid PRIVMSG #esoteric :Wow. < 1118339187 0 :sp3tt!unknown@unknown.invalid PRIVMSG #esoteric :That's awesome. < 1118339297 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :nice pgimeno! < 1118342108 0 :wooby!~wooby@cpe-065-191-186-247.nc.res.rr.com JOIN :#esoteric < 1118351510 0 :graue!~piecrust@ip68-100-130-21.dc.dc.cox.net JOIN :#esoteric < 1118354997 0 :calamari!~calamari@dialup-4.240.114.146.Dial1.Phoenix1.Level3.net JOIN :#esoteric < 1118355003 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :hi < 1118355033 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :hey < 1118355080 0 :wooby!unknown@unknown.invalid PRIVMSG #esoteric :hio < 1118355094 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :hey lament, wooby.. what's new & exciting? < 1118355127 0 :wooby!unknown@unknown.invalid PRIVMSG #esoteric :not much, working through a bison tutorial with the ultimate hope of fashioning a BF compiler < 1118355156 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :nifty < 1118355175 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :what will be the hll? < 1118355192 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :something you invent, or c-like? < 1118355233 0 :wooby!unknown@unknown.invalid PRIVMSG #esoteric :what do you mean by hll? < 1118355245 0 :wooby!unknown@unknown.invalid PRIVMSG #esoteric :i'm at the very start of this tutorial, you see :) < 1118355251 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :high level language < 1118355256 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :calamari: i'm guessing he wants to compile brainfuck < 1118355260 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :maybe I misunderstand what you're trying to do < 1118355277 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :lament: oic < 1118355292 0 :wooby!unknown@unknown.invalid PRIVMSG #esoteric :lament is correct < 1118355314 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :my usual fun is compiling to bf, so I get easily confused :) < 1118355335 0 :wooby!unknown@unknown.invalid PRIVMSG #esoteric :lol i know what you mean, i'm interested in that too :) < 1118355347 0 :wooby!unknown@unknown.invalid PRIVMSG #esoteric :how about you, what's new and great < 1118355392 0 :sp3tt!unknown@unknown.invalid QUIT :Read error: 54 (Connection reset by peer) < 1118355541 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :wooby: http://esoteric.voxelperfect.net/wiki/BF_instruction_minimalization < 1118355578 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :wooby: I think that last step still needs a bit of work, though :) I'd like a way to modify every bit, not just every other < 1118355741 0 :Keymaker!~Not@wire74.adsl.netsonic.fi JOIN :#esoteric < 1118355744 0 :wooby!unknown@unknown.invalid PRIVMSG #esoteric :hm, that's fascinating < 1118355747 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :pgimeno: looks great < 1118355751 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :calamari: wow!!!!! < 1118355754 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :that stuff is great < 1118355770 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :i don't remember if i have mentioned that before, i saw that link yesterday < 1118355776 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :(iirc) < 1118355804 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :Keymaker: thanks.. but I haven't really progressed much past BitChanger of a few years ago < 1118355933 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :but that's really good achievement too < 1118356003 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :I'm not sure that it's turing complete yet < 1118356091 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :for example (}()) should be like [-]<.. but it only gets it by luck < 1118356583 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :actually it'd be (()}) wouldn't it < 1118357088 0 :graue_!~graue@ip68-100-130-21.dc.dc.cox.net JOIN :#esoteric < 1118357345 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :hi graue < 1118359115 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :and btw, "hostage" was very good movie < 1118359280 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :hi calamari < 1118359571 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :graue: I'd really like to integrate EsoShell into the wiki. Would you like to work on it with me? < 1118359609 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :i'd rather not have executable code running out of the wiki < 1118359616 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :it's for information, not running programs < 1118359671 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :graue: your vision of the wiki is a bit narrower than I'd hoped for < 1118359708 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :I'm halfway wondering if you'll be pulling up those in-progress pages at any moment < 1118359829 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :now I realize it's your wiki, you're running it, and all that.. which I appreciate.. but perhaps if you're going to stifle the expressive purposes of the wiki we need to abandon your stranglehold and start a new wiki elsewhere < 1118359880 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :calamari: how exactly were you thinking of integrating the esoshell into the wiki? < 1118359925 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :kipple: when all this wiki talk started up again, it was suggested that it'd be cool to be able to experimentally test esolangs from the wiki < 1118359944 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :yeah, I know. I think it was me who suggested it... < 1118359959 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :add a prominent external link then < 1118359976 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :you could put it in the files archive and link to it from the wiki. < 1118360040 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :Speaking of wiki and files, what's the word on scheduled dumps? < 1118360110 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :help me out, how do i dump a mysql database from the command line? < 1118360140 0 :wooby!unknown@unknown.invalid PRIVMSG #esoteric :there's a program called mysqldump < 1118360156 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :mysqldump -a -c -C-e --add-drop-table --delayed-insert -Q -u (username) -p(password) -h (host) (db-name) < 1118360170 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :er, there should be a space between -C and -e < 1118360186 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :and probably tag onto the end > filename < 1118360207 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :or pipe it to gzip < 1118360232 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :kipple: or bzip2 as it deals better with text < 1118360240 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :so true < 1118360247 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :doesn't bzip2 deal better with everything, not just text? < 1118360267 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :bzip2 deals especially better with text < 1118360284 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :lament: I don't know, I haven't done or seen good research. < 1118360299 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :would be nice if the images directory is included in the zip as well < 1118360332 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :or you could just download the one and only image from commons.wikimedia.org if anything happens < 1118360387 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :yes, but hopefully there will be more eventually... < 1118360425 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :then hopefully i can archive the images directory too, eventually < 1118360435 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :hehe. sure < 1118360442 0 :calamari!unknown@unknown.invalid QUIT :Read error: 145 (Connection timed out) < 1118360724 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :i'm getting an error 1044, access denied... when using LOCK TABLES < 1118360730 0 :calamari!~calamari@dialup-4.240.150.97.Dial1.Phoenix1.Level3.net JOIN :#esoteric < 1118360786 0 :wooby!unknown@unknown.invalid PRIVMSG #esoteric :wb calamari < 1118360810 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :hi wooby.. lost my connection < 1118360814 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :ACTION checks what he missed < 1118360869 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :graue: so you're saying that you're not going to host the files or the html to run them? < 1118360918 0 :graue_!unknown@unknown.invalid PRIVMSG #esoteric :no, i'm not saying that; they could go in the files archive, or in a new area < 1118360933 0 :graue_!unknown@unknown.invalid PRIVMSG #esoteric :i am saying they should not be part of the wiki < 1118360947 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :graue: why not? < 1118360981 0 :graue_!unknown@unknown.invalid PRIVMSG #esoteric :because java applets are a huge can of worms < 1118360987 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :in what way? < 1118361008 0 :graue_!unknown@unknown.invalid PRIVMSG #esoteric :i for one will not be able to use them; they'll freeze my windows 98 box, and on gnu/linux they'll give me ugly messages about installing nonfree plugins < 1118361020 0 :graue_!unknown@unknown.invalid PRIVMSG #esoteric :it's silly to junk up a page like that, when the point is information < 1118361034 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :the applet wouldn't be on every page < 1118361053 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :graue_: sounds like your db user doesn't have access rights to lock the db tables < 1118361053 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :it'd only be on one page < 1118361073 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :but why not have that page in the files archive? < 1118361089 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :kipple: how does that work? you need html to run the applet < 1118361097 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :so? < 1118361106 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :the files archive is accessible with HTTP < 1118361111 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :so if it's just a file it can't be run < 1118361123 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :it defeats the purpose of being an applet < 1118361129 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :you just put both the HTML file and the JAR in the archive < 1118361177 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :whouldn't it look nicer to have the wiki framework around it? < 1118361187 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :I don't see the big problem < 1118361197 0 :graue_!unknown@unknown.invalid PRIVMSG #esoteric :no, it would not look nicer to make the wiki display missing plugin messages and/or freeze my browser < 1118361227 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :graue: umm.. java doesn't freeze my browser.. fix your browser then < 1118361260 0 :graue_!unknown@unknown.invalid PRIVMSG #esoteric :well, that's constructive < 1118361264 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :calamari: He's using IE, can't fix. < 1118361283 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :the applet would have to be on a page of it's own anyway, so people who don't want to run applets can just avoid that page < 1118361284 0 :graue_!unknown@unknown.invalid PRIVMSG #esoteric :the machine is a pentium 2, it's old and slow < 1118361294 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :kipple: it would be < 1118361319 0 :graue_!unknown@unknown.invalid PRIVMSG #esoteric :the point is my old, slow, broken computer can still access the wiki, because the wiki is just text, just information < 1118361328 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :but then again, that would not be much different from an external page < 1118361329 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :and you'd be able to edit it just like any other wiki page, to add content about ysing the program < 1118361348 0 :graue_!unknown@unknown.invalid PRIVMSG #esoteric :so add that content to the EsoShell article < 1118361360 0 :graue_!unknown@unknown.invalid PRIVMSG #esoteric :the instructions and program shouldn't be on the same page < 1118361379 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :um, I disagree < 1118361394 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :ACTION had so many plans for this.. so frustrating to be blocked by ignorance < 1118361407 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :it's very nice to have instructions on the same page, so you can simply scroll down when you need to look at them < 1118361407 0 :graue_!unknown@unknown.invalid PRIVMSG #esoteric :you aren't blocked < 1118361418 0 :graue_!unknown@unknown.invalid PRIVMSG #esoteric :using an external page is not a blockade < 1118361450 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :here's an idea.. don't go to the EsoShell wiki page ;) < 1118361459 0 :graue_!unknown@unknown.invalid PRIVMSG #esoteric :what if i want to read about it? < 1118361466 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :then read about it < 1118361477 0 :graue_!unknown@unknown.invalid PRIVMSG #esoteric :what page do i go to to just read about it? < 1118361490 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :the EsoShell page < 1118361494 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric ::) < 1118361502 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :anyhow... < 1118361510 0 :graue_!unknown@unknown.invalid PRIVMSG #esoteric :which you just told me not to go to < 1118361517 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :it'd be nicer to have separate pages for different languages < 1118361531 0 :graue_!unknown@unknown.invalid PRIVMSG #esoteric :it's not that hard: files archive (and hypothetical other sections of site) = stuff, wiki = descriptions of stuff < 1118361541 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :for exmaple, a page full of bf programs to copy and paste in while running the applet < 1118361551 0 :graue_!unknown@unknown.invalid PRIVMSG #esoteric :then i encourage you to add a link at the bottom of each language, pointing to the convenient interpreter for that language < 1118361589 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :graue: you still haven't said what is so wrong about allowing a Java applet directly on the wiki < 1118361601 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :umm. I think he has... < 1118361619 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :he has told me how he has a slow computer.. that's about it < 1118361687 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :ACTION gives up then < 1118361740 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :when I have time, I'll start a new wiki that is more user friendly < 1118362647 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :ok, let's try this again < 1118362656 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :there is "stuff", and there is "info about stuff" < 1118362678 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :a program is "stuff" < 1118362695 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :the wiki is for "info about stuff" < 1118362698 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :Is an example program stuff or info about stuff? < 1118362737 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :And I'll note that I don't see any reason the wiki can't also store "stuff". < 1118362749 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :me neither... < 1118362769 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :the reason is that "stuff" can crash your computer, or require a certain operating system, or eat up your RAM < 1118362775 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :"info about stuff" is just information < 1118362790 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :my slow computer is one of many possible examples of why mixing "stuff" and "info about stuff" is a bad idea < 1118362818 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :i am quite happy to store relevant "stuff" on esoteric.voxelperfect.net, if people are interested in having it there < 1118362822 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :If you don't want "stuff", don't download it. If your web browser lets websites crash your computer, it is broken, period, and should not be used as the baseline for everthing. < 1118362854 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :i don't think websites should have programs in them at all < 1118362883 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :does that mean every website with a java applet is broken, period? or is my opinion NOT the final say on what is or isn't broken? < 1118362898 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :Looking at the existence of Flash, I've got to say that almost every else in the world disagrees with you on that one. < 1118362947 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :that's exactly my point < 1118362974 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :your opinion that my "broken" web browser should not be accommodated is not law, either < 1118362995 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :Your opinion on what is broken is invalid because you're not seeing that it's your browser that's broken. It's like the ethnic joke where the guy goes to the doctor and says "My leg hurts when I poke it, my chest hurts when I poke it, my head hurts when I poke it" and the doctor responds "Your finger is broken." < 1118363031 0 :graue_!unknown@unknown.invalid QUIT :Read error: 145 (Connection timed out) < 1118363045 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :I'm not trying to be mean or insulting, just point out that web apps are not uncommon or inherently bad. < 1118363235 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :that doesn't change the fact that they don't belong on a wiki < 1118363250 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :there is nothing hard about the concept of separating content from information about that content < 1118363261 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :that's not a "fact", that's your opinion... < 1118363272 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :They do belong on a wiki, the wiki has file support for just that reason. < 1118363288 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :the wiki has file support to store images < 1118363339 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :graue: why does the esoteric wiki have to fit into the "normal" wiki.. we're supposed to be out there, right? :) < 1118363340 0 :graue_!~graue@ip68-100-130-21.dc.dc.cox.net JOIN :#esoteric < 1118363349 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :Dividing data and metadata is arbitrary. If you're providing both, provide them together. < 1118363387 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :And MediaWiki does not have file support just for images; otherwise it would not be possible to upload anything but images. < 1118363399 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :that said, I can understand graue's reluctance to change his wiki.. he started that wiki before we all got together and started decided things.. so it isn't quite fair to ask him to change what was already there < 1118363443 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :I disagree. I'm asking because I see straightforward ways to make things better. Is very much in the wiki spirit. < 1118363538 0 :wooby!unknown@unknown.invalid QUIT : < 1118363565 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :malaprop: I think graue has his own ideas about how a wiki should be run, and doesn't want to change those to fit what the rest of us would like.. that's totally his choice tho. That's why I think it might be best to choose to start fresh < 1118363600 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :I'd rather build up than start again from scratch. It's why I'm such a pain in the ass. < 1118363632 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :please, let us not end up with two competing wikis! < 1118363680 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :And on that note, I unfortunately have to go. I may be online again in a few hours or it'll be tomorrow morning (~13h). < 1118363686 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :cya malaprop < 1118363687 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :ACTION idles. < 1118364166 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :having to put something one mouseclick away is a very stupid thing to fork a wiki over < 1118364253 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :graue: I don't see it that way, exactly.. this one item certainly isn't a dealbreaker. What gets me is how you do not seem to care about the opinion of the rest of the community.. we had a lot of plans that were made together, and you singlehandledly vetoed those plans when we decided to go with your server. < 1118364361 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :graue: we were going to have file uploading, but you didn't want that, until we complained so loudly you couldn't ignore it.. this java applet thing was in the works pretty much from the very beginning=, we we're going to have multiple wikis, etc.. < 1118364410 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :which is totally fine for your own server.. hey you're the boss.. but I don't think you're being very cooperative < 1118364450 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :and so, in the future, when something needs to be done.. I'm sure it will be the same way < 1118364477 0 :graue_!unknown@unknown.invalid PRIVMSG #esoteric :i have vetoed all of one plan, put forward by two people; there is no problem moving the java applet one mouseclick away; the multiple wikis idea was rejected with everyone's agreement because it wasn't practical; file uploading is a feature that was implemented separately from the wiki with everyone's agreement who happened to speak up < 1118364510 0 :graue_!unknown@unknown.invalid PRIVMSG #esoteric :you're blowing a lot of hot air and it's silly, just for one extra mouseclick people will have to make to get to your java program < 1118364564 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :graue: I recall things differently < 1118364589 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :everyone wanted to be able to uplaod files, only requiring a user account < 1118364615 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :you were the only one that wanted all the sql beg you to upload file hoops < 1118364616 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :revolution!!!! < 1118364634 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :lament: hehe < 1118364651 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :ACTION isn't upset, btw :) < 1118364656 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :people of the world rise against graue's tyrannical rule < 1118364661 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :*peoples < 1118364741 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :lament: I see no problem letting him run his wiki the way he wants to < 1118364798 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :I think we should have left it that way from the beginning.. it was a mistake, is all. His wiki predates the whole eso preservation thing < 1118364872 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :that is true. < 1118365095 0 :graue_!unknown@unknown.invalid PRIVMSG #esoteric :i actually started my wiki to preserve esoteric languages < 1118365107 0 :graue_!unknown@unknown.invalid PRIVMSG #esoteric :it just took a while for people to become interested < 1118366724 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :personally it took a backup solution to become interested. otherwise Wikipedia would have been better < 1118366801 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :i still think ftp would be the best < 1118366811 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric ::) < 1118367172 0 :graue_!unknown@unknown.invalid PRIVMSG #esoteric :ftp for a wiki? < 1118367177 0 :graue_!unknown@unknown.invalid PRIVMSG #esoteric :you mean for the files, right? < 1118367316 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :probably < 1118369051 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :i mean, we don't actually need a wiki. < 1118369518 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :well, I've discovered the reason I can't get a file list for my applet's help program.. http doesn't support getting a file list.. hehe < 1118369577 0 :kipple!unknown@unknown.invalid QUIT :Read error: 145 (Connection timed out) < 1118369690 0 :graue_!unknown@unknown.invalid PRIVMSG #esoteric :with webdav it does < 1118369698 0 :graue_!unknown@unknown.invalid PRIVMSG #esoteric :but that probably isn't exactly practical < 1118369737 0 :graue_!unknown@unknown.invalid PRIVMSG #esoteric :make .listing files? < 1118369753 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :yeah.. it'll have to be something like that < 1118370225 0 :graue_!unknown@unknown.invalid QUIT :"brb" < 1118370234 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :the built in commands don't change much, unless a new language is added < 1118370291 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :it'd be cool to have some kind of programs page that it automatically loaded up, so you had a bunch of example programs to run. Would need to be a wiki though, otherwise content would be nonexistent < 1118370486 0 :wooby!~wooby@cpe-065-191-186-247.nc.res.rr.com JOIN :#esoteric < 1118370492 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :re wooby < 1118370501 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :was just thinking about your idea < 1118370511 0 :wooby!unknown@unknown.invalid PRIVMSG #esoteric :me too :) < 1118370512 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :I think it can be done < 1118370515 0 :wooby!unknown@unknown.invalid PRIVMSG #esoteric :any ideas? < 1118370519 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :it'll just need to be in one file < 1118370525 0 :wooby!unknown@unknown.invalid PRIVMSG #esoteric :what mechanism do you propose for referencing code? < 1118370549 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :yeah.. have a certain wiki page, for say BF programs. Then, a program on the page would look something like < 1118370589 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :name: myprogram.b < 1118370594 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :code: ....... < 1118370609 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :then the program could parse the page to grab the programs < 1118370642 0 :wooby!unknown@unknown.invalid PRIVMSG #esoteric :i see < 1118370665 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :I think you were hoping for something more interractive? < 1118370672 0 :wooby!unknown@unknown.invalid PRIVMSG #esoteric :i was thinking more along the lines of storing code fragments in a db table, with author, description, and usage information < 1118370691 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :oic, so like a library of bf snippets? < 1118370700 0 :wooby!unknown@unknown.invalid PRIVMSG #esoteric :yeah exactly < 1118370720 0 :wooby!unknown@unknown.invalid PRIVMSG #esoteric :the problem is it would be so difficult to come up with a standard for handling return data < 1118370764 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :it also wouldn't work well for languages such as Befunge that are two-dimensional < 1118370790 0 :wooby!unknown@unknown.invalid PRIVMSG #esoteric :i'm beginning to think it wouldn't work well in general < 1118370802 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :but it's still a cool idea for a wiki page < 1118370818 0 :wooby!unknown@unknown.invalid PRIVMSG #esoteric :suppose you had a code fragment recognized by the interpreter as 1, which say... converts a cell value to ascii value < 1118370823 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :could save your neatest bf tricks for posterity < 1118370833 0 :wooby!unknown@unknown.invalid PRIVMSG #esoteric :so you could do like +++1 => 3 < 1118370857 0 :wooby!unknown@unknown.invalid PRIVMSG #esoteric :that would work cleanly because the return value is only a byte < 1118371004 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :I wonder if I could rig file writing to automatically edit the wiki.. that'd be cool, permanent storage < 1118371043 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :actually, just the close operation would want to write anything < 1118371046 0 :wooby!unknown@unknown.invalid PRIVMSG #esoteric :haha wikiFS ;) < 1118371081 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :yeah.. it'd be cool.. because you could edit it yourself, or you could use the applet, and it's just plain text on the wiki page to view < 1118371185 0 :wooby!unknown@unknown.invalid PRIVMSG #esoteric :i'd imagine javascript to be conducive to interactive lang interpreting, at least for BF < 1118371191 0 :wooby!unknown@unknown.invalid PRIVMSG #esoteric :do you consider that an option? < 1118371652 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :sorry.. was afk. java or javascript seem file.. both are client side though.. I chose Java because it was more powerful < 1118371669 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :s/file/fine/ < 1118371847 0 :wooby!unknown@unknown.invalid PRIVMSG #esoteric :yeah < 1118371995 0 :wooby!unknown@unknown.invalid PRIVMSG #esoteric :ha, just perusing the bfbasic readme < 1118372009 0 :wooby!unknown@unknown.invalid PRIVMSG #esoteric :'randomize' would be an interesting function to implement < 1118372247 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :'lo all < 1118372284 0 :wooby!unknown@unknown.invalid PRIVMSG #esoteric :hio < 1118372453 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :How goes? < 1118372488 0 :wooby!unknown@unknown.invalid PRIVMSG #esoteric :ACTION abides < 1118373882 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :wooby: it was fun :) < 1118374655 0 :graue_!~graue@ip68-100-130-21.dc.dc.cox.net JOIN :#esoteric < 1118374716 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :Hola sen~or graue_. < 1118374729 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :Please mentally combine the n and ~ ;) < 1118374737 0 :graue_!unknown@unknown.invalid PRIVMSG #esoteric :will do < 1118374841 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :I suppose the fact that you're now logged in as graue_ instead of graue suggests that you didn't get my response in #directnet ? < 1118374854 0 :graue_!unknown@unknown.invalid PRIVMSG #esoteric :ah, nope, but i'll go see what it was < 1118374915 0 :graue!unknown@unknown.invalid QUIT :"this client is obsolete" < 1118374942 0 :graue_!unknown@unknown.invalid NICK :graue < 1118374953 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :#directnet just lost its peak user count ;) < 1118375650 0 :calamari!unknown@unknown.invalid QUIT :Read error: 104 (Connection reset by peer) < 1118375746 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :you know, i gotta say calamari's idea for loading programs from a wiki page is pretty cool < 1118375803 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :i wonder if it could be accommodated by creating a new namespace < 1118375826 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :Dern too much talking... < 1118375832 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :Mind making a brief of the idea? < 1118375835 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :you'd go to "Brainfuck" and say "hey, this seems cool" and follow the esoshell link to the "EsoShell:Brainfuck" page with the programs and stuff < 1118375858 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :calamari has made a small fake shell program as a java applet, and it has esoteric language interpreters < 1118375864 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :Yeah, I know that much. < 1118375866 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :the idea was so people could try new languages out conveniently < 1118375869 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :Right. < 1118375880 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :recently he mentioned loading languages automatically from a wiki page < 1118375896 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :like you could put a "99 bottles of beer" example in the "EsoShell:Brainfuck" wiki article (or whatever) < 1118375905 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :and the shell would be able to load it directly < 1118375911 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :that is my understanding < 1118375941 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :so, any idiot could add a cool program to test out < 1118375948 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :Why not have the wiki itse---because some would need input. < 1118375952 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :Yay answering my own question! < 1118376017 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :i wonder if calamari would go for the "EsoShell:" namespace idea < 1118376035 0 :calamari!~calamari@dialup-4.240.114.223.Dial1.Phoenix1.Level3.net JOIN :#esoteric < 1118376039 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :hey calamari < 1118376044 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :we have been talking about you < 1118376060 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :please to read http://tunes.org/~nef/logs/esoteric/05.06.09 and catch up on the discussion < 1118376061 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :hi graue < 1118376088 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :sorry.. was getting ready to go out.. gotta watch star wars again :) < 1118376095 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :great < 1118376100 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :well, check it out later then < 1118376115 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :short story: i think it would be cool if you did your java applet thing in a new namespace on the existing wiki < 1118376117 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :I'll check it now :) < 1118376120 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :like, "EsoShell:Brainfuck" etc < 1118376121 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :oh < 1118376127 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :okay < 1118376133 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :that would be interesting < 1118376140 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :brb .. reading < 1118376242 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :that sounds great.. I was actually wondering how to pull that off while in the shower hehe < 1118376279 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :my previous idea of being able to edit old files from esoshell might cause problems.. but saving new ones should be okay < 1118376311 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :dunno.. it all depends on what I can get the wiki to tell me < 1118376340 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :I know in moin it would tell me when the page was locked and that I had a certain amount of time to make my edit < 1118376353 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :that sort of thing < 1118376371 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :the only thing I'm afraid of is that popluar things to run would be locked all the time < 1118376430 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :mediawiki doesn't lock anything; if you try to save an edit based on an out of date revision, it just tells you there's been a conflict < 1118376446 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :does it allow you to resolve the conflict? < 1118376458 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :or do you just lose it? < 1118376469 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :i'm not sure, exactly... i'd have to try it again, but i think it possibly does < 1118376517 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :lets find out.. http://esoteric.voxelperfect.net/w/index.php?title=User_talk:Calamari&action=edit < 1118376522 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :I'm editing that page < 1118376553 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :someone do a quick edit and then I'll save mine < 1118376566 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :okay i did one < 1118376607 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :interesting < 1118376619 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :it gives the new text in an upper text area < 1118376624 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :and the old in a lower one < 1118376648 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :well, it works at least < 1118376650 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :that's cool though < 1118376652 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :yeah < 1118376656 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :it's enough.. < 1118376671 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :at least EsoShell can know that there was a conflict and work with it < 1118376688 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :and it's good because people won't be ablke to lock others out < 1118377301 0 :wooby!unknown@unknown.invalid QUIT : < 1118377557 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :graue: just did a quick test < 1118377578 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :graue: as long as the page I'm reading is from the same base url as the applet, I can read it < 1118377615 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :so, I could read http://lilly.csoft.net/~jeffryj, even though the applet started from http://lilly.csoft.net/~jeffryj/EsoShell < 1118377626 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :I could not, however, read http://www.google.com < 1118377674 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :is that going to be an issue at all with what you had in mind for setup? < 1118377755 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :actually.. even if it is, it's cool and I want to write it anyways.. hehe < 1118377916 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :huh.. weird.. when I view source on the wiki, I don't get everything < 1118377951 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :nm.. must be blind < 1118377983 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :
how convienient! < 1118378076 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :any thoughts on how to wrap the filename and source? need to think about 2d languages, whitespace.. etc :) gotta run < 1118378082 0 :calamari!unknown@unknown.invalid QUIT :"Leaving" < 1118378501 0 :wooby!~wooby@cpe-065-191-186-247.nc.res.rr.com JOIN :#esoteric < 1118379097 0 :GregorR!unknown@unknown.invalid QUIT :Nick collision from services. < 1118379125 0 :wooby!unknown@unknown.invalid QUIT : < 1118379127 0 :GregorR!~GregorR@c-24-21-138-66.hsd1.or.comcast.net JOIN :#esoteric < 1118381181 0 :malaprop!unknown@unknown.invalid QUIT :"sleep" < 1118381289 0 :graue!unknown@unknown.invalid PART #esoteric :? < 1118383433 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :Bwarhar < 1118385931 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :okay < 1118386177 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric ::P < 1118389334 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :esoshell page crashed firefox < 1118390399 0 :clog!unknown@unknown.invalid QUIT :ended < 1118390400 0 :clog!unknown@unknown.invalid JOIN :#esoteric < 1118398702 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :good morning < 1118398710 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :i felt asleep :D < 1118398732 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :i just went to bed for a while and slept ~11 hours < 1118398741 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric ::\ < 1118399398 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :hi, seems that I missed an important conversation about 8 hours ago < 1118399470 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :lament: are you using multiple profiles simultaneously? my mozilla crashes if I don't open the java applet in the main profile < 1118399496 0 :sp3tt!~chatzilla@lite-148-133.umenet.net JOIN :#esoteric < 1118399712 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :no, i'm not < 1118400022 0 :Dc[Fkn3]!~aa@pcp07730155pcs.nrockv01.md.comcast.net JOIN :#esoteric < 1118400036 0 :Dc[Fkn3]!unknown@unknown.invalid PART #esoteric :? < 1118400133 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :what was the conversation about? < 1118400194 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :Keymaker: about esolangs and the wiki < 1118400282 0 :sp3tt!unknown@unknown.invalid QUIT :brown.freenode.net irc.freenode.net < 1118400318 0 :sp3tt!~chatzilla@lite-148-133.umenet.net JOIN :#esoteric < 1118400362 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :I think that graue's idea of a separate namespace is a nice solution for everyone < 1118400522 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :I personally like most of the current directions of the wiki, and given that a solution that is universally accepted is impossible, I think that that's about the best that we can have < 1118400540 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :yeah, I think it's a neat idea < 1118400542 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :except for the backups, but that's currently being worked on < 1118400766 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :that said, there's an issue with the files section that needs a solution: some esolang authors may disagree with their distributions being hosted there, so permission should be gathered before posting files there (those which are explicitly FOSS don't need a permission, I think) < 1118400818 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :that's about the only showstopper for the preservation effort < 1118400819 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :though you'll want to tag them with whatever the correct license is < 1118400857 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :isn't that usually included within the distribution? < 1118400871 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :good point... maybe a generic tag that says "this file is not necessarily within the public domain" < 1118400888 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :hm, yeah < 1118400955 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :the script that gathers the svn head and makes it public could perhaps add such a tag < 1118400976 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :with "makes it public" I mean in the files/ dir < 1118401399 0 :Keymaker!unknown@unknown.invalid QUIT :"I've seen this déjà vu before.." < 1118401446 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :one more issue about the "java on the wiki" (hope it can be sorted out): I don't like everyone being able to upload and use java applets in every page; that should be restricted to privileged users or something < 1118405290 0 :kipple!~kipple@163.80-202-100.nextgentel.com JOIN :#esoteric < 1118405743 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :pgimeno: I agree that java applets upload should be restricted < 1118405802 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :otherwise, it seems like a lot happened here while I was asleep :) I like the ideas for the EsoShell that came up! < 1118405823 0 :sp3tt!unknown@unknown.invalid PRIVMSG #esoteric :EsoShell? < 1118405831 0 :sp3tt!unknown@unknown.invalid PRIVMSG #esoteric :You mean like... command.com? < 1118405910 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :no, I mean this: http://lilly.csoft.net/~jeffryj/EsoShell/ < 1118407332 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :kipple: nice, seems that there's consensus after all < 1118407614 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :yay, I've managed to fix the fibonacci generator in piet without modifying the whole program (white cells are cool) < 1118407699 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :now it turns out that 100 Fibonacci numbers are too much for the range of an int < 1118408511 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :http://www.formauri.es/personal/pgimeno/temp/piet/fib.php < 1118408521 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :err < 1118408524 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :http://www.formauri.es/personal/pgimeno/temp/piet/fib2.php < 1118408843 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :damn, the colors are not equal < 1118408854 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :equal? < 1118408885 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :seen the page? when I compare the original and mine, I see different colors < 1118408892 0 :malaprop!~ph@ppp-68-251-59-237.dsl.chcgil.ameritech.net JOIN :#esoteric < 1118408895 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :probably a gAMA chunk < 1118408937 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :yes, there are some minor differences. does it matter, as long as it works? < 1118408960 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :not at all, but I'd like equal colors to match for proper comparison < 1118408975 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :gAMA chunks don't alter the RGB of each color < 1118409546 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :indeed, that was because of a gAMA chunk present in the original; now I've uploaded the fixed version < 1118409568 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :corrected and resubnitted ;) < 1118409737 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :so, what was the conclusion? is npiet implemented correctly? < 1118409907 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :I think so < 1118409933 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :that's not actually related to the program itself; DMM said he didn't have an opportunity of testing it < 1118409943 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :he wrote it without the help of an interpreter < 1118410020 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :that program won't work in the perl interpreter because of the handling of white blocks though < 1118410026 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :yes. that's a useful tool for checking if the language design is ok, before implementing it < 1118410046 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :ok. so is the perl interpreter wrong then? < 1118410096 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :I think so; the spec is pretty clear and even if there's a bit of room for reinterpretation I think it's too forced to interpret that in the way that the perl interpreter does < 1118410144 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :anyway, fixing it is just a matter of adding a pixel :) < 1118410150 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :so I think I'll do that < 1118410265 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :hm, I'm wrong, it's two pixels < 1118411428 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :resubnitted < 1118411450 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :that one should work with the perl interpreter too < 1118411645 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :I'm not totally sure though < 1118412369 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :the issue with npiet is that cells are 32-bit integers instead of bignums, so fibonacci numbers greater than the 45th one don't come out well < 1118412382 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :does perl handle bignums? < 1118412459 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :without the aid of a library, that is < 1118413550 0 :fizzie!unknown@unknown.invalid PRIVMSG #esoteric :As far as I know, it doesn't. The bitwise operators use integers (32-bit here), and afaik most arithmetic is done using floats. < 1118413583 0 :fizzie!unknown@unknown.invalid PRIVMSG #esoteric :Judging from what 'man perlop' says about Integer Arithmetic. < 1118413664 0 :fizzie!unknown@unknown.invalid PRIVMSG #esoteric :Although Math::BigInt apparently is part of the standard. < 1118414776 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :thanks; I don't know if the perl interpreter uses that < 1118419121 0 :Keymaker!~Not@wire74.adsl.netsonic.fi JOIN :#esoteric < 1118419136 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :hi. < 1118419208 0 :puzzlet!unknown@unknown.invalid PRIVMSG #esoteric :low. < 1118419843 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric ::) < 1118420833 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :is piet turing complete? < 1118420847 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :i'm too lazy to search information by myself < 1118420917 0 :puzzlet!unknown@unknown.invalid PRIVMSG #esoteric :i'm lazy too but i guess so < 1118420930 0 :puzzlet!unknown@unknown.invalid PRIVMSG #esoteric :just guessing < 1118420961 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :ok < 1118422691 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :I'm pretty sure it is < 1118422794 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :at least if the stack is able to hold bignums < 1118422840 0 :puzzlet!unknown@unknown.invalid PRIVMSG #esoteric :And you have infinitely extendable canvases to paint < 1118422856 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :that's not needed, I think < 1118422902 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :as soon as you have a canvas with an UTM program in it, you have a Turing-complete language < 1118423062 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :I would have said that it's a pushdown automaton, but I recently saw that BF just needs a few (5 at most, 2 at least) cells with arbitrary integers in them to be TC < 1118423076 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :http://www.esolangs.org/wiki/Brainfuck#Computational_class < 1118423126 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :and the stack rotate operation makes Piet able to handle the stack as a finite amount of variables < 1118423141 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :hm, that should be stated in the wiki < 1118423158 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :I'll go for it < 1118423565 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :the stuff in esowiki is interesting < 1118423589 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :it'll be quite cool afterall! :) < 1118424422 0 :graue!~graue@ip68-100-130-21.dc.dc.cox.net JOIN :#esoteric < 1118424935 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :lament: is that 'smallfuck to smetana' stuff anywhere? < 1118424942 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :or have you written anything about it? < 1118424950 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :i'd be interested in reading < 1118425801 0 :calamari_!~jeffryj@lilly.csoft.net JOIN :#esoteric < 1118425807 0 :calamari_!unknown@unknown.invalid PRIVMSG #esoteric :hi < 1118425940 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :'ello < 1118426039 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :oy < 1118426045 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :hi < 1118426056 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :can one just edit the esolangs wiki? < 1118426062 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :i'd like to add some stuff < 1118426065 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :please do! < 1118426089 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :ok. i'll do so. after the dinner ;) < 1118426090 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :it is nice if you create an account before editing, but not mandatory < 1118426095 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :ok < 1118426100 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :i'll do that < 1118426290 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :i brought the dinner here :) < 1118426333 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :please avoid food stains on wiki articles < 1118426347 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :oops too late :) < 1118427202 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :by the way, is it allowed edit User:Keymaker page? :) < 1118427211 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :yes < 1118427223 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :hah < 1118427228 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :then i'll modify < 1118427310 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :you can edit practically any page (including other users' pages) < 1118427465 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :yes < 1118427465 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :but i meant that is it ok if edit it.. < 1118427465 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :that you people don't count it as self-advertising or anything < 1118427465 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :(only linkin' two of my websites ;)) < 1118427499 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :that's what the user pages are for! don't expect that anyone else will edit it < 1118427559 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :do you have user page? < 1118427564 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :(haven't checked) < 1118427608 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :http://esoteric.voxelperfect.net/wiki/Special:Listusers < 1118427608 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :http://www.esolangs.org/wiki/User:Keymaker < 1118427626 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :cool < 1118427639 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :(i meant your link) < 1118429296 0 :calamari_!unknown@unknown.invalid PRIVMSG #esoteric :Keymaker: here is what you probably shouldn't do: http://esoteric.voxelperfect.net/wiki/User:Calamari how's that for overdoing it? :) < 1118429462 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :hehe < 1118429465 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :I think that is a nice user page. < 1118429469 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :yeah < 1118429472 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :i added a new page: < 1118429473 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :http://www.esolangs.org/wiki/Hello < 1118429514 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :Keymaker: http://z3.ca/~lament/smetana_sf.tar.z < 1118429516 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :oops < 1118429519 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :Keymaker: http://z3.ca/~lament/smetana_sf.tar.gz < 1118429559 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :cheers < 1118429591 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :Hah. Who needs Hello when we have HQ9+ ? ;) < 1118429667 0 :calamari_!unknown@unknown.invalid PRIVMSG #esoteric :hq9+ was great :) < 1118429680 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :I just checked out Hello's home page and thought: "what? an esolang made by a woman? can it be?" < 1118429690 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :but it wasn't < 1118429700 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :yeah. just a guy named Anne < 1118429732 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :too bad, i was almost contacting the person until i read that :) < 1118429743 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :if I was nammed anne I'd make esolangs too < 1118429824 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :esolangs are an exclusively male activity < 1118429825 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :very macho < 1118429851 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :well, most of you guys (okay, me too) have nicks which makes it impossible to know your gender, so maybe there are some women here as well... I've just assumed you're all male (probably very sexist of me) < 1118429895 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :lol @ lament :p < 1118429900 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric ::D < 1118429908 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :kipple: Or you've been on IRC for more than ten minutes. < 1118429928 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :heh < 1118429952 0 :calamari_!unknown@unknown.invalid PRIVMSG #esoteric :efnet has women < 1118429957 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :"IRC. The place where men are men, women are men, and 16 year old girls are FBI agents" < 1118429971 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :heh < 1118429975 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :case in point < 1118429975 0 :calamari_!unknown@unknown.invalid PRIVMSG #esoteric :hehehe < 1118429978 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :efnet doesn't have women :P < 1118429993 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :don't remember where that quote is from though < 1118429999 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :either the way, we need females here. < 1118430135 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :well, if there are any, I expect they pretend to be male. < 1118430155 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :Why pretend? Folks will assume just fine on their own. < 1118430167 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :touche < 1118430832 0 :calamari_!unknown@unknown.invalid PRIVMSG #esoteric :so, I'm curious.. how can we display a whitespace program on the wiki without using images? < 1118430875 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :I'm not sure you can < 1118430879 0 :calamari_!unknown@unknown.invalid PRIVMSG #esoteric :I could invent some kind of escape code, but that wouldn't work well for a 2-d whitespace, if there is ever such a thing < 1118430909 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :um < 1118430914 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :there're women on IRC < 1118430921 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :there even are women on Freenode < 1118430935 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :but to expect women in #esoteric is clearly a bit too much < 1118430942 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric ::) < 1118431016 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :It would be possible, but I don't think you ought to. < 1118431080 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :That is, with whitepsace. < 1118431089 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :Gregor: you are the only one here who explicitly identifies yourself as a male. Got something to hide??? ;) < 1118431109 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :ACTION detaches his/her artifificial penis < 1118431125 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :ah, you were talking about whitespace :) < 1118431148 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :cpressey is a known male :P < 1118431164 0 :calamari_!unknown@unknown.invalid PRIVMSG #esoteric :gregorR: I'd like to automatically feed programs from the wiki into esoshell.. but does the wiki allow arbitrary chars like that? < 1118431181 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :Ahh, I see. Doubtful. < 1118431208 0 :calamari_!unknown@unknown.invalid PRIVMSG #esoteric :how about a mini preprocessor table at the top.. so that you could set a=" ", b="\n", etc < 1118431209 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :I don't know, I guess ... If there's some equiv. to
, it should be happy.
< 1118431211 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :maybe there is some 
 equivalent?
< 1118431219 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :Ahahaha :P
< 1118431222 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :great minds, etc...
< 1118431223 0 :calamari_!unknown@unknown.invalid PRIVMSG #esoteric :maybe, that would definitely be best
< 1118431291 0 :calamari_!unknown@unknown.invalid PRIVMSG #esoteric :anyone remember how to set expert mode in ircii?  
< 1118431323 0 :calamari_!unknown@unknown.invalid PRIVMSG #esoteric :I guess since I don't remember means I am non-expert.. so.. brb :)
< 1118431332 0 :calamari_!unknown@unknown.invalid PART #esoteric :?
< 1118431444 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :this esolang wiki editing is fun
< 1118431519 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :
 works!!!
< 1118431532 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :does it maintain TAB characters?
< 1118431593 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :yes
< 1118431601 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :see test here: http://esoteric.voxelperfect.net/wiki/User:Rune
< 1118431656 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :you can't enter tabs directly in the editor (at least not in my browser), but pasting works fine
< 1118431712 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :Keymaker: how exactly does the digital root thing work?
< 1118431719 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :cause it doesn't do anything
< 1118431839 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :oh, i see
< 1118431842 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :you had DOS linebreaks
< 1118432206 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :mh where?
< 1118432218 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :digitalr.t
< 1118432221 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :ah
< 1118432222 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :yes
< 1118432234 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :they were breaking the interpreter
< 1118432241 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :i used the ready-compiled dos interpreter
< 1118432241 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :presumably it works in windows
< 1118432246 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :oh
< 1118432249 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :i was using the python one
< 1118432252 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :ok
< 1118432261 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :(is it the same one?)
< 1118432267 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :i don't think so
< 1118432276 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :iirc it was in original thue package
< 1118432327 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :ah
< 1118432346 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :indeed, yes
< 1118432367 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :the code should be fine
< 1118432375 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :(digitalr.t)
< 1118432423 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :anybody know if whitespace it TC?
< 1118432423 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :yeah
< 1118432428 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :it works after i changed the linebreaks
< 1118432432 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :ok
< 1118432443 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :interpreter's fault :)
< 1118432505 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :well, you can't expect any reasonable piece of software to recognize dos linebreaks :)
< 1118432559 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :yes
< 1118432560 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :true
< 1118432571 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric ::)
< 1118432647 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :but dos linebreaks include char #10, so it should work on most systems, no?
< 1118432691 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :kipple: what should work?
< 1118432704 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :dos linebreaks...
< 1118432727 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :kipple: no, dos linebreaks will work on dos and on especially forgiving editors on real operating systems
< 1118432761 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :But a whitespace nterpreter should read: \r - this must be a comment, ignore ... \n - line break
< 1118432765 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :And hence work regardless.
< 1118432782 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :yes. exaclty my point
< 1118432785 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :(Well, unless you use MacOS <=9 linebreaks)
< 1118432802 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :did they change it in OS X ?
< 1118432810 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :Yeah, it's UNIX linebreaks now.
< 1118432827 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :nice. If only MS would do the same
< 1118432841 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :No, they're just going to make them longer :P
< 1118432857 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :GregorR: neither 0xA or 0xD are named "line break". 0xD is Unix is carriage return. 0xA is line feed.
< 1118432859 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :It'll be CR-LF-PageB-tab-tab-space-lf
< 1118432866 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :and \n = 0xD
< 1118432899 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :malaprop: From a UNIX-centric whitespace nterpreters standpoint, \n = linebreak.
< 1118432904 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :That's what I meant.
< 1118432917 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :ok
< 1118434628 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :i made a logo for esowiki, featuring esododo:
< 1118434629 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :http://koti.mbnet.fi/yiap/stuff/esolang.png
< 1118434649 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :(although the creature doesn't probably look like dodo)
< 1118434652 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :hey! the dodo is back :)
< 1118434668 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric ::)
< 1118434726 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :i just thought it could be fun/look nice. i don't like that yellow flower so much
< 1118434770 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :Keymaker: The yellow flower is the logo for MediaWiki.
< 1118434775 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :yeah. several people have been making logo suggestions. maybe we should have a contest
< 1118434813 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :ok
< 1118434825 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :btw, anyone got link?
< 1118435039 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :pgimeno has been using piet programs
< 1118435060 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :ah yes
< 1118435063 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :saw one today
< 1118435068 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :I think he meant to use the fibonacci program, but the eso-program would be much better IMHO
< 1118435073 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :did you see that?
< 1118435074 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :hmm.. what about random logo?
< 1118435085 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :yeah
< 1118435093 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :random logo could be nice
< 1118435095 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :kipple, i like your last spoof
< 1118435115 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :I made some spoofs of the wikimedia logo: http://rune.krokodille.com/lang/logos.html
< 1118435126 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :yeah, and i like the fourth one
< 1118435138 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :yes, I've heard, graue :)
< 1118435177 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :there are a lot of variations that could be done with that theme...
< 1118435189 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :why does the dodo face away from the page?
< 1118435202 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :it'd be looking off the side of the screen
< 1118435218 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :well, dodos are stupid birds... :)
< 1118435298 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :and the other reason is i simply just can't draw anything :D
< 1118435420 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :sorry for the late answer, got an unexpected visit of my parents right after pressing enter in the last line I wrote
< 1118435437 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric ::)
< 1118435482 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :I have both corrected DMM's Fibonacci program in Piet and created one which reads (and prints) "ESO" but then don't need to be used as logos
< 1118435494 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :s/then/they/
< 1118435518 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :http://www.formauri.es/personal/pgimeno/temp/piet/fib2.php
< 1118435529 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :http://www.formauri.es/personal/pgimeno/temp/eso.png
< 1118435543 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :argh, broken, hold a sec
< 1118435546 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :someone needs to make a three instruction language: [, ], and yellow flower
< 1118435554 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :then we can say the mediawiki logo is a program
< 1118435556 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :hahaha
< 1118435573 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :the lang could be called Flower Power
< 1118435576 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :http://www.formauri.es/personal/pgimeno/temp/eso-big.png
< 1118435894 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :the eso logo is really nice
< 1118435903 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :hehe. mmh flower power..
< 1118435997 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :thanks
< 1118436051 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :it can be reduced at will; it's not fixed-size (though an integral number of pixels per codel is recommended)
< 1118436137 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :graue: can file upload permissions be established?
< 1118436204 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :ACTION goes trying to make music
< 1118436214 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :(with 'buzz' tracker)
< 1118436377 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :pgimeno, er what?
< 1118436408 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :for the wiki, I mean
< 1118436454 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :it's not permitting you to upload?
< 1118436470 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :I've been reading yesterday's log about the possibility of a separate namespace for EsoShell
< 1118436491 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :I like the idea very much but I don't like everyone being able to upload and post java files
< 1118436629 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :so if file permissions can be established for some users I think that will be safe
< 1118437137 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :yes. it should be restricted to admins
< 1118437193 0 :calamari_!~jeffryj@lilly.csoft.net JOIN :#esoteric
< 1118437194 0 :calamari_!unknown@unknown.invalid PRIVMSG #esoteric :re's
< 1118437512 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :hi calamari_ 
< 1118437522 0 :calamari_!unknown@unknown.invalid PRIVMSG #esoteric :hi pgimeno :)
< 1118439063 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :rgh..
< 1118439067 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :making music is so hard
< 1118439071 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :better just listen :)
< 1118439119 0 :sp3tt!unknown@unknown.invalid QUIT :Read error: 54 (Connection reset by peer)
< 1118439990 0 :calamari_!unknown@unknown.invalid PRIVMSG #esoteric :keymaker: what type of music are you composing?
< 1118440068 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :dunno could one call it composing..
< 1118440073 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :well, hard to tell
< 1118440118 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :monotrack/schranz
< 1118440143 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :with industrial flavour
< 1118440205 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :sounds interesting
< 1118440215 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :hope so
< 1118440220 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :only song i've finished
< 1118440225 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :is about half a year old
< 1118440233 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :and made with different program; modplug
< 1118440249 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :it's called "radiation machine"
< 1118440273 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :it's monotrack
< 1118440287 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :i guess i could upload it if you want to hear it.
< 1118440375 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :oh. and the track must be heard loud. if you listen that one low it doesn't sound good. preferably with good speakers
< 1118440389 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :you gotta feel the bass
< 1118440397 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :yeah
< 1118440411 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :it isn't very danceable, i warn
< 1118440418 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :but ok, i'll upload it now
< 1118440443 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :thanks
< 1118440502 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :i'm now uploading, takes a while
< 1118440524 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :sure, don't worry
< 1118440539 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :as i haven't made up any artist name the artist is "factory esthetic".. :\
< 1118440549 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :(so don't care about crappy naming!)
< 1118440564 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :heh
< 1118440569 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :as well, the file is "radiation beta" although it's done :)
< 1118440590 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :I have just an unfinished one
< 1118440602 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :music?
< 1118440609 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :yes, module
< 1118440616 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :ok
< 1118440636 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :I ran out of ideas :)
< 1118440656 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric ::)
< 1118440659 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :ok, here it is:
< 1118440660 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :http://koti.mbnet.fi/yiap/stuff/radiation beta.mp3
< 1118440692 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :as warning, again, it's not very good!
< 1118440704 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :why don't you upload the module?
< 1118440721 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :because i have added some effects with audacity
< 1118440732 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :that's cheating
< 1118440736 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :add the effects properly
< 1118440745 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :i can't. don't listen then :p
< 1118440775 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :graue: so, about the permissions...?
< 1118440794 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :i don't think that's possible
< 1118440809 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :umm
< 1118440861 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :that's a problem IMO
< 1118440902 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :can a wiki page hold a java program that is not an uploaded file?
< 1118440922 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :i.e. in a different URL (the files section)
< 1118440945 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :(np: factory esthetic - radiation machine)
< 1118440954 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :?
< 1118440960 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :ah now playing..
< 1118441005 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :sounds good
< 1118441010 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :thanks!
< 1118441066 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :maybe a bit too exaggerated the bass IMO, unless you want to break my window :)
< 1118441072 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :haha :)
< 1118441167 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :cool
< 1118441175 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :cheers :)
< 1118441182 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :I like it
< 1118441185 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :i like the ending "sequence"
< 1118441191 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :like where the beeps go off
< 1118441204 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :can't explain..
< 1118441210 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :pgimeno, possibly
< 1118441250 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :that'd be safe enough (for me at least)
< 1118441298 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :Keymaker: you can hardly explain music, if at all
< 1118441317 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :true
< 1118441320 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :but yeah, the ending sounds good
< 1118441353 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric ::)
< 1118441663 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :hmm
< 1118441675 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :i should start making some content to bf-hacks.org
< 1118441682 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :new program or some text
< 1118441698 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :but i'm not that good writing about math/computer subjects..
< 1118441710 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :so perhaps i'll just program something
< 1118441724 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :or then start writing the first issue of the brainfuck magazine
< 1118441741 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :either the way, i'll switch to linux now, takes some mins..
< 1118441743 0 :Keymaker!unknown@unknown.invalid QUIT :"I've seen this déjà vu before.."
< 1118442020 0 :Keymaker!~a@wire74.adsl.netsonic.fi JOIN :#esoteric
< 1118442028 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :hmm
< 1118442394 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :can't invent name..
< 1118443812 0 :calamari_!unknown@unknown.invalid PART #esoteric :?
< 1118443824 0 :calamari_!~jeffryj@lilly.csoft.net JOIN :#esoteric
< 1118443955 0 :calamari_!unknown@unknown.invalid PRIVMSG #esoteric :ACTION reads scrollback
< 1118444001 0 :calamari_!unknown@unknown.invalid PRIVMSG #esoteric :I don'tthink I'm following very well... but one thing for sure is that the class file and wiki pages need to be at the same url, or Java freaks out with security exceptions
< 1118444027 0 :calamari_!unknown@unknown.invalid PRIVMSG #esoteric :anything at the same url is fine, but if the url changes any, Java won't allow it
< 1118444039 0 :calamari_!unknown@unknown.invalid PRIVMSG #esoteric :err host I should say, not url
< 1118444051 0 :calamari_!unknown@unknown.invalid PRIVMSG #esoteric :is the host going to change?
< 1118444105 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :ah, no it isn't
< 1118444110 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :I think they can be made relative
< 1118444158 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :the only issue with that is that there are two possible servers for the URLs: www.esolangs.org and esoteric.voxelperfect.net
< 1118444166 0 :calamari_!unknown@unknown.invalid PRIVMSG #esoteric :then I think we're okay.. the current class file prints a bunch of html garbage.. that is http://lilly.csoft.net/~jeffryj  but the class file was run from EsoShell/
< 1118444187 0 :calamari_!unknown@unknown.invalid PRIVMSG #esoteric :pgimeno: as long as the redirect happens before the java file runs, it's okay
< 1118444198 0 :calamari_!unknown@unknown.invalid PRIVMSG #esoteric :for example, try http://kidsquid.com/EsoShell
< 1118444205 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :only if they can be really relative
< 1118444217 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :they're not redirects
< 1118444218 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :otherwise that's an issue
< 1118444226 0 :calamari_!unknown@unknown.invalid PRIVMSG #esoteric :yeah, won't they be?
< 1118444239 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :can you examine the host that was given in the http request?
< 1118444273 0 :calamari_!unknown@unknown.invalid PRIVMSG #esoteric :graue: Java doesn't care what I look at.. once it makes up its own mind, we're stuck with that decision, afaik
< 1118444289 0 :calamari_!unknown@unknown.invalid PRIVMSG #esoteric :see what I'm saying?
< 1118444306 0 :calamari_!unknown@unknown.invalid PRIVMSG #esoteric :it decides what the codebase is
< 1118444311 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :graue: my concern is just if the  or  or whatever tag is used allows relative paths; if that's possible then there's no issue, and I'm pretty sure it is
< 1118444318 0 :calamari_!unknown@unknown.invalid PRIVMSG #esoteric :actually.. hmmm 
< 1118444328 0 :calamari_!unknown@unknown.invalid PRIVMSG #esoteric :in the html, it is possible to specify the codebase
< 1118444341 0 :calamari_!unknown@unknown.invalid PRIVMSG #esoteric :so I can tell it the codebase is on a different host than the html
< 1118444358 0 :calamari_!unknown@unknown.invalid PRIVMSG #esoteric :that can work.. as long as the code is actually where I'm telling it
< 1118444367 0 :calamari_!unknown@unknown.invalid PRIVMSG #esoteric :anyways.. I need to get going
< 1118444370 0 :calamari_!unknown@unknown.invalid PRIVMSG #esoteric :bbl
< 1118444371 0 :calamari_!unknown@unknown.invalid QUIT :"Leaving"
< 1118444922 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :wow
< 1118444925 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :this is crazy
< 1118444978 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :http://www.de.ioccc.org/2004/gavare.c
< 1118444983 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :IOCCC entry
< 1118444999 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :it creates a bmp
< 1118445007 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :like it's a raytracer
< 1118445014 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :amazing
< 1118445503 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :is that valid C?
< 1118445519 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :dunno, it gave me couple of warnings
< 1118445523 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :but not errors :)
< 1118445557 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :wow
< 1118445564 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :indeed
< 1118445573 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :we need similar program in brainfuck ;)
< 1118445582 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :the variables aren't even typed...
< 1118445598 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :do they default to int then?
< 1118445605 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :have you ran the program?
< 1118445609 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :no
< 1118445611 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :ok
< 1118445613 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :try it out
< 1118445617 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :I will
< 1118445627 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :and i don't know, probably they default to int
< 1118445640 0 :fizzie!unknown@unknown.invalid PRIVMSG #esoteric :Untyped variables are ints.
< 1118445641 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :something about int was said at ioccc iirc
< 1118445654 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :ok
< 1118445674 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :variables only default to int in C89 and C95
< 1118445678 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :in C99, that program would be invalid
< 1118445708 0 :fizzie!unknown@unknown.invalid PRIVMSG #esoteric :One of my homework exercise solutions used untyped variables.
< 1118445734 0 :fizzie!unknown@unknown.invalid PRIVMSG #esoteric :a,b=0;main(){read(0,&a,1)?b=b*2|a&1,main():printf("%u",b);}
< 1118445764 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :great
< 1118445764 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :Keymaker: did it take long to run on you rcomputer?
< 1118445797 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :not long
< 1118445802 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :maybe about minute or two
< 1118445813 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :maybe three
< 1118445823 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :well, my linux box is 187 MHz, so I guess I'll wait...
< 1118445828 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :yeah :)
< 1118445834 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :do you think we should have articles for language inventors on the wiki?
< 1118445845 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :do you know what the A parameter is for?
< 1118445847 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :or then you can terminate the program and change the values in the beginning of the code
< 1118445852 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :to get smaller picture
< 1118445859 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :(less time, less space ;))
< 1118445868 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :isn't that the X and Y params?
< 1118445877 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :and no idea about A
< 1118445886 0 :fizzie!unknown@unknown.invalid PRIVMSG #esoteric :The 'A' value is an anti-alias factor. Setting it to 1 disables the anti-aliasing feature (this makes the output look bad), but setting it too high makes the trace take a lot more time to complete.
< 1118445891 0 :fizzie!unknown@unknown.invalid PRIVMSG #esoteric :http://www.ioccc.org/2004/gavare.hint
< 1118445916 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :so just make x and y smaller
< 1118446010 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :graue: perhaps some of them
< 1118446022 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :like urban müller!
< 1118446030 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :and cpressey seemed to be
< 1118446032 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :but is there really much to say?
< 1118446035 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :wanted on the list
< 1118446036 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :of
< 1118446042 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :(no :))
< 1118446045 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :something
< 1118446049 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :can't remember
< 1118446060 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :probably it was "wanted pages"
< 1118446062 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :a short paragraph about Urban could be on the BF page
< 1118446064 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :or something
< 1118446092 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :yeah. well, seems to be we don't know much about this genius
< 1118446100 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :but i'm gonna find out someday
< 1118446105 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :by sending e-mail :)
< 1118447688 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :http://www.esolangs.org/wiki/Esolang:Authors
< 1118447692 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :discuss
< 1118449853 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :lalala
< 1118451118 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :graue: any progress on the automated DB backup?
< 1118453788 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :i'm waiting for lock tables permission
< 1118453799 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :supposedly it can be provided to me
< 1118456194 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :http://esoteric.voxelperfect.net/db/latest.sql.bz2
< 1118456317 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :it should now update on sundays at about 00:01 UTC, maybe a little later
< 1118456390 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :great
< 1118456422 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :ACTION sets up a mirroring script.
< 1118456431 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :How about svn dump?
< 1118456605 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :um, just check it out
< 1118456622 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :So you want me to start hassling you again as soon as someone commits a revision, eh? :)
< 1118459866 0 :calamari!~calamari@dialup-4.240.69.55.Dial1.Phoenix1.Level3.net JOIN :#esoteric
< 1118459901 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :hi
< 1118459918 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :Hullo
< 1118460970 0 :kipple!unknown@unknown.invalid QUIT :Read error: 110 (Connection timed out)
< 1118462396 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :graue: latest.sql.bz2 seems to be 0 bytes in length
< 1118462728 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :does it?
< 1118462731 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :brb investigating
< 1118462773 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :funny, it's 449514 bytes on the server
< 1118462791 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :I do 'wget http://esoteric.voxelperfect.net/db/latest.sql.bz2' and get http 200 but 0 bytes.
< 1118462808 0 :CXI!unknown@unknown.invalid QUIT :Connection timed out
< 1118462824 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :yeah, me too
< 1118463337 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :try http://esoteric.voxelperfect.net/db/latest.sql.gz
< 1118463377 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :still 0b
< 1118463407 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :really? works for me
< 1118463439 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :Really, from two different systems.
< 1118463537 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :well, seeing as how it works fine for me, i can't do anything about that
< 1118463585 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :Are you trying from that machine itself?
< 1118463713 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :no, i am not
< 1118463794 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :Works fine for me.
< 1118463868 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :doesn't work even from a new, third host
< 1118463996 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :ah, hm, .gz works but .bz2 is 0b?
< 1118464005 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :ACTION didn't notice the changed extension at first.
< 1118464051 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :ah, that's why i gave you a url :)
< 1118464079 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :It looked the same at first glance, heh. Why gz instead of bz2?
< 1118464167 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :because gz files don't get served as 0 bytes
< 1118464209 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :lol
< 1118464542 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :I've got a cron job and simple page set up, I'll post to the mailing list after dns propagates a bit.
< 1118466986 0 :malaprop!unknown@unknown.invalid QUIT :"quit"
< 1118467664 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :esoshell wiki writing testbed: http://lilly.csoft.net/~jeffryj/cgi-bin/miniwiki.cgi
< 1118468062 0 :Keymaker!unknown@unknown.invalid PART #esoteric :?
< 1118469012 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :what does that do, just change itself?
< 1118469890 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :graue: yeah.. it's handy because I can access it from lilly.csoft.net while testing out the wiki file i/o
< 1118469928 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :since Java has those security restrictions
< 1118469932 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :ah, i see
< 1118470096 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :graue: I still haven't decided on the format.. what do you think of what I just added?
< 1118470142 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :works i guess
< 1118470157 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :not very pretty, though :)
< 1118470173 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :you will have to escape < into <
< 1118470190 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :even inside pre?
< 1118470196 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :yeah
< 1118470205 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :how else do you think "" works?
< 1118470211 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :heheh
< 1118470304 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :that might get annoying for authors typing in programs by hand, or pasting them in
< 1118470349 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :most text editors have find and replace
< 1118470400 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :aha.. mediawiki takes care of that for us
< 1118470411 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :hmm, a brainfuck and html polyglot would be fun
< 1118470429 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :except that it's not possible because html has to have < before any >s
< 1118470438 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :
< 1118470452 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :You can put < and > in those, just not -->
< 1118470465 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :that < will be illegal in brainfuck since it goes to cell -1
< 1118470469 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :graue: I might not understand.. I did 
 <<< 
and mediawiki translated the < to < < 1118470479 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :calamari, cool < 1118470501 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :what if you do
  
? < 1118470532 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :works fine < 1118470540 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :interesting < 1118470567 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :I guess the only restriction is that the file couldn't contain < 1118470597 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :I'm not sure that's such a big deal :) < 1118470610 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :nope < 1118470624 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :Damn, that first < think is a real toughy XD < 1118470642 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :If you started with >++ you'd be fine, but that may make it unhappy ... it would probably be illegal HTML, technically. < 1118470736 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :GregorR: I'll be stripping off the
 and 
before bf sees it < 1118470816 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :calamari: I was referring to the HTML-BF polyglot < 1118470887 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :GregorR: aha :) < 1118472125 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :graue: http://esoteric.voxelperfect.net/wiki/Help:Editing has no help documents.. is this a work in progress? < 1118472169 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :calamari, how did you get there? < 1118472226 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :graue: any edit page, click down at the bottom where it says (Editing Help) opens in new window < 1118472240 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :err, have the parens wrong.. but that's the idea :) < 1118472353 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :http://esoteric.voxelperfect.net/wiki/Help:Contents also < 1118472364 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :that's any page click "Help" on the left < 1118473016 0 :CXI!~Sanity@dialup-89.105.221.203.acc51-kent-syd.comindico.com.au JOIN :#esoteric < 1118473557 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :god what is with all the redundant pages < 1118473587 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :i made an Esolang:Help, but Help:Editing and Help:Contents should just be the same thing < 1118473768 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :i redirected the other two now < 1118474167 0 :calamari_!~calamari@dialup-4.240.114.3.Dial1.Phoenix1.Level3.net JOIN :#esoteric < 1118474178 0 :calamari_!unknown@unknown.invalid PRIVMSG #esoteric :re's :) < 1118474473 0 :calamari_!unknown@unknown.invalid PRIVMSG #esoteric :graue: http://esoteric.voxelperfect.net/wiki/User_talk:Calamari < 1118474473 0 :calamari_!unknown@unknown.invalid PRIVMSG #esoteric :better, worse? < 1118474473 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :cool, it works < 1118474489 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :you can make user subpages < 1118474499 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :e.g. "User:Calamari/esoshell_tests" < 1118474501 0 :calamari_!unknown@unknown.invalid PRIVMSG #esoteric :argh, I messed up that link on the help page < 1118474512 0 :calamari_!unknown@unknown.invalid PRIVMSG #esoteric :oh yeah? I'll have to try that :) < 1118474536 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :oh god, man, you didn't read the page you were editing! < 1118474552 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :it clearly states that that section is called "External resource", not "External Links" :) < 1118474560 0 :calamari_!unknown@unknown.invalid PRIVMSG #esoteric :graue: lol < 1118474686 0 :calamari_!unknown@unknown.invalid PRIVMSG #esoteric :oops, conflict < 1118474887 0 :calamari_!unknown@unknown.invalid PRIVMSG #esoteric :btw, can only admins revert pages? or is revert just a cute name for copying & pasting the old page back in? < 1118475133 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :revert is a cute name for changing a page back by whatever means, yes < 1118475153 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :however, admins get a convenient link to do this automatically, when looking at a diff < 1118475159 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :all it does is make it faster for them < 1118475180 0 :calamari!unknown@unknown.invalid QUIT :Connection timed out < 1118475489 0 :calamari_!unknown@unknown.invalid PRIVMSG #esoteric :hehe, having those file extensions is probably unnecessary :) < 1118475530 0 :calamari_!unknown@unknown.invalid PRIVMSG #esoteric :maybe a description area would be helpful too < 1118475575 0 :calamari_!unknown@unknown.invalid PRIVMSG #esoteric :I need to go to bed.. feel free to improve upon the current design < 1118475610 0 :calamari_!unknown@unknown.invalid QUIT :"Leaving" < 1118476481 0 :graue!unknown@unknown.invalid PART #esoteric :? < 1118476799 0 :clog!unknown@unknown.invalid QUIT :ended < 1118476800 0 :clog!unknown@unknown.invalid JOIN :#esoteric < 1118481341 0 :sp3tt!~chatzilla@cust-148-133.elhandel.umeaenergi.se JOIN :#esoteric < 1118481697 0 :sp3tt!unknown@unknown.invalid PRIVMSG #esoteric :Is it possible to do division in bf? < 1118481721 0 :puzzlet!unknown@unknown.invalid PRIVMSG #esoteric :i think so < 1118481774 0 :sp3tt!unknown@unknown.invalid PRIVMSG #esoteric :It should be possible using the same code as multiplication... < 1118481780 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :sp3tt: brainfuck is turing-complete < 1118481782 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :so yeah, it is :) < 1118481816 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :just need to know the algorithm... < 1118481885 0 :sp3tt!unknown@unknown.invalid PRIVMSG #esoteric :>+++++[<+++++++++>-] 5 * 9 < 1118481925 0 :puzzlet!unknown@unknown.invalid PRIVMSG #esoteric :iteratively subtracting until the number goes down to 0, and counting how many subtraction has been done? < 1118481938 0 :sp3tt!unknown@unknown.invalid PRIVMSG #esoteric :<[--------->>+<-<] < 1118481969 0 :sp3tt!unknown@unknown.invalid PRIVMSG #esoteric :That would divide by nine, but how do you handle situations where there is a remainder? I.e where x % y != 0. < 1118481978 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :[-[-[-[-[-[-[ < 1118481984 0 :puzzlet!unknown@unknown.invalid PRIVMSG #esoteric :yeah < 1118481998 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :but it's better to write a general algorithm < 1118482002 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :to divide X by Y < 1118482007 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :where X and Y are two numbers on the tape < 1118482026 0 :sp3tt!unknown@unknown.invalid PRIVMSG #esoteric :True. < 1118482091 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :implementing the algorithm is left as an exercise for the reader. < 1118482145 0 :sp3tt!unknown@unknown.invalid PRIVMSG #esoteric :Google search for brainfuck division turns up German wikipedia. < 1118482185 0 :sp3tt!unknown@unknown.invalid PRIVMSG #esoteric :Heh. I wrote a 5 page PDF about brainfuck (in Swedish) leaving Hello world as an exercise for the reader :) < 1118482232 0 :puzzlet!unknown@unknown.invalid PRIVMSG #esoteric :I have discovered a truly remarkable implementation, which this margin is too small to contain. < 1118482256 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :it certainly doesn't sound hard. just keep subtracting. < 1118482285 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :or store your numbers as rationals :) < 1118482295 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :then division is the same as multiplication < 1118482344 0 :sp3tt!unknown@unknown.invalid PRIVMSG #esoteric :One could write a nested loop, subtracting one until the cell contains 0. < 1118482376 0 :sp3tt!unknown@unknown.invalid PRIVMSG #esoteric :When the loop has subtracted one Y times, add one to a third cell. < 1118482400 0 :sp3tt!unknown@unknown.invalid PRIVMSG #esoteric :And when the loop is finished, calculate the remainder in some way. < 1118482458 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :the remainder will just sit there < 1118482464 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :in whatever cell you were using for subtraction < 1118483163 0 :sp3tt!unknown@unknown.invalid PRIVMSG #esoteric :That would require a check to see if y > x < 1118484715 0 :starling!~nobody@adsl-63-197-122-98.dsl.sktn01.pacbell.net JOIN :#esoteric < 1118484759 0 :starling!unknown@unknown.invalid QUIT :"pop" < 1118486357 0 :kipple!~kipple@163.80-202-100.nextgentel.com JOIN :#esoteric < 1118488088 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :moin < 1118489073 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :hola < 1118489556 0 :sp3tt!unknown@unknown.invalid QUIT :Read error: 104 (Connection reset by peer) < 1118491091 0 :Keymaker!~Not@wire74.adsl.netsonic.fi JOIN :#esoteric < 1118491101 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :rgrg < 1118491379 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :is that finnish for "hello"? < 1118491438 0 :fizzie!unknown@unknown.invalid PRIVMSG #esoteric :No, that would be "hei" or something. < 1118491454 0 :fizzie!unknown@unknown.invalid PRIVMSG #esoteric :"tervehdys", perhaps, although that's closer to 'greetings'. < 1118491479 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :you say "hei" in Finland as well? < 1118491494 0 :fizzie!unknown@unknown.invalid PRIVMSG #esoteric :Uh, yes. < 1118491519 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :In Norway too < 1118491593 0 :fizzie!unknown@unknown.invalid PRIVMSG #esoteric :It is an useful greeting when mingling with swedish-speaking folks, since their "hej" is pronounced quite similarly. < 1118491775 0 :fizzie!unknown@unknown.invalid PRIVMSG #esoteric :Away to eat now. -> < 1118492056 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :ah. hei kipple! < 1118492075 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :hei < 1118492079 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :heh < 1118492116 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :i found interesting site; http://freesound.iua.upf.edu/ < 1118492120 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :it has allkinds of sound samples < 1118492129 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :well, that was a nice small Finnish/Norgwegian polyglot conversation :) < 1118492182 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :haha < 1118493002 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :Keymaker: nice link < 1118493021 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :very nice, Keymaker! reminds me of the free images site... http://www.openclipart.org/ < 1118493078 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :thanks pgimeno! I like < 1118493502 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :np, enjoy the world of free resources :) < 1118493537 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :nice < 1118493561 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric ::) there's good machine sounds etc on that page.. that's what i was looking for and finally found a nice source :) < 1118493573 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :i'll try to get something done with some samples < 1118495025 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :Keymaker: what kind of software do you use for making music < 1118495312 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :i use buzz tracker < 1118495317 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :it's really cool imho < 1118495320 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :totally freeware < 1118495346 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :the only bad thing is that there is so much stuff that i don't know what to do < 1118495366 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :it's filled with allkinds of things and options < 1118495380 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :and audacity for sample stuff < 1118498863 0 :puzzlet!unknown@unknown.invalid QUIT :Read error: 104 (Connection reset by peer) < 1118499014 0 :puzzlet!~puzzlet@61.247.148.38 JOIN :#esoteric < 1118499384 0 :puzzlet!unknown@unknown.invalid QUIT :Read error: 104 (Connection reset by peer) < 1118500763 0 :puzzlet!~puzzlet@61.247.148.38 JOIN :#esoteric < 1118501511 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :ok that's enough musicing for today. < 1118501524 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :i lose my nerver < 1118501530 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :*nevers < 1118501533 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :fck < 1118501538 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :*nervers < 1118501541 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :*nerves < 1118501548 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :can't tpye < 1118501557 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :too nevrous? :) < 1118501557 0 :puzzlet!unknown@unknown.invalid PRIVMSG #esoteric :bad keyboard? < 1118501563 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric ::) < 1118501572 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :yes < 1118501586 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :the keyboard's fine < 1118501614 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :i'll go to eat. then i'll switch to linux. then me comes back. < 1118501620 0 :Keymaker!unknown@unknown.invalid QUIT :"I've seen this déjà vu before.." < 1118501870 0 :Keymaker!~a@wire74.adsl.netsonic.fi JOIN :#esoteric < 1118501906 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :rgh. so it is true: if you eat too much candy before the actual food you don't feel like eating the actual food < 1118501972 0 :puzzlet!unknown@unknown.invalid PRIVMSG #esoteric :you finished eating in 5 minutes? < 1118501986 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :no. i brought the dinner here again :) < 1118502111 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :i'll listen some prodigy. i hope i could make their kind of music a bit.. it's so crazy :) < 1118502698 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :i added bf-hacks to esowiki brainfuck links < 1118502706 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :hopefully nobody minds < 1118503676 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :i added two small sample programs to thue oage < 1118503679 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :*page < 1118503688 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :they should be correct, although i didn't test < 1118504618 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :you forgot to log in before editing... :) < 1118504647 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :aaaaaaaaargh < 1118504656 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :frrrrrgh < 1118504702 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :maybe the wiki should be editable for users only? < 1118504735 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :oops, iirc 'editable' means something that can be eaten :) < 1118504750 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :or perhaps not < 1118504752 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :no, that's edible < 1118504755 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :yes < 1118504761 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :just remembered that < 1118504768 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :i wonder what i'm thinking today < 1118504773 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :i've been all crazy < 1118504775 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric ::) < 1118504786 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :well, too bad the wiki isn't edible < 1118504822 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :only the chef programs < 1118504831 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric ::) < 1118504936 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :i'll try to think more about the snack language i was planning < 1118504940 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :ACTION thinks < 1118505794 0 :malaprop!~ph@ppp-68-251-59-237.dsl.chcgil.ameritech.net JOIN :#esoteric < 1118506220 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :yes! < 1118506272 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :i think i got some idea < 1118506272 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :time to write good ol' python < 1118506505 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :is 'snack' good name? any other idea for a language that deletes it's own code? < 1118506527 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :Keymaker: SourceSafe < 1118506535 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric ::D < 1118506555 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :or well, it doesn't delete the actual source from hard drive < 1118506558 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :(too bad!) < 1118506564 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :but from memory < 1118508418 0 :cpressey!unknown@unknown.invalid QUIT :brown.freenode.net irc.freenode.net < 1118508483 0 :cpressey!nobody@d154-20-76-195.bchsia.telus.net JOIN :#esoteric < 1118508664 0 :cpressey!unknown@unknown.invalid QUIT :brown.freenode.net irc.freenode.net < 1118508755 0 :cpressey!nobody@d154-20-76-195.bchsia.telus.net JOIN :#esoteric < 1118509267 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :question: < 1118509291 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :if stack is empty, should popping return error or zero/empty/do nothing? < 1118509332 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :Pretty arbitrary. I've seen both commonly. < 1118509337 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :yeah < 1118509375 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :do something completely different! < 1118509396 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :empty stack returns random value? < 1118509402 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :hehe < 1118509410 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :that could be nice < 1118509419 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :or start popping the source code :) < 1118509422 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :would add some random flavour to the language < 1118509431 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :well source is popped all the time ;) < 1118509439 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :print 99bob < 1118509444 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :heh < 1118509456 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :then that could be written with one instruction.. < 1118509464 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :random could be nice < 1118509468 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :yeah < 1118509477 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :if there is another way of checking if the stack is empty < 1118509504 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :not yet < 1118509517 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :i'm still planning while writing the interpreter < 1118509545 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :maybe you could have an boolean operator that checks if a number is 'random' :D < 1118509552 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :heh < 1118509582 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :btw; would reversible stack be okay for two stacks? < 1118509586 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :like there is one stack < 1118509596 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :but instruction '/' could reverse it < 1118509610 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :and that way the other side of the stack could be popped and pushed etc.. < 1118509625 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :that would be a nice instruction < 1118509630 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :yes < 1118509812 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :interesting contest: http://www.brainhz.com/underhanded/ < 1118509826 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :(might be slashdotted any moment now) < 1118509879 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :hehe < 1118512527 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :kipple: Yes, is now on Slashdot. < 1118512548 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :I know, that's where I found it < 1118512758 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :ah, I read your comment to say it was yours or a friends and you were waiting for /. to post a story on it < 1118512823 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :ah. No. I was waiting for the server to go down from the slashdot effect. Which it hasn't :) < 1118513039 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :malaprop < 1118513046 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :how to reverse string in python? < 1118513209 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :"foo"[::-1] < 1118513228 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :So you slice the whole thing with a negative step, basically. < 1118513237 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :ah cheers < 1118513239 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :works < 1118513505 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :snack is progressing! < 1118513680 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :any code examples? < 1118513721 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :mmm. Python looks cool. Maybe I'll use that for my next esolang < 1118513785 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :not yet < 1118513789 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :hopefully later tonight < 1118513791 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :and yeah < 1118513803 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :python is my favourite "real" language thesedays < 1118513804 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :kipple: Python rules. :) < 1118513810 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :i found it out few days ago < 1118513814 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric ::) < 1118513838 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :in python strings and stacks and stuff like that is so easy that it's idea for esolang interpreter writing < 1118513844 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :*ideal < 1118513864 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :Keymaker: Heh, have you used list comprehensions at all? They're my favorite new idiom. < 1118513875 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :hmm no i don't think so < 1118513877 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :what are those? < 1118513902 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :Say you have a list full of objects that you want to do a common operation on. Instead of writing < 1118513908 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :for x in list: < 1118513915 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric : x.foo() < 1118513918 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :you can write: < 1118513925 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :[x.foo() for x in list] < 1118513931 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric ::) < 1118513946 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :which gets really handy when you do stuff like "\n".join([x.toXML() for x in list]) < 1118513951 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :yeah < 1118514017 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :i selected to this language that popping empty stack returns nothing < 1118514032 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :and probably make the random feature for memory stack < 1118514042 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :this language has two stacks < 1118514050 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :oh, conditionals are also handy: [x.foo() for x in list if x.bar > 2] < 1118514060 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric ::) < 1118515737 0 :comet_11!Sanity@dialup-89.105.221.203.acc51-kent-syd.comindico.com.au JOIN :#esoteric < 1118515801 0 :CXI!unknown@unknown.invalid QUIT :Read error: 104 (Connection reset by peer) < 1118516204 0 :graue!~graue@ip68-100-135-226.dc.dc.cox.net JOIN :#esoteric < 1118516403 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :phew! finished the first part of the Malbolge article < 1118516411 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :cool! < 1118516414 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :is it up? < 1118516457 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :yeah < 1118516465 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :http://www.esolangs.org/wiki/Malbolge < 1118516482 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :cool, i'll read it now! < 1118516495 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :it's just a language description at the moment < 1118516514 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :ok < 1118516825 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :good work < 1118516840 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :thanks < 1118516861 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :is it easy enough to understand? < 1118516872 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :yeah, i guess < 1118516881 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :all but the code samples :) < 1118516890 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :hehe, indeed < 1118516966 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :even 'reading' the normalized version requires external help (a trace is helpful) < 1118516974 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :heh < 1118517026 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :so, Keymaker, when is the Malbolge quine done? < 1118517032 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :uhhh < 1118517040 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric ::) < 1118517053 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :thanks heaven i haven't even thought that < 1118517086 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :hehehe < 1118517099 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :(nor digital root calculator!) < 1118517101 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :ACTION considers about offering a prize < 1118517111 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric : http://esoteric.voxelperfect.net/db/latest.sql.bz2 < 1118517112 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric : it should now update on sundays at about 00:01 UTC, maybe a little later < 1118517121 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :so can it be announced to the mailing list? < 1118517143 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :I'd guees so. Mention that I'm doing backups. < 1118517176 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :Keymaker: you may want to add the digital root program to http://www.esolangs.org/wiki/Popular_problem < 1118517179 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :I'll set up a cron job as well < 1118517180 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :oh, and it's .gz, not .bz2 < 1118517187 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :that would be cool pgimeno < 1118517197 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :although dunno how popular that is < 1118517203 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :but it's worth being popular ;) < 1118517205 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :malaprop: well, I managed to download the .bz2 without problems < 1118517215 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :maybe an apache caching issue or something < 1118517233 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :i'll add it < 1118517238 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :huh, and now I can get it < 1118517261 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :graue: which of the archives is the one that gets updated? < 1118517416 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :the null program is not a quine in malbolge: it crashes the reference interpreter due to a(nother) bug < 1118517437 0 :slobo!unknown_us@p5492EA3B.dip.t-dialin.net JOIN :#esoteric < 1118517458 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :hi slobo < 1118517550 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :that nick sounds reminiscent of a not very fast language < 1118517642 0 :slobo!unknown@unknown.invalid PRIVMSG #esoteric :hi < 1118517644 0 :slobo!unknown@unknown.invalid PRIVMSG #esoteric :? < 1118517672 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :hi < 1118517705 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :http://en.wikipedia.org/wiki/SLOBOL_programming_language < 1118517777 0 :slobo!unknown@unknown.invalid PRIVMSG #esoteric :lol, didn't know this :) < 1118517821 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric ::) < 1118517928 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :brb, taking down one bottle of beer from the wall < 1118517968 0 :slobo!unknown@unknown.invalid PART #esoteric :? < 1118518020 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric ::) < 1118518025 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :how many left? < 1118518069 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :too few < 1118518090 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :"go to store and buy some more" < 1118518100 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric ::) < 1118518184 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :the counter is still in 4 < 1118518199 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :ok < 1118518701 0 :calamari!~calamari@dialup-4.240.150.22.Dial1.Phoenix1.Level3.net JOIN :#esoteric < 1118518714 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :hi < 1118518725 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :hi < 1118518735 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :ok here it is: http://www.esolangs.org/wiki/Digital_root < 1118518878 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :anyway, if anyone wants to try and implement the Song with real hardware (or should I say liquid-ware?), here is the place to do it: http://www.mommsen-eck.de/ < 1118518905 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :you wont have to drink the same kind twice :) < 1118518918 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric ::) < 1118518955 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :though you might get some run-time errors, I think... < 1118518963 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :i have a feeling any hardware couldn't get past 50 bottles before serious malfunction < 1118518982 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :or well, past 20 < 1118518992 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :well, I think the way to do it would be with parallell processing < 1118519001 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric ::) < 1118519045 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :ahh, didigtal root is the division by 3 test < 1118519059 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :hm? < 1118519080 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :that's the way you can tell if a number is divisible by 3 < 1118519090 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :(besides actually doing the division) < 1118519092 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :ah < 1118519099 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :i didn't know that < 1118519102 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :cool < 1118519103 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :so if it comes out to 3, 6, or 9, it's divisible < 1118519109 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :yeah < 1118519307 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :I should add a page to the bf giving algorithms, like division for sp3tt < 1118519321 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :that could be nice < 1118519354 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :N.B. the digital root is also a test for divisibility by 9 (if it comes out to 9) < 1118519431 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :pgimeno: cool, didn't know that one :) < 1118519441 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :does it work for 6 as well? < 1118519447 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :nope < 1118519460 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :for 6, check that it's even and it's divisible by 3 < 1118519482 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :right, because 2*3=6 < 1118519490 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :yup < 1118519497 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :so now we know the /18 rule :) < 1118519504 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :sure :) < 1118519578 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :also, if a number's last two digits can be divided by 4, then it's divisible by 4; if it's also divisible by 3, then it's divisible by 4*3=12 < 1118519622 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :pgimeno: I don't think that works for 144. < 1118519631 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :oh, whole number div 3? ya, ok < 1118519661 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :144=4*4*9, quite more complex < 1118519680 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :(requires that the last four digits can be divided by 16) < 1118519888 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :this regexp tests divisibility by 4 (if I've made no mistake): ^[0-9]*([13579][26]|[02468]?[048])$ < 1118520119 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :no, it does not work < 1118520216 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :^([0-9]*[13579][26]|[0-9]*[02468][048]|[048])$ should work (there was a problem with the ? above) < 1118520526 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :would these instructions be good: < 1118520550 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :'i' to increase memory stack's top value by 1 < 1118520568 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :'I' (big 'i') to increase memory stack's top value by 10 < 1118520587 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :and 'd' and 'D' to decrease by 1 and 10 < 1118520619 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :but i wouldn't like to use letters < 1118520627 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :better think something else.. < 1118520665 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :or should i use the befunge way? polish notation (was it called that)? < 1118520714 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :like 99* would push 9 to stack and then 9 to other stack and then pop them and multiply them and then push the result < 1118520725 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :Keymaker: ya, that's rpn < 1118521014 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :grhhh. i just use the gooood ol' + and - stright from brainfuck :) < 1118521023 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :nobody needs more than that < 1118521286 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :hmm < 1118521289 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :what should i do: < 1118521296 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :Keymaker: How about have integer literals repeat? So + adds 1 to top of stack, and +9 adds ten. < 1118521308 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :that could be nice idea < 1118521323 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :but i decided that using the "loop" system i have is easy enough :) < 1118521362 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :i was about to ask that i probably should use good ol' byte as memory 'cell' size? < 1118521453 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :i hate bytes < 1118521458 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :be original < 1118521461 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :use base 9 or sometihng < 1118521465 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :hmm < 1118521468 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :Be a man, use unicode. < 1118521474 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :NOOOOOOOOOOOOOOOOO < 1118521477 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :and yeah < 1118521480 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric ::) < 1118521482 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :puzzlet will kill you if you don't use unicode < 1118521495 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :do you really want to be mauled by a mob of angry koreans? < 1118521498 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :is there still no language using balanced trinary? < 1118521512 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :don't make me use bits.. < 1118521518 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :pgimeno: that would be surprising < 1118521528 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :pgimeno: wasn't there an actual computer using balanced trinary < 1118521538 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :no idea < 1118521558 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :is there? < 1118521574 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :ACTION googles < 1118521612 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :well, there was a ternary computer < 1118521620 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :i have no idea if it was balanced ternary or some other kind < 1118521625 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :it was made in russia < 1118521636 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :iskra or something? < 1118521640 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric ::) < 1118521655 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :no, probably something else < 1118521686 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :http://www.computer-museum.ru/english/setun.htm < 1118521691 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :yeah < 1118521707 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :wow < 1118521715 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :indeed < 1118521718 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :yeah < 1118521720 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :never heard of this < 1118521735 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :very little actual detail in that article < 1118521765 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :maybe it's some soviet secret < 1118521767 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :i wonder why there aren't more ternary machines < 1118521784 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :the article seems to list a bunch of unilateral advantages < 1118522040 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :does setun use balanced ternary? I haven't seen that < 1118522175 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :i'll take a small break from developing esolang -- and go to program in thue :) < 1118522191 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :i probably come back later < 1118522197 0 :Keymaker!unknown@unknown.invalid PART #esoteric :? < 1118524394 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :http://www.esolangs.org/wiki/Brainfuck_algorithms < 1118524511 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :argh.. I wasn't logged in.. < 1118524541 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :it seems to random forget I'm logged in.. I blame my browser < 1118525060 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :there's a timeout < 1118525092 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :if you refresh any page you reload the timer < 1118525157 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :can that be disabled? < 1118525201 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :brb < 1118525203 0 :calamari!unknown@unknown.invalid QUIT :"Leaving" < 1118525940 0 :calamari!~calamari@dialup-4.240.114.40.Dial1.Phoenix1.Level3.net JOIN :#esoteric < 1118525941 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :re's < 1118526013 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :calamari: I don't know if that can be disabled; I learned the trick after noticing the disconnections < 1118526045 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :I've just read your page; very nice < 1118526069 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :it's good to have 'stock' algorithms instead of reinventing the wheel each time < 1118526143 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :one comment though < 1118526204 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :I've noticed that the PRNG works modulo 65536, but LCGs modulo a power of 2 suffer from a "nonrandomness disease" < 1118526276 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :in the best case, the lowest bit just toggles from 0 to 1 on each iteration, and the next one just cycles like this: 0, 0, 1, 1 < 1118526329 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :(sorry for the ping, I wanted to make sure you weren't disconnected) < 1118526380 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :the alternative is to use a prime modulus, and 65537 is just nice because it allows for period 65536 < 1118526405 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :it will complicate the algorithm, though < 1118526509 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :A = 75, B = 74 make V always < 65536 (that's the PRNG used in the Speccy, incidentally) < 1118526581 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :(sorry if I'm being a bit picky here, PRNGs are an area of my interest) < 1118526686 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :pgimeno: I used the numbers from the book listed.. they investigated many different combinations of numbers to come up with those < 1118526713 0 :fizzie!unknown@unknown.invalid PRIVMSG #esoteric :modulo-2^n LCGs are quite common, though, aren't they? Knuth uses a modulo-2^35 one. < 1118526743 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :yeah, but e.g. the low bit of the high byte has period 256 < 1118526745 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :pgimeno: I'd love to see a better solution (especially if it's simpler!) :) < 1118526768 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :(in the period-65536 generator I mean) < 1118526783 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :calamari: no, it won't be simpler :) < 1118526845 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :fizzie: Knuth also warns against using the low bits in LCGs modulo powers of 2; he recommends using multiplication to get a number in a given range < 1118526850 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :I'm still working on putting up my array code, but it will take longer because I need to make sure it's right :) < 1118526879 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :array code is always so complicated < 1118526936 0 :fizzie!unknown@unknown.invalid PRIVMSG #esoteric :That's the usual rand(3) manpage warning. < 1118526959 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :that problem disappears with a prime modulus LCG < 1118527044 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :(though maximum period for prime M is M-1, not M) < 1118527134 0 :fizzie!unknown@unknown.invalid PRIVMSG #esoteric :(Hmf, glibc's rand() apprently isn't a LCG.) < 1118527206 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :I've learnt to never trust standard library's PRNGs anymore :) < 1118527301 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :that way you can make reentrant generators, predictable results, better period guarantees... < 1118527343 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :and of course better randomness guarantees < 1118527359 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :do you know Kyodai Mahjongg? < 1118527407 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :in that game there are lots of board numbers that generate exactly the same board < 1118527474 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :just because the period is insufficient and the generation method is a RN hog < 1118527610 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :calamari: maybe the book authors just didn't consider a modulus other than 65536 < 1118527624 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :perhaps < 1118527635 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :it's been a long time since I coded that up < 1118527662 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :it seemed to work fine.. I checked it out in basic first to see what kinds of numbers were produced < 1118527695 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :and you didn't notice that they were alternatively odd/even? :) < 1118527705 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :they weren't < 1118527728 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :well, did you print the values of V? < 1118527749 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :if you're assuming that the produced random # is16-bits wide, thats an error.. I'm only using 8 bits of it < 1118527775 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :oh ok. that's the high byte then, right? < 1118527781 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :I don't recall < 1118527802 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :looks like it (from the bf) < 1118527816 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :it must be, otherwise it would be odd/even < 1118527856 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :feel free to post an improved algorithm.. then everyone can benefit < 1118527870 0 :starling!~nobody@adsl-63-197-122-98.dsl.sktn01.pacbell.net JOIN :#esoteric < 1118527923 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :might do, if I clean my to-do list a bit first :) < 1118527989 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :hehe < 1118527995 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :there, I clarified the rng a bit < 1118528009 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :now it says 0-255 and hight byte < 1118528020 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :nice < 1118528043 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :ok, back to arrays.. afk :) < 1118528048 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric ::) < 1118528195 0 :starling!unknown@unknown.invalid PRIVMSG #esoteric :I know this is probably the wrong place to ask... < 1118528221 0 :starling!unknown@unknown.invalid PRIVMSG #esoteric :Esoteric certainly, but... maybe not in the brainfsck style. < 1118528270 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :Are the perl and c malbolge interpreters equivalent? < 1118528333 0 :starling!unknown@unknown.invalid PRIVMSG #esoteric :Is there a language out there that doesn't treat text special unless explicitly marked as such? < 1118528343 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :special? < 1118528353 0 :starling!unknown@unknown.invalid PRIVMSG #esoteric :Yeah, like "as a variable" or "as a keyword" or something. < 1118528383 0 :starling!unknown@unknown.invalid PRIVMSG #esoteric :The only language I can think of really (or not really) is perl's print < Are the perl and c malbolge interpreters equivalent? <- I don't really know; the C interpreter has some caveats < 1118528833 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :but in general you can expect that programs with characters in the printable ASCII range will work the same < 1118528844 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :I've written a Python one (and a debugger) < 1118529110 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :starling: even Perl (or sh) makes the EOT string special < 1118529130 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :or do you mean "user decidable"? < 1118529176 0 :starling!unknown@unknown.invalid PRIVMSG #esoteric :Well, user decidable I suppose. I suppose it's possible to make the end of file to act as EOT in some cases. < 1118529206 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :sh is one < 1118529246 0 :starling!unknown@unknown.invalid PRIVMSG #esoteric :It's just I'm trying to write a screenplay, and I have to invent my own language for it. Wanted some functionality, without worrying about every word possibly being variable expanded. < 1118529278 0 :starling!unknown@unknown.invalid PRIVMSG #esoteric :The only extant formats I can find are all 'output' formats, with margin lengths and font and such. < 1118529370 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :Python docstrings don't fit there very well, if I understand the problem correctly < 1118529398 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :don't C comments fit? < 1118529401 0 :starling!unknown@unknown.invalid PRIVMSG #esoteric :Yeah, perl's < < 1118529616 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :maybe php fits your needs < 1118529624 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :I'm using it as a preprocessor < 1118529646 0 :starling!unknown@unknown.invalid PRIVMSG #esoteric :*nods* I don't know PHP, but it might work good. < 1118529703 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :php outputs text until it encounters , then it begins outputting text again < 1118529713 0 :Keymaker!~Not@wire74.adsl.netsonic.fi JOIN :#esoteric < 1118529716 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :hello < 1118529721 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :hi Keymaker < 1118529726 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :hi < 1118529727 0 :starling!unknown@unknown.invalid PRIVMSG #esoteric :Right-o. < 1118529734 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :good work calamari < 1118529757 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :not sure what kind of array code you're writing there < 1118529769 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :but simple array is easy < 1118529769 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :+++++++++ what value? < 1118529769 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :> ++++++++++++++++++++++ where? < 1118529769 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :[ < 1118529769 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :>>>[>>]+[<<]<- < 1118529769 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :] < 1118529771 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :< < 1118529773 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :[ < 1118529775 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :> >>>[>>]<+<[<<] <<- < 1118529777 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :] < 1118529803 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :that code moves the "what value?" value to "where?" memory place < 1118529821 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :each location uses two bytes; one for movement and one for storing < 1118529845 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :this is, for byte-implementation < 1118529866 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :but the same code would work even if the cell size is more than byte < 1118529879 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :(on those implementations that i don't prefer) < 1118529969 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :keymaker: I'm doing x(y)=z and x = y(z) < 1118529992 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :But, you could add that as a simiplified case :) < 1118529999 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :ok < 1118530018 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :what kind of array is this your new array? < 1118530027 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :is there any size limit? < 1118530069 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :as well, your random code is clever < 1118530072 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :size limit depends on cell size < 1118530076 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :never heard of that < 1118530080 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :ok < 1118530081 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :keymaker: thanks :) < 1118530085 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric ::) < 1118530095 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :oh i mean like how long the array is < 1118530102 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :yeah that's what I mean too < 1118530103 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :like can you set x(4999999) = 3 < 1118530119 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :yes, if your cells can hold the value 4999999 < 1118530147 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :ok.. so the max is with 1 byte-implementation x(255)? < 1118530151 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :yes < 1118530154 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :'ok < 1118530164 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :my code basically does that < 1118530173 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :or well, it does that < 1118530174 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric ::) < 1118530182 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :it wouldn't be hard to add < 1118530186 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :it to get the value < 1118530198 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :I've saved my changes < 1118530203 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :? < 1118530214 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :changes? < 1118530218 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :could you add your sections and save changes so I can work in my little corner without a conflict < 1118530227 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :sure < 1118530254 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :do you want me to add my stuff to esowiki? < 1118530255 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :what will it be, x = y(_constant), x(_constant_)=y ? < 1118530269 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :my code? < 1118530274 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :also, be sure to specify where the pointer ends up < 1118530280 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :yes < 1118530304 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :see the one array code I put for an example of what I mean < 1118530306 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :i'll do this: i'll write the stuff on txt < 1118530318 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :and later, for example tomorrow, add it when you're edited the wiki < 1118530325 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :okay < 1118530326 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :or something like that < 1118530331 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :i have no reason to hurry :) < 1118530334 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :brb < 1118530336 0 :malaprop!unknown@unknown.invalid QUIT :"leaving" < 1118530349 0 :malaprop!~ph@ppp-68-251-59-237.dsl.chcgil.ameritech.net JOIN :#esoteric < 1118530361 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :if i do detailed work i may add it to my site as well < 1118530402 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :but what i could do is to convert some of those algorithms of your to non-wrapping implementation ;) < 1118530404 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :I think I'll write a Malbolge quine < 1118530411 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric ::) < 1118530413 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :go ahead < 1118530470 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :what can I offer if you manage to do that? hmm... < 1118530510 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :99 bottles of beer? < 1118530512 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :pgimeno: more bf algorithms :) < 1118530520 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric ::) < 1118530526 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :yeah, that makes sense, Keymaker < 1118530560 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :malaprop: if you write a Malbolge quine I'll reward you with 99 bottles of beer < 1118530646 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :malaprop: are you really interested in Malbolge? I want to write sections about practical Malbolge coding < 1118530684 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :My interest in Malbolge is not deep. < 1118530698 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :ok < 1118530711 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :calamari: reversing data would be nice there as well. we could probably use that 50-byte entry of bfcc #1 if we asked the author's (bertram) permission. < 1118530731 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :I'm going to go think about this on the train to visit some friends; I'll be AFK the next 24hish. < 1118530746 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric ::) < 1118530766 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :have you read Lou Scheffer's article? it's a good introduction < 1118530817 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :when his ideas are put into practice other issues surface though < 1118530842 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :bbl < 1118530953 0 :starling!unknown@unknown.invalid PART #esoteric :? < 1118531095 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :keymaker: ok.. array code should be up if you want to add things :) < 1118531160 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :ok < 1118531261 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :here should be code that 'returns' NOT(x) < 1118531262 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :+++++++++++++++++++++++++++ THIS IS X < 1118531262 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :[>+>+<<-]>>[<<+>>-] < 1118531262 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :+++++>>> < 1118531262 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :+++++[<+++++[<+++++>-]>-]<< < 1118531262 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :[<++>-]<< < 1118531264 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :[>-<-]>[<+>-]<< < 1118531277 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :the first cell is x < 1118531286 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :and the second cell will get the value not(x) < 1118531299 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :the original x will remain in the first cell < 1118531356 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :why not put it in the wiki rather than paste it here? :) btw, I already have a not function listed < 1118531386 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :but isn't that for wrapping version? < 1118531394 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :yeah.. this is non-wrapping? cool < 1118531397 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :yes < 1118531401 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :that's why i wrote this < 1118531402 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric ::p < 1118531424 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :i'll add it there..? < 1118531431 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :if it's possible to normalize it (use variable names instead of > and <, please do so < 1118531450 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :that way it becomes much more reuseable < 1118531466 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :hmm.. sorry, i don't know how to convert to those :\ < 1118531478 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :that's okay.. I'll try to do it < 1118531484 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :good :) < 1118531488 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :they confuse me too much < 1118531505 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :here's the memory layout (if i remember it correctly): < 1118531510 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :oh wait < 1118531518 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :it's no use, since it change during execution < 1118531558 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :that's the probelm with bf algorithms, isn't it.. no documentation, and can't remember how it works :) < 1118531611 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :makes me glad that I was able to preserve mine somewhat with the variable naming format < 1118531614 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :hehe. but here is what it does: take copy of x, make one cell 255, decrease 255 by that copy x's value, then move not(x) to second cell < 1118531637 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :heh < 1118531882 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :so whats the shortest way to make 255? 16*16-1? < 1118531934 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :dunno < 1118531940 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :i used 5*5*5*2 < 1118531951 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :+5 < 1118531952 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric ::) < 1118532139 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :but notice on 1-byte, non-wrapping implementation you can NOT do 16*16 :) < 1118532143 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :how's this: http://www.esolangs.org/wiki/Brainfuck_algorithms < 1118532151 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :aha < 1118532156 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :that is true < 1118532169 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :so I need to fix it again :) < 1118532197 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :the 5*5*5*2+5 way is quite good imho < 1118532209 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :17*15 < 1118532251 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :that's easy, but long :) < 1118532251 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :except that neither of us seem to understand it :) < 1118532283 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :can you show me just the code where you set a cell to 255? < 1118532291 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :ok < 1118532297 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :+++++>>> < 1118532298 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :+++++[<+++++[<+++++>-]>-]<< < 1118532304 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :first place 5 < 1118532312 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :go three right < 1118532319 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :thanks < 1118532328 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :and so on :) < 1118532363 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :probably best would be if you'd just convert my original code to that tutorial form :) < 1118532410 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :there is what I get: < 1118532413 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :>[-]+++++++++++++++[<+++++++++++++++++>-] < 1118532413 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :[-]+++++>[-]>[-]>[-]+++++[<+++++[<+++++>-]>-]<< < 1118532427 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :your code (when properly zeroed) is actually a bit longer < 1118532442 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :maybe some of the [-] can be skipped? < 1118532471 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :actually wait, I missed on on mine < 1118532482 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :[-]>[-]+++++++++++++++[<+++++++++++++++++>-] < 1118532487 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric ::) < 1118532500 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :still shorter tho :) < 1118532623 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :your code leaves cells with values on the memory < 1118532639 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :adn on which cell the x should be? < 1118532672 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :I don't understand your question < 1118532675 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :oh wiat < 1118532682 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :nothing notghin nothing!! < 1118532691 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :i just ran the two lines you posted < 1118532699 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :and thought that that isn't working at all :D < 1118532705 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :now i see it's comparing < 1118532734 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :yes, your way is shorter if cells must be cleared first < 1118532763 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :algorithms page is probably assuming the codes can be run at any time? < 1118532766 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :yeah < 1118532771 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :ok < 1118532784 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :is neg = not + 1 going to wrap ? < 1118532797 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :no idea < 1118532810 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :ie neg(10)=-10, not(10)=-11, so -11+1 = -10 < 1118532829 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :no idea still! < 1118532834 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :hehe < 1118532838 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric ::) < 1118532876 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :ahh lets see, not(0)=255, 255+1=0.. oops < 1118532898 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :I could make 0 a special case < 1118532904 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :? < 1118532908 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :i can't understand this at all < 1118532920 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :what does "x = -x" do? < 1118532947 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :in values that can't be negative? < 1118532968 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :good question.. mnaybe it makes no sense to even bother < 1118532982 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :it's on the esowiki.. < 1118532999 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :that's because it works well when cell wrapping is allowed < 1118533002 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :255 = -1 < 1118533026 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :i don't think it's really useful, sorry :) < 1118533032 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :mainly because there is no sense :) < 1118533032 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :so if x = 1, the code x=-x gives -1 < 1118533039 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :yes < 1118533049 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :you've never used -x in a program you wrote? < 1118533053 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :no < 1118533066 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :well, sometimes in math you need it :) < 1118533087 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :but assuming i have brainfuck implementation, 1-byte and non-wrapping < 1118533098 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :then you don't need it < 1118533101 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :and i want -(33) < 1118533105 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :but non-wrapping isn't a given < 1118533128 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :a lot of bf programmers (including myself) are okay with wrapping < 1118533142 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric ::] < 1118533154 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :so let's just leave the non-wrapping version off, because you're right, it makes no sense < 1118533161 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :ok :) < 1118533165 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :agree! < 1118533190 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :heheh < 1118533205 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :btw, is the line between wrapping and non-wrapping version of not(x) necessary? < 1118533210 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :it makes reading hard < 1118533213 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :I should rewrite == and != to use 1 = true instead of 255 < 1118533228 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :keymaker: nope, that must be an accident on my part < 1118533235 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :ok :) < 1118533239 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :i can write other of them < 1118533247 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :which one do you want == or != ? < 1118533264 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :do you understand the code? :) < 1118533275 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :not esowiki code < 1118533279 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :but pure brainfuck, yes < 1118533283 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :okay :) < 1118533290 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :I can do both, it won't take long < 1118533297 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :well, ok then < 1118533463 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :what 'x = x and y (boolean)' does? < 1118533484 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :okay done < 1118533490 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :ok < 1118533490 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :x = x && y < 1118533494 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :for the record, according to http://www.iwriteiam.nl/Ha_bf_numb.html you need at least 30 instructions for 255 < 1118533549 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :ok < 1118533565 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :i mean it does something with bits? < 1118533571 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :(&&) < 1118533605 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :AND 'gate'? < 1118533649 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :keymaker: if you're familiar with c, it is the && operator < 1118533657 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :i'm not < 1118533686 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :keymaker: examples: 1 == 2 returns 0, 5 == 5 returns 1 < 1118533703 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :ah < 1118533706 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :i'm stupid < 1118533710 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :this is useful for things like if() < 1118533712 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :i was thinking at byte level < 1118533713 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :yes < 1118533714 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :this < 1118533717 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :00110 < 1118533721 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :10010 < 1118533726 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :00010 < 1118533728 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric ::) < 1118533730 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :ahh, yeah, that's bitwise < 1118533734 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :i mean bit level < 1118533754 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :I've writeen those, too.. I 'd forgotten ! :) < 1118533776 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :smallfuck comes handy at those :) < 1118533786 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric ::) < 1118533789 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :indeed < 1118533792 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :yeah, I'd bet it does < 1118533807 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :interesting how it can be more powerful and less at the same time < 1118533815 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric ::) < 1118533849 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :i should write some smallfuck program (using some i/o extension) < 1118533912 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :Boolfuck may be what you're looking for < 1118533914 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :naturally without using any bf-->sf stuff < 1118533996 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :bitchanger is smaller, but not symmetric < 1118534019 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :so you don't really win anything.. just less symbols < 1118534024 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric ::) < 1118534028 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :how did you invent it? < 1118534039 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :keymaker: driving down the freeway I came up with the answer :) < 1118534070 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :heh, the eureka effect < 1118534073 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :I didn't know about any other bit bf's < 1118534098 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :lol < 1118534100 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :my goal was to simplify bf so that it could be wired with transistors < 1118534110 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric ::) < 1118534117 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :didn't happen, of course < 1118534247 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :with TTL circuits, I hope < 1118534285 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :nm < 1118534295 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :rgh. < 1118534303 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :well, seems i didn't go night photographin' < 1118534315 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :better continue being here, then < 1118534365 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :gotta go tomorrow, or going crazy < 1118534385 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :anyways, i'll switch to linux once again, will be back soon. < 1118534387 0 :Keymaker!unknown@unknown.invalid QUIT :"I've seen this déjà vu before.." < 1118534550 0 :Keymaker!~a@wire74.adsl.netsonic.fi JOIN :#esoteric < 1118534563 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :So ................... < 1118534567 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :? < 1118534616 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :I wanted to release DN 0.5 today ... < 1118534619 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :But I don't think I can ... < 1118534622 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :I can't find this damn bug :'( < 1118534626 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric ::( < 1118534636 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :what kind o bug? < 1118534662 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :How much detail do I want to describe this in ... < 1118534677 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :When one side sends a direct connect request, it then stops receiving input. < 1118534680 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :For some inexplicable reason. < 1118534687 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :hmm < 1118534710 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :hey, i know: "there is something wrong!" < 1118534722 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric ::P < 1118534733 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :I'm considering disabling DCR for this version, and fixing it later. < 1118534733 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :no idea, naturally < 1118535471 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :here's a snack code to print 'A' < 1118535472 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :!+?:::::::"?++++++++"< < 1118535583 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :here are the instructions so far: " ! + - = : < > ? # < 1118535598 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :and probably '!' for output < 1118535602 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :input is missing < 1118535617 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :'/' is there also < 1118535733 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :so, 12 instructions total < 1118535836 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :no input? < 1118535855 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :not yet < 1118535866 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :it will be there, probably character @ < 1118536008 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :actually the 'A' printing program would be two instructions longer in brainfuck :) < 1118536009 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :++++++++[>++++++++<-]>+. < 1118536026 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :and probably snack code can be squeezed. i'll try < 1118536157 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :! is for output? and it's the first instruction in the example? < 1118536177 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :last < 1118536177 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :do you run backwards? < 1118536180 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :yes < 1118536185 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :the program will be put into stack < 1118536189 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :aha < 1118536192 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :and it will be eaten from there < 1118536201 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :program will be stopped when no instructions left < 1118536342 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :keymaker: any gems for x = (y >= z)? I have code, but it's very long < 1118536360 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :nope < 1118536379 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :i guess i couldn't make very short non-wrapping code either < 1118536423 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :I can't think of a non-wrapping way to find the cell size < 1118536436 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :i.e... what is the maximum cell value < 1118536449 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :it can't be found < 1118536455 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :the maximum < 1118536455 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :yeah, I don't think it can < 1118536461 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :only wrapping allows it < 1118536510 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :but the good thing is one doesn't really need to know the maximum value. as long as the interpreter has bytes < 1118536515 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :that means wrapping is more powerful.. for example the wrapping version of not works for all cell sizes < 1118536541 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :but one shouldn't use other sizes!!!!!!!!!!!!!! < 1118536549 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :8) < 1118536553 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :pi16.b disagrees :) < 1118536567 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :well, that program doesn't know anything < 1118536573 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric ::p < 1118536593 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :bfasm disagrees then :) < 1118536608 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :maybe it needs some rewriting ;) < 1118536615 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :yeah, it does < 1118536618 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :heh < 1118536634 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :seriously, i don't mind if people use wrapping version < 1118536641 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :but i'm just defending non-wrapping < 1118536668 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :i mean i'm going to code my programs with non-wrapping 1-byte implementation < 1118536714 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :the original distribution implies wrapping :) < 1118536720 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :i know < 1118536724 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :1 byte = 8bits .. but could you do non-wrapping with 1 bit? < 1118536744 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :lol < 1118536745 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :yes < 1118536764 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :+ and - are fine :) < 1118536858 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :yep, it still works.. cool < 1118536875 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :and besides, non-wrapping is less implementation dependent < 1118536878 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :what works? < 1118536887 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :maker: what you said < 1118536893 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :+ and - ? < 1118536896 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :yeah < 1118536900 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :of course it works! :D < 1118537046 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :how do you do non-wrapping subtraction? .. lets say 3 - 5 ? < 1118537072 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :probably first check which one is bigger < 1118537083 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :and then probably.. < 1118537087 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :(wait) < 1118537099 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :would you have a cell that specifies the sign ? < 1118537115 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :dunno < 1118537121 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :never done that < 1118537147 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :if you come up with something, that could be used for x = -x :) < 1118537157 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :ok < 1118537180 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :that'd be pretty simple an operation now... sign = 1 - sign.. something like that :) < 1118537776 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :ouch. my knees hurt < 1118537818 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :it probably has nothing to do with 14 hours of sitting :) < 1118537832 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :probably not.. < 1118537890 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :I end up sitting different ways throughout the day without even noticing the changes.. other people comment :) < 1118537899 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric ::) < 1118538053 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :I hate all of my friends. < 1118538067 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric ::) < 1118538165 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :I don't have any friends that I don't hate < 1118538188 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :graue: is the converse true? < 1118538201 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :You are all my sworn enemies ... and I love ya', every one. < 1118538230 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric ::) < 1118538237 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :calamari, what would that be? I'm confused < 1118538281 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :no, "if I hate someone, then he is my friend" is not true < 1118538333 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric : http://esoteric.voxelperfect.net/db/latest.sql.bz2 < 1118538333 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric : it should now update on sundays at about 00:01 UTC, maybe a little later < 1118538333 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :so can it be announced to the mailing list? < 1118538354 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :sure i guess < 1118538359 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :okay < 1118538371 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :what about the uploaded files? < 1118538395 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :I'd like to upload a Piet program < 1118538403 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :what announced on the mailing list? < 1118538415 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :Keymaker: the database backup < 1118538420 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :ok < 1118538511 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :hey, what if you have bit-sized cells, but incrementing 1 or decrementing 0 is an error that crashes your program? < 1118538517 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :that would be strange to deal with < 1118538558 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric ::) < 1118538580 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :graue, please, could you set up a backup of the wiki uploads? < 1118538681 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :graue: that's wrapping.. it's an error, lol < 1118538709 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :graue: also can you alow me to upload files? < 1118538873 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :pgimeno, when there are too many to back them up manually, then yes < 1118538879 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :calamari, you should be allowed already < 1118538921 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :hum, what happens in MediaWiki when a file is missing? < 1118538987 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :I mean, if the file is not present in the uploads dir but the database indicates that it's there < 1118539005 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :can it be re-uploaded? < 1118539072 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :if not, people interested in mirroring will need to know what directories to put the mediawiki files in < 1118539110 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :IIRC the dir name is made by looking at the first characters of a hash of the file's name < 1118539219 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :graue: ok thanks < 1118540232 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :well. time to go.. < 1118540251 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :see you earlier/later today < 1118540251 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :nite < 1118540251 0 :Keymaker!unknown@unknown.invalid PART #esoteric :? < 1118540433 0 :calamari_!~calamari@dialup-4.240.114.159.Dial1.Phoenix1.Level3.net JOIN :#esoteric < 1118540753 0 :graue!unknown@unknown.invalid PART #esoteric :? < 1118541448 0 :calamari!unknown@unknown.invalid QUIT :Read error: 110 (Connection timed out) < 1118541614 0 :calamari_!unknown@unknown.invalid PRIVMSG #esoteric :bbl, phone < 1118541616 0 :calamari_!unknown@unknown.invalid QUIT :"Leaving" < 1118547945 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :isn't this a correct nonwrapping "not x"?: temp0[-]x[temp0+x[-]]+temp0[-x-temp0] < 1118549048 0 :kipple!unknown@unknown.invalid QUIT :Read error: 110 (Connection timed out) < 1118553836 0 :calamari_!~calamari@dialup-4.240.111.80.Dial1.Phoenix1.Level3.net JOIN :#esoteric < 1118553838 0 :calamari_!unknown@unknown.invalid PRIVMSG #esoteric :hi < 1118557014 0 :GregorR-L!~GregorR-L@dsl093-040-198.pdx1.dsl.speakeasy.net JOIN :#esoteric < 1118559348 0 :calamari_!unknown@unknown.invalid PRIVMSG #esoteric :is any language that restricts memory to a finite amount a finite-state automaton? < 1118559419 0 :calamari_!unknown@unknown.invalid PRIVMSG #esoteric :trying to categorize one of my languages, and it would be turing complete, except ultimately there is a maximum amount of memory.. although that maximum amount is exceptionally large < 1118559592 0 :calamari_!unknown@unknown.invalid PRIVMSG #esoteric :256^26 bytes.. 3.74x10^50 terabytes < 1118559686 0 :calamari_!unknown@unknown.invalid PRIVMSG #esoteric :wow, that's a lot of memory.. hehe :) < 1118560668 0 :calamari_!unknown@unknown.invalid QUIT :"Leaving" < 1118563199 0 :clog!unknown@unknown.invalid QUIT :ended < 1118563200 0 :clog!unknown@unknown.invalid JOIN :#esoteric < 1118569714 0 :GregorR-L!unknown@unknown.invalid QUIT :Read error: 110 (Connection timed out) < 1118570721 0 :J|x!jix@p5489AB4E.dip.t-dialin.net JOIN :#esoteric < 1118570838 0 :J|x!unknown@unknown.invalid PRIVMSG #esoteric :moin < 1118570851 0 :J|x!unknown@unknown.invalid NICK :jix < 1118571166 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :anyone here ? < 1118571279 0 :puzzlet!unknown@unknown.invalid PRIVMSG #esoteric :nope < 1118571315 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :ok < 1118571433 0 :puzzlet!unknown@unknown.invalid PRIVMSG #esoteric :jix: may i help you? < 1118571545 0 :sp3tt!~chatzilla@cust-148-133.elhandel.umeaenergi.se JOIN :#esoteric < 1118571585 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :nobody's here < 1118571588 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :nobody's ever here < 1118571591 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :this channel is EDAD! < 1118571830 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :is it? < 1118571843 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :yeah < 1118571844 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :EDAD < 1118572007 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :before i went to france i just done my XUML interpreter(4 mins before i had to shutdown my computer).. i'm going to upload it and create a wiki page < 1118574361 0 :sp3tt!unknown@unknown.invalid PRIVMSG #esoteric :Would latin qualify as an esoteric language? lol < 1118579666 0 :J|x!jix@p5489C260.dip.t-dialin.net JOIN :#esoteric < 1118579885 0 :jix!unknown@unknown.invalid QUIT :Nick collision from services. < 1118579890 0 :J|x!unknown@unknown.invalid NICK :jix < 1118581781 0 :sp3tt_!~chatzilla@lite-148-133.umenet.net JOIN :#esoteric < 1118582170 0 :sp3tt!unknown@unknown.invalid QUIT :Read error: 60 (Operation timed out) < 1118582268 0 :comet_11!unknown@unknown.invalid QUIT :Read error: 104 (Connection reset by peer) < 1118582339 0 :CXI!Sanity@dialup-89.105.221.203.acc51-kent-syd.comindico.com.au JOIN :#esoteric < 1118582500 0 :kipple!~kipple@163.80-202-100.nextgentel.com JOIN :#esoteric < 1118583492 0 :graue!~graue@ip68-100-130-21.dc.dc.cox.net JOIN :#esoteric < 1118585422 0 :Keymaker!~a@wire74.adsl.netsonic.fi JOIN :#esoteric < 1118585452 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :wheee < 1118585476 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :finally got around taking a look at appearance stuff in this mandrake < 1118585488 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :now i'm finally feeling comfortable with the appearance < 1118585492 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :now when i've changed it < 1118585501 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :the previous looked like s*it < 1118585668 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :what window manager are you using? < 1118585707 0 :fizzie!unknown@unknown.invalid PRIVMSG #esoteric :Use evilvm, it's nice. No nonsense about menus or title bars or other unnecessities. < 1118585744 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :i guess it's kde in case that is window manager. i'm a bit lost about the terminology < 1118586122 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :i prefer ion < 1118586140 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :kde is a desktop environment, i'm not sure what window manager it normally uses < 1118586148 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :ok < 1118586150 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :no idea < 1118586603 0 :fizzie!unknown@unknown.invalid PRIVMSG #esoteric :I think they call it Kwin. < 1118587311 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :i. hate. overflow. stupid non-wrapping cells :p < 1118587829 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :problem fixed < 1118589097 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :i wish C had a balanced trinary type < 1118589104 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :or type checking for enums so i could make my own < 1118589111 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :question: in which direction langton's ant is going when started? < 1118589119 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :left righ up or down < 1118589139 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :i can't find the start direction anywhere grrrrr < 1118590062 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :i wish i knew :( < 1118591367 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :well, doesn't matter anymore < 1118592318 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :chocolated covered langton's ant < 1118592332 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :mmh.. ants.. < 1118593087 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :bbl' < 1118593090 0 :Keymaker!unknown@unknown.invalid PART #esoteric :? < 1118593581 0 :cpressey_!nobody@d154-20-76-195.bchsia.telus.net JOIN :#esoteric < 1118593595 0 :cpressey!unknown@unknown.invalid QUIT :brown.freenode.net irc.freenode.net < 1118594803 0 :Keymaker!~a@wire74.adsl.netsonic.fi JOIN :#esoteric < 1118594819 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :from esowiki: "fixed erroneous fix" < 1118594821 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric ::D < 1118594860 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :probably means someone fixed stuff, and the noticed there was nothing wrong < 1118594952 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :Keymaker: my thue digital root program is shorter than yours :p < 1118594965 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :grrrg < 1118594966 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric ::p < 1118594968 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :well, no wonder < 1118594973 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :i'm not very good at thue < 1118595031 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :(but i should try again :w) < 1118595347 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :write a digital root program in qdeql < 1118595357 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :this is just a suggestion, not a command < 1118595370 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :what is that? < 1118595377 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :qdeql < 1118595676 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :an esoteric language of my invention < 1118595681 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :www.oceanbase.org/graue/qdeql < 1118595815 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :hmmmm... < 1118595834 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :hmmmmmmmmmmmmmmmmmmmm indeed.. will take 10x times until i understand anything < 1118595868 0 :tokigun!tokigun@sparcs.kaist.ac.kr JOIN :#esoteric < 1118595919 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :hello < 1118596092 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :hello < 1118596093 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :;) < 1118596391 0 :harkeyahh!~zillermae@206-81-148-32.slkc.qwest.net JOIN :#esoteric < 1118596570 0 :tokigun!unknown@unknown.invalid QUIT :"leaving" < 1118596720 0 :harkeyahh!unknown@unknown.invalid PRIVMSG #esoteric :I thought this forum was aboutbusiness law < 1118596732 0 :harkeyahh!unknown@unknown.invalid PRIVMSG #esoteric ::-/ APL won't help me this time < 1118596752 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :how did you get that impression?? :D < 1118596762 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :graue: about qdecl. I'm not familiar with the dequeue and enqueue opearations. < 1118596791 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :is dequeue to take an element from the end of the queue, and enqueue to insert it at the beginning? < 1118597163 0 :tokigun!~tokigun@dor204226.kaist.ac.kr JOIN :#esoteric < 1118597190 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :yes < 1118597227 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :kipple: although i normally consider the "beginning" of the queue to be the part you dequeue from < 1118597254 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :heh. yes. I agree < 1118597308 0 :harkeyahh!unknown@unknown.invalid QUIT :brown.freenode.net irc.freenode.net < 1118597339 0 :harkeyahh!~zillermae@206-81-148-32.slkc.qwest.net JOIN :#esoteric < 1118599880 0 :{^Raven^}!~{^Raven^}@82-38-204-252.cable.ubr05.shef.blueyonder.co.uk JOIN :#esoteric < 1118599899 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :Hi everyone < 1118599924 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :It's nice to be back ;) < 1118599977 0 :fizzie!unknown@unknown.invalid PRIVMSG #esoteric :Hello. < 1118600034 0 :harkeyahh!unknown@unknown.invalid PRIVMSG #esoteric :I like this channel i am coming in now as a regular < 1118600064 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :I was here 24/7 a while back, it's a nice place < 1118600113 0 :harkeyahh!unknown@unknown.invalid PRIVMSG #esoteric :I especially like the marble floors < 1118600124 0 :harkeyahh!unknown@unknown.invalid PRIVMSG #esoteric :nice touch < 1118600596 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric ::) < 1118600599 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :hello raven < 1118600610 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :hi there Keymaker, long time no see < 1118600614 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :now: where have you been??! < 1118600618 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :hi < 1118600656 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :I went back to work < 1118600706 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :but but.. how did that stop you accessing this channel? < 1118600716 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :or did you wokr 24/7 < 1118600735 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :anyways, plenty of interesting has happened. < 1118600758 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :Umm...very good point there, dunno. < 1118600763 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric ::) < 1118600767 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :Ooh, plz tell < 1118600782 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :well, the esowiki that people have been actively updating and makin' is up at < 1118600787 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :esolangs.org < 1118600799 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :my brainfuck site http://www.bf-hacks.org/ is up < 1118600816 0 :harkeyahh!unknown@unknown.invalid PRIVMSG #esoteric :Yeah brainfuck is awesome < 1118600827 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :yep < 1118600834 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :and i made a simple polyglot quine: < 1118600835 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :http://www.bf-hacks.org/hacks/pgq.b < 1118600872 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :well, much more.. the logs are filled with interesting discussion now when we've got guys like pgimeno and GregorR here < 1118600883 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :also, plenty of new esolangs have been made < 1118600907 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :I'll take a peek at the chat logs later, I've got a lot of catching up to do < 1118600912 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :but now i must go eat dinner (that i can't this time bring here) < 1118600915 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :ok < 1118600918 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :bbl < 1118600921 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :have fun Keymaker < 1118601004 0 :harkeyahh!unknown@unknown.invalid PRIVMSG #esoteric :i'm 11:30 am here and he is eating dinner < 1118601008 0 :harkeyahh!unknown@unknown.invalid PRIVMSG #esoteric :lucky bastard < 1118601194 0 :harkeyahh_!~zillermae@206-81-148-32.slkc.qwest.net JOIN :#esoteric < 1118601232 0 :harkeyahh_!unknown@unknown.invalid PRIVMSG #esoteric :ChanServ don't talk to me < 1118601342 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :Keymaker: it seems to be written in c99 ;) < 1118601611 0 :smott!~pocky@193.77.153.149 JOIN :#esoteric < 1118601635 0 :harkeyahh_!unknown@unknown.invalid PRIVMSG #esoteric :hello Smott < 1118601642 0 :harkeyahh_!unknown@unknown.invalid PRIVMSG #esoteric :did you tell ChanServ to stop bugging you? < 1118601919 0 :smott!unknown@unknown.invalid PRIVMSG #esoteric :hi. what? < 1118601975 0 :harkeyahh_!unknown@unknown.invalid PRIVMSG #esoteric :yeah ChanServ < 1118601981 0 :harkeyahh_!unknown@unknown.invalid PRIVMSG #esoteric :he always talks to me when i come in < 1118601987 0 :harkeyahh_!unknown@unknown.invalid PRIVMSG #esoteric :I am sick of it < 1118601996 0 :smott!unknown@unknown.invalid PRIVMSG #esoteric :oh right. one gets used it i suppose < 1118601996 0 :harkeyahh_!unknown@unknown.invalid PRIVMSG #esoteric :being harassed by a robit < 1118602034 0 :harkeyahh_!unknown@unknown.invalid PRIVMSG #esoteric :he can't treat me like trailer trash jsut because he lives in a near freezing basment in seattle < 1118602088 0 :smott!unknown@unknown.invalid PRIVMSG #esoteric :well, he's the boss, or so i hear < 1118602138 0 :harkeyahh_!unknown@unknown.invalid PRIVMSG #esoteric :see thats it repression of the organic race by hunks of metal < 1118602157 0 :harkeyahh_!unknown@unknown.invalid PRIVMSG #esoteric :we should make a machine that can rival ChanServ and beat him to a pulp < 1118602235 0 :harkeyahh!unknown@unknown.invalid QUIT :Read error: 110 (Connection timed out) < 1118602248 0 :fizzie!unknown@unknown.invalid PRIVMSG #esoteric :At 20:30, that was a rather late dinner, even. < 1118602340 0 :harkeyahh_!unknown@unknown.invalid PRIVMSG #esoteric :i know really < 1118602385 0 :smott!unknown@unknown.invalid PRIVMSG #esoteric :does anyone happen to have any code for this language called smallfuck? < 1118602416 0 :harkeyahh_!unknown@unknown.invalid PRIVMSG #esoteric :no not anymore < 1118602420 0 :harkeyahh_!unknown@unknown.invalid PRIVMSG #esoteric :it went out of date years ago < 1118602437 0 :harkeyahh_!unknown@unknown.invalid PRIVMSG #esoteric :you really need to upgrade your machine < 1118602574 0 :smott!unknown@unknown.invalid PRIVMSG #esoteric :typical of me, always years behind the current technology < 1118602606 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :I'd say check lament's website for it but I cannot find a current one < 1118602623 0 :harkeyahh_!unknown@unknown.invalid PRIVMSG #esoteric ::-/ Well, we can't all be up-to-date < 1118603149 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :check the chat logs, lament posted a link to his smallfuck->smetana compiler in the last few days < 1118603175 0 :smott!unknown@unknown.invalid PRIVMSG #esoteric :ok < 1118604023 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :graue: have you made hello world in qdeql? < 1118604066 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :yeah, it's in the distribution < 1118604085 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :hello.qdeql < 1118604122 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :ok i must look more carefully :) < 1118604210 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :arh < 1118604270 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :hey, maybe i should make & do nothing on EOF rather than enqueueing 0 < 1118604293 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :that would make writing some programs more challenging, but then cat could handle binary files < 1118604309 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :mmmh.. binary.. < 1118604657 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :bbl < 1118604660 0 :Keymaker!unknown@unknown.invalid PART #esoteric :? < 1118605662 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :Hey peeps...Roll up...Roll up... < 1118605749 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :It is my pleasure to announce the release of Lost Kingdom (Enhanced Brainfuck Edition) < 1118605833 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :http://jonripley.com/brainfuck/games/ < 1118605859 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :Lost Kingdom is a text adventure written in Brainfuck < 1118605892 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :Probably the first ever piece of interactive fiction ever written in an esoteric programming language < 1118605928 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :Also one of the largest non-trivial Brainfuck programs ever written < 1118605933 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :Have fun! < 1118605969 0 :harkeyahh_!unknown@unknown.invalid QUIT :"leafing" < 1118606719 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :Holy fuck....... < 1118606809 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :ACTION bows down to {^Raven^}, his new god. < 1118606920 0 :lindi-!unknown@unknown.invalid QUIT :Read error: 110 (Connection timed out) < 1118606952 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :ACTION is sporting a grin larger than the recommended specifications < 1118607133 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :...omg. < 1118607571 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :you wrote this in BFBASIC, right? < 1118608166 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :yes...but trust me it was a non-trivial exercide < 1118608194 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :ACTION shuffles nervously < 1118608654 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :it seems like it's impossible to read binary files in brainfuck < 1118608666 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :if the implementation returns -1 on EOF, you can't read a 255 byte < 1118608673 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :if the implementation returns 0, you can't read a 0 byte < 1118608691 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :and if it implements EOF as no change, you get to choose what byte you can't read, but you still can't read a certain byte value! < 1118608734 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :It will be possible in the future to handle binary files and do a lot more than that with any esolang capable of IO < 1118608776 0 :harkeyahh!~zillermae@206-81-148-32.slkc.qwest.net JOIN :#esoteric < 1118608780 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :but at the moment it is problematic as you say < 1118608809 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :it's not a problem in Kipple! < 1118608835 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :at the moment, you say? is there an official revision on the way? ;) < 1118608848 0 :harkeyahh!unknown@unknown.invalid PRIVMSG #esoteric :omfg i forgot how to do a crying emotiocon < 1118608863 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :there's that EsoAPI thing < 1118608864 0 :harkeyahh!unknown@unknown.invalid PRIVMSG #esoteric ::'( < 1118608865 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric ::'( < 1118608883 0 :harkeyahh!unknown@unknown.invalid PRIVMSG #esoteric :omfg i forgot how many star wars films there are 5 or 6 :'( < 1118608896 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :7 :) < 1118608907 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :yeah, but only 0 of them were any good < 1118608916 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :do not underestimate the power of the Holiday Special ;) < 1118608925 0 :harkeyahh!unknown@unknown.invalid PRIVMSG #esoteric ::'( no there can't be 7 then i am missing 2 films < 1118608947 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :well, really, there are 6 < 1118608954 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :PESOIX is in development which is a POSIX style layer for any esolang < 1118608965 0 :harkeyahh!unknown@unknown.invalid PRIVMSG #esoteric :star wars is the worst trilogy ever :'( < 1118608984 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :raven: interesting. how will that solve the EOF problem in BF? < 1118609052 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :the original star wars trilogy are among my favorite movies, but the new trilogy is crap < 1118609064 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :The official URL for PESOIX is http://catseye.mine.nu:8080/projects/pesoix/doc/pesoix.html but also take a peek at http://jonripley.com/easel/ < 1118609130 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :PESOIX includes an implementation independant call to test for EOF < 1118609230 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :looks interesting :) < 1118609565 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :thanks < 1118609621 0 :sp3tt_!unknown@unknown.invalid QUIT :Read error: 54 (Connection reset by peer) < 1118611332 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :is the owner of the soojung blog here? I'd really love to know the English translation of your entry! Thanks for wirting it! < 1118611680 0 :J|x!jix@p5489C260.dip.t-dialin.net JOIN :#esoteric < 1118611765 0 :jix!unknown@unknown.invalid QUIT :Nick collision from services. < 1118611768 0 :J|x!unknown@unknown.invalid NICK :jix < 1118612056 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :ACTION wishes that Keymaker was around earlier < 1118612709 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :{^Raven^}: you mean http://sapzil.info/soojung/entry.php?id=620 ? < 1118612757 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :Yes < 1118612788 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :Yes... I wrote it :) < 1118612821 0 :lindi-!~lindi@kulho150.adsl.netsonic.fi JOIN :#esoteric < 1118612824 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :catseye.mine.nu:8080 doesn't work < 1118612844 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :Thanks, I have tried to read it via Babelfish but not much luck :( < 1118612859 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :{^Raven^}: Babelfish... omg :S < 1118612883 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :it's 5:48 am now... i have to sleep ;) < 1118612892 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :(GMT+09:00) < 1118612895 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :nite < 1118613066 0 :tokigun!unknown@unknown.invalid NICK :t0k1gun < 1118613114 0 :t0k1gun!unknown@unknown.invalid NICK :tokigun^away < 1118613282 0 :Keymaker!~Not@wire74.adsl.netsonic.fi JOIN :#esoteric < 1118613286 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :'ello < 1118613303 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :cpressey seems to have done nice job @ esowiki < 1118613308 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :hi there Keymaker < 1118613310 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :hi < 1118613336 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :nice website good to know that you found a new host < 1118613425 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :new host? < 1118613435 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :had i one before? :) < 1118613440 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :oh wait < 1118613441 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :yeah < 1118613445 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :school server < 1118613471 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :yes, bf-hacks is now my place along with koti.mbnet.fi/yiap/ < 1118613541 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :what means 'non-trivial'? < 1118613547 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :too lazy to search for a dictionary.. < 1118613589 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :in programming terms it means really, really difficult aka usually almost impossible < 1118613643 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :ok < 1118613646 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :cheers < 1118613652 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :writing Hello world in brainfuck is trivial. Writing it in Malbolge is not.... < 1118613663 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric ::) < 1118613712 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :keymaker: you missed my announcement earler :( < 1118613721 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :ok what it was? < 1118613738 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :(i was eating birthday cake and reading) < 1118613822 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :keymaker: http://jonripley.com/brainfuck/games/ (look for Lost Kingdom) < 1118613890 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :very nice < 1118613893 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :ACTION faints < 1118614038 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :have you used any text-to-brainfuck generators? < 1118614046 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :or everything just pure typed brainfuck? < 1118614280 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :ah, not, but still awesome :) < 1118614293 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :now i have to try it :) although i suck at text games < 1118614302 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :it was a lot of hard work < 1118614335 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :technichally it's two different(ish) games rolled into one, a conversion of the original and a specially enhanced version < 1118614345 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :have fun tho < 1118614724 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :nite < 1118614757 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :nite < 1118614766 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :nite < 1118614767 0 :jix!unknown@unknown.invalid QUIT :"Banned from network" < 1118619243 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :anyone got more information about aura?? < 1118620549 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :figure it out yourself! < 1118620555 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :(no, no one does) < 1118620679 0 :harkeyahh!unknown@unknown.invalid PRIVMSG #esoteric :i developed a new companion to html not a programming language, but close enough < 1118620685 0 :harkeyahh!unknown@unknown.invalid PRIVMSG #esoteric :it is the rival of CSS < 1118620690 0 :harkeyahh!unknown@unknown.invalid PRIVMSG #esoteric :called TSS < 1118620724 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric ::) < 1118620735 0 :harkeyahh!unknown@unknown.invalid PRIVMSG #esoteric :Tiled Style Sheets 1.0 < 1118620809 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :LOL < 1118620818 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :Good ol' arrange->tiled < 1118620999 0 :harkeyahh!unknown@unknown.invalid PRIVMSG #esoteric :do brainfuck files have a .bf extension? < 1118621011 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :Sometimes .b, sometimes .bf < 1118621023 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :usually .b I think < 1118621032 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :.bf is also used for befunge < 1118621036 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :I always use .b as .bf is used by befunge < 1118621058 0 :harkeyahh!unknown@unknown.invalid PRIVMSG #esoteric :okay, thanks much < 1118621117 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :bf is for befunge, use b instead :) < 1118621127 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :i use b < 1118621227 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :i hate to think what Befuck and Befreak must use < 1118621279 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :well, there is no reason to limit extension to 1-3 chars really... < 1118621288 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :yeah < 1118621314 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :.befuck < 1118621316 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :.befreak < 1118621317 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric ::P < 1118621328 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :Anybody have a SCSI terminator they can pass me through IRC? < 1118621964 0 :fizzie!unknown@unknown.invalid PRIVMSG #esoteric :I can't seem to fit mine into the floppy drive for DIGITIZING. < 1118622003 0 :fizzie!unknown@unknown.invalid PRIVMSG #esoteric :It's for scsi-2, with that HD50 connector, if that's ok. < 1118622075 0 :harkeyahh_!~zillermae@206-81-148-32.slkc.qwest.net JOIN :#esoteric < 1118622157 0 :fizzie!unknown@unknown.invalid PRIVMSG #esoteric :It's originally from an SGI Indy, and has a value-adding "feature" of not being able to fit to the (inset) scsi connectors of an external Sun HD box. < 1118622189 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :what are you talking about?! < 1118622223 0 :fizzie!unknown@unknown.invalid PRIVMSG #esoteric :The SCSI terminator requested few lines ago. < 1118622326 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :what is it? < 1118622330 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :I'm very SCSI-inept .... this is old, and I'm not sure how old SCSI-2 is, or whether this is SCSI-2 or SCSI-1 < 1118622392 0 :fizzie!unknown@unknown.invalid PRIVMSG #esoteric :Well... if it has a small-ish (well, small for 50 pins) 50-pin connector, it's probably scsi-2. < 1118622407 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :It's pretty massive. < 1118622420 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :This is an olde Apple CD-ROM drive. < 1118622443 0 :fizzie!unknown@unknown.invalid PRIVMSG #esoteric :Ah, then it's probably the Centronics connector, which is larger. HD50 would look like http://www.cselex.com/images-large/HD50.jpg < 1118622481 0 :fizzie!unknown@unknown.invalid PRIVMSG #esoteric :Although I guess I'd have some sort of trouble DCC'ing a physical object anyway. < 1118622533 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :http://www.elara.ie/elara/graphics/Belkin/OR1230000015229.jpg < is this a SCSI terminator? I thought SCSI terminators only had one end ... < 1118622600 0 :fizzie!unknown@unknown.invalid PRIVMSG #esoteric :Pretty hard to say from the image. Usually they do have only a single connector. < 1118622600 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :yo < 1118622606 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :hi < 1118622656 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :Keymaker: seen my tentative x=not(x)? < 1118622721 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :could you give it to me as pure brainfuck? < 1118622744 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :i get confused by those wiki versions that have instructions replaced with text < 1118622787 0 :fizzie!unknown@unknown.invalid PRIVMSG #esoteric :I'm not saying it _isn't_ a terminator, though. Some seem to have two connectors, assumedly to work as terminators when nothing's connected, but allow adding new devices to the end of the chain temporarily. < 1118622810 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :assume x is at 0, temp0 is at 1, and D = 0; then: >[-]<[>+<[-]]+>[-<->] < 1118622863 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :Keymaker: a label means: insert as many > or < as to go to the given label < 1118622915 0 :fizzie!unknown@unknown.invalid PRIVMSG #esoteric :Or possibly a: "Feed-through SCSI terminator: Use this if you have no more connectors left on your cable to connect a SCSI terminator. You plug the last connector in one side of the SCSI terminator and then plug the other side of the terminator into your last device. Helps keep cable lengths short." < 1118622922 0 :harkeyahh!unknown@unknown.invalid QUIT :Read error: 110 (Connection timed out) < 1118623027 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :hmm < 1118623049 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :so x is in cell 0? and this is non-wrapping? < 1118623057 0 :harkeyahh_!unknown@unknown.invalid QUIT :Read error: 145 (Connection timed out) < 1118623090 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :I may be mistaken, I haven't tried the code < 1118623097 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :or should this be < 1118623100 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :for bits? < 1118623117 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :like 0 to 1 and 1 to 0? < 1118623121 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :this means: if x = 0 then x = 1 else x = 0 < 1118623131 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :then it works < 1118623152 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :yeah, it does that, what you said, yes < 1118623153 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :isn't that what not(x) does? < 1118623164 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :or is it bitwise not? < 1118623173 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :it is bitwise not i assume < 1118623178 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :oh! < 1118623181 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :I see < 1118623184 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :ok < 1118623197 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :I assumed logical not < 1118623245 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :for bitwise signed it would be NOT(x)=MAXCELLVALUE-x < 1118623268 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :yeah < 1118623269 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :yeah, assuming MAXCELLVALUE is a power of 2 - 1 :) < 1118623288 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :wait.. i'm confused with these namings < 1118623321 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :doesn;t matter if cell values wrap < 1118623361 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :what's difference between bitwise and logical? < 1118623369 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :does logical return only 0 or 1? < 1118623393 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :and bitwise does stuff by first slicing values to bits and then doing bit operations and so on? < 1118623398 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :yeah, logical NOT returns only TRUE or FALSE < 1118623408 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :ah. then pgimenos code is logical not < 1118623425 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :(sorry, i got confused with these names) < 1118623451 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :logical not that works with values bigger than 1, as well < 1118623452 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :"bitwise" means one bit at a time < 1118623455 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :ok < 1118623483 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :you can cheat a bitwise NOT easily in BF < 1118623556 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :{^Raven^}: btw, this is related to http://www.esolangs.org/wiki/Brainfuck_algorithms < 1118623588 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :yep < 1118623664 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :heh, my algorithm matches calamari's one except for the last [-x-temp0] instead of [temp0-x-] < 1118623690 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :nice page there < 1118623697 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :yeah < 1118623707 0 :harkeyahh!~zillermae@206-81-148-32.slkc.qwest.net JOIN :#esoteric < 1118623735 0 :harkeyahh!unknown@unknown.invalid PRIVMSG #esoteric :sup ChanServ my babeh < 1118623743 0 :harkeyahh!unknown@unknown.invalid PRIVMSG #esoteric :almost finished with TSS < 1118623765 0 :harkeyahh!unknown@unknown.invalid PRIVMSG #esoteric :had to program the neutralizer in bf < 1118623861 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :I suck at BF, btw < 1118623886 0 :harkeyahh!unknown@unknown.invalid PRIVMSG #esoteric :I had to hack the compiler to get it to work < 1118623888 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :If I can remember how to program BF: (value)>[-]-<[>-<] sets cell+1 to bitwise NOT cell < 1118623926 0 :harkeyahh!unknown@unknown.invalid PRIVMSG #esoteric :{^Raven^} I should upload it so you can take a look at it < 1118624013 0 :harkeyahh!unknown@unknown.invalid PRIVMSG #esoteric :{^Raven^} http://pastebin.bafserv.com/412 < 1118624027 0 :harkeyahh!unknown@unknown.invalid PRIVMSG #esoteric :in the //INSET BF NEUTRALIZER bit < 1118624065 0 :harkeyahh!unknown@unknown.invalid PRIVMSG #esoteric :*note it has been hacked to adjsut for some ASCII differences in TSS < 1118624111 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :or >[-]-<[>-<]>[<+>]< to set cell=NOT(cell); (cell+1) = 0 < 1118624146 0 :harkeyahh!unknown@unknown.invalid PRIVMSG #esoteric :yeah I would have done it that way but then the page outputs backwards < 1118624181 0 :harkeyahh!unknown@unknown.invalid PRIVMSG #esoteric :h/o going to get a manual bbm < 1118624483 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :logical NOT is a bit harder < 1118624899 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :hey, here's interesting phrase: "Pile up Z's" < 1118624909 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :means "Get some sleep" < 1118624920 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :according to some slang of the fifties page i'm reading < 1118624930 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric ::) < 1118624967 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :Umm, wouldn't logical not just be bitwise not proceeded by [[-]+] ? < 1118624987 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :Oh wait ... < 1118624997 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :Yeah, that's right. < 1118625009 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :00000000 becomes 11111111 becomes 00000001 < 1118625019 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :00000001 becomes 11111110 --- never mind, I'm dumb. < 1118625165 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :got as far as >[-]<[>+<[-]]>[<+>]< and >[-]+<[>-] but not luck < 1118625182 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :keep forgetting the other condition < 1118625188 0 :harkeyahh!unknown@unknown.invalid PRIVMSG #esoteric :okay got it < 1118625222 0 :harkeyahh!unknown@unknown.invalid PRIVMSG #esoteric :I was reading up i think it will be fine < 1118625252 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :ACTION is off to bed before morning happens again < 1118625263 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :nite all < 1118625267 0 :harkeyahh!unknown@unknown.invalid PRIVMSG #esoteric :nite raven < 1118625298 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :nite < 1118625334 0 :harkeyahh!unknown@unknown.invalid PRIVMSG #esoteric :Keymaker did you see the TSS source code? < 1118625679 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :no < 1118625737 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :but i must go now < 1118625747 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :3:26 am and i'm tired :) < 1118625754 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :'nite < 1118625761 0 :Keymaker!unknown@unknown.invalid QUIT :"I've seen this déjà vu before.." < 1118626117 0 :calamari!~calamari@dialup-4.240.69.84.Dial1.Phoenix1.Level3.net JOIN :#esoteric < 1118626124 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :hi < 1118626136 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :Hoi < 1118626183 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :hey there < 1118626208 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :howdy < 1118626209 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :hi Raven.. you're mentioned on the wiki under BFBASIC :) < 1118626223 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :am i? cool! must check that out < 1118626233 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :don't get too excited.. lol < 1118626243 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :OK, rather than finding a SCSI terminator, I'll ask: Is there any way to install Debian on an olde PowerPC laptop with a disk drive and no networking or CD? :P < 1118626298 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :null-modem cable perhaps? < 1118626312 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :It's a Mac. < 1118626316 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :i released Lost Kingdom to the world today :) but i guess you know that already ;) < 1118626365 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :anyways i'm off to bed, nite < 1118626392 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :gregor: doesn't it have some equivalent of a serial port? < 1118626423 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :kipple: It has a modem ... and a strange port with a little telephone on it XD < 1118626431 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :(Gregor is not a macintosh expert :P) < 1118626471 0 :fizzie!unknown@unknown.invalid PRIVMSG #esoteric :A disk drive as in a floppy one? < 1118626471 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :nite {^Raven^} < 1118626519 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :fizzie: Yeah. < 1118626520 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :raven: cool! (goes off to download) < 1118626523 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :Well, it has an HDD too. < 1118626548 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :BTW {^Raven^}, though Lost Kingdom is whooping my arse, it's quite awesome. < 1118626575 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :bah < 1118626586 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :show us how impressive the source in BFBASIC looks < 1118626611 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :the way it uses brainfuck is no better than giving us a big .exe file < 1118626629 0 :fizzie!unknown@unknown.invalid PRIVMSG #esoteric :(I'm not a mac expert either.) I've once installed linux on one x86 laptop much like that one. I used the internal modem in the laptop, connected to another modem on a desktop box (with atx3 they won't insist on a dial tone) running pppd, then did a network install. < 1118626634 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :and saying "look what i did in machine code!" < 1118626644 0 :fizzie!unknown@unknown.invalid PRIVMSG #esoteric :For booting you'd probably need a bootable mac floppy. < 1118626660 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :graue: I think a .class file might be a better comparison. < 1118626675 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :fizzie: I can boot into the basic installer, I just can't get the packages from anywhere XD < 1118626690 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :GregorR, same difference < 1118626705 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :brainfuck is only interesting when it's handwritten < 1118626795 0 :fizzie!unknown@unknown.invalid PRIVMSG #esoteric :If there's a version that supports the modem and ppp, you could do it the way I did. If you're _really_ patient, you could also write the packages on gazillion floppies, and copy on the HD, and install from there, using the shell included in the installer. < 1118626815 0 :fizzie!unknown@unknown.invalid PRIVMSG #esoteric :Uh, 'copy on the HDD using the shell', I mean. < 1118626864 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :you'd only need two floppies, not a gazillion < 1118626893 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :but you would have to reuse them a gazillion times < 1118626907 0 :fizzie!unknown@unknown.invalid PRIVMSG #esoteric :Well, yes, gazillion floppyfuls (hee, nice word) of data. < 1118626937 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :That sounds like more fun than I can possibly describe 8-D < 1118626945 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :GregorR: yeah, it might not be too hard to convert from bfbasic bf back to bfbasic, since the source for bfbasic is available < 1118626962 0 :fizzie!unknown@unknown.invalid PRIVMSG #esoteric :It's like watching paint dry, only less interesting. < 1118627066 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :graue: re: handwritten, I disagree.. it might be a little unsettling to see a larger project in bf, but I think most people would agree that asm doesn't work out the best for huge projects.. bf is like asm in many ways < 1118627144 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :it just makes sense to use a compiler in large cases < 1118627449 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :calamari, yeah, but then why use brainfuck? < 1118627491 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :the reason to use brainfuck is it's challenging and interesting to write in < 1118627510 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :if you're compiling, why not just compile for your machine? < 1118627586 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :i wrote a DOS program once using only a hex editor, and that was interesting to have written something in machine code, but i don't compile mammoth C programs to 2 MB binaries and say, hey, look what i wrote in machine code! < 1118627592 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :the reason for it being interesting is a lie < 1118627775 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :graue: bf is cross platform.. and it is interesting to me: 1) example of the power of bf, 2) a fun game, 3) using bfbasic, 4) big, etc < 1118627802 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :hope that helps < 1118627836 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :graue: and if you have something cool to show off that your wrote in c, I don't think anyone here would mind :) < 1118627837 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :fair enough, but you gotta admit it ain't nothin' like a program actually written in brainfuck < 1118627881 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :graue: you wouldn't use bfbasic in a bfgolf tournament.. is that what you're looking for? :) < 1118627941 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :i wrote this in C, which is cross platform because it runs in wine: http://www.thunderpalace.com/software/blockman/ < 1118627952 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :i guess everyone here will be astounded at how impressive that is < 1118628138 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :impressive, most impressive.. obi-wan has taught you well, you have controlled your fear. now release your anger.. only your hatred can destroy me :) < 1118628169 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :since I know how big a star wars fan you are, I know you'll appreciate that ;) < 1118628225 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :thank you < 1118628243 0 :harkeyahh!unknown@unknown.invalid QUIT :Read error: 110 (Connection timed out) < 1118628305 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :graue: "BLOCKMAN.LVL is nonexistent or corrupt" < 1118628326 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :the file is there.. < 1118628372 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :not trying to run it from the zip or anything < 1118628407 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :hmm.. works from the command line < 1118628425 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :wonder where the bug is.. gnome, wine, or ubuntu? < 1118628677 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :graue: somehow I get the feeling the game is abandoned, but if not, the game would benefit from a menu, for restart, quit, and easy access to help < 1118628720 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :well, it was only a version 0.07 < 1118629019 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :*nod*, doesn't change my suggestion any :) < 1118629415 0 :harkeyahh!~zillermae@206-81-148-32.slkc.qwest.net JOIN :#esoteric < 1118632412 0 :graue!unknown@unknown.invalid PART #esoteric :? < 1118632625 0 :harkeyahh!unknown@unknown.invalid QUIT :"Chatzilla 0.9.68.5 [Firefox 1.0.4/20050511]" < 1118632801 0 :wooby!~wooby@ny-lancastercadent4g1-3a-236.buf.adelphia.net JOIN :#esoteric < 1118633574 0 :kipple!unknown@unknown.invalid QUIT :Read error: 110 (Connection timed out) < 1118633617 0 :smott_!~pocky@193.77.153.149 JOIN :#esoteric < 1118633796 0 :smott!unknown@unknown.invalid QUIT :Read error: 110 (Connection timed out) < 1118635165 0 :wooby!unknown@unknown.invalid QUIT : < 1118636284 0 :calamari!unknown@unknown.invalid QUIT :Read error: 110 (Connection timed out) < 1118636685 0 :calamari!~calamari@dialup-4.240.114.73.Dial1.Phoenix1.Level3.net JOIN :#esoteric < 1118636955 0 :GregorR!unknown@unknown.invalid QUIT :Success < 1118638515 0 :malaprop!unknown@unknown.invalid QUIT :"sleep" < 1118640471 0 :graue!~graue@ip68-100-130-21.dc.dc.cox.net JOIN :#esoteric < 1118640479 0 :graue!unknown@unknown.invalid QUIT :Client Quit < 1118640877 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :argh.. my esoshell hacks for printed backspaces don't seem to be working right < 1118640891 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :gotta give up for now, homework time < 1118646093 0 :tokigun^away!unknown@unknown.invalid NICK :tokigun < 1118649341 0 :calamari!unknown@unknown.invalid QUIT :"Leaving" < 1118649599 0 :clog!unknown@unknown.invalid QUIT :ended < 1118649600 0 :clog!unknown@unknown.invalid JOIN :#esoteric < 1118658337 0 :kipple!~kipple@163.80-202-100.nextgentel.com JOIN :#esoteric < 1118661189 0 :Keymaker!~Not@wire74.adsl.netsonic.fi JOIN :#esoteric < 1118661212 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :hmmm. grrhhh. i had some question in mind just second ago < 1118661215 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :.. < 1118661400 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :yes.. what's difference between random and undefined? < 1118661512 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :undefined can be anything, while random implies a certain distribution of values < 1118661561 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :ah < 1118661610 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :at least that's how I see it. there are probably people here who can put it more formally < 1118661634 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric ::) < 1118661652 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :as well, if anyone has any information about aura, tell me < 1118661690 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :I've looked at the interpreter source. is there any web site? < 1118661710 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :can't find < 1118662437 0 :fizzie!unknown@unknown.invalid PRIVMSG #esoteric :I'd say the precise meanings of 'random' and 'undefined' depend on the context in which they are used. In the C specs for example, the term undefined is well-defined. < 1118662441 0 :fizzie!unknown@unknown.invalid PRIVMSG #esoteric :("behavior, upon use of a nonportable or erroneous program construct, of erroneous data, or of indeterminately valued objects, for which this International Standard imposes no requirements") < 1118663299 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :bbl. < 1118663301 0 :Keymaker!unknown@unknown.invalid QUIT :"I've seen this déjà vu before.." < 1118664841 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :mornin peeps < 1118667639 0 :tokigun!unknown@unknown.invalid QUIT :"Chatzilla 0.9.68.5 [Firefox 1.0.3/20050414]" < 1118668328 0 :jix!jix@p5489F563.dip.t-dialin.net JOIN :#esoteric < 1118668354 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :moin < 1118668411 0 :sp3tt!~chatzilla@lite-148-133.umenet.net JOIN :#esoteric < 1118670179 0 :malaprop!~ph@ppp-68-251-59-237.dsl.chcgil.ameritech.net JOIN :#esoteric < 1118676707 0 :Falling!gang@CPE00a0cc7896fe-CM0012250080d4.cpe.net.cable.rogers.com JOIN :#esoteric < 1118676814 0 :Falling!unknown@unknown.invalid PART #esoteric :? < 1118677577 0 :tokigun!~tokigun@dor204226.kaist.ac.kr JOIN :#esoteric < 1118679281 0 :jix!unknown@unknown.invalid QUIT :"Banned from network" < 1118681175 0 :jix!jix@p5489F563.dip.t-dialin.net JOIN :#esoteric < 1118681205 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :back < 1118682858 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :hullo < 1118683788 0 :harkeyahh!~zillermae@206-81-148-32.slkc.qwest.net JOIN :#esoteric < 1118683823 0 :harkeyahh!unknown@unknown.invalid PRIVMSG #esoteric :ChanServ my babeh < 1118685206 0 :calamari_!~jeffryj@lilly.csoft.net JOIN :#esoteric < 1118685212 0 :calamari_!unknown@unknown.invalid PRIVMSG #esoteric :hi < 1118685224 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :hi there < 1118685333 0 :calamari_!unknown@unknown.invalid PRIVMSG #esoteric :hi raven, just sent you a mail :) can't work on it right now tho < 1118685407 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :me either, i have a cross compiler to port to C and a load of other programs to write < 1118685471 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :I have some ideas for writing better brainfuck virtual machines that I need to write up < 1118685515 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :ACTION prefers the term virtual-machine to interpreter any day < 1118685675 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :Doesn't "virtual machine" include the idea of sandboxing? < 1118685795 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :It can do, it depends ultimately on the functionality you are trying to achieve < 1118685836 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :The machine isn't virtual if it's stepping all over your real machine, tho. < 1118685895 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :IMHO any current interpreter that allows a program to wander into arbitary workspace is horrificly broken < 1118685909 0 :calamari_!unknown@unknown.invalid PRIVMSG #esoteric :malaprop: would you consider Java a virtual machine, even though it ties in to all sorts of low level stuff? < 1118686062 0 :calamari_!unknown@unknown.invalid PRIVMSG #esoteric : < 1118686066 0 :calamari_!unknown@unknown.invalid PRIVMSG #esoteric :oops :) < 1118686358 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :Java the language? No, it's a language. JVM, yes, as a browser applet is sandoboxed. < 1118686457 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :*depending on the security settings active at the time. A JVM with appropriate permissions can access the underlying OS < 1118687152 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :well, I don't think there is a definition of virtual machine that everbody would agree on < 1118687280 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :I don't see any definitions on Wikipedia that don't include some kind of sandboxing. Where do y'all see it defined without? < 1118687410 0 :graue!~graue@ip68-100-130-21.dc.dc.cox.net JOIN :#esoteric < 1118687456 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :but what is sandboxing? brainfuck interpreters isolates the programs from the computer, and does not allow arbitrary memory and file access < 1118687556 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :bf is isolated because there's no implementation of file IO. It'd be a VM if bf had IO and it was to a fake filesystem only. < 1118687564 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :malaprop: google for - define:virtual machine < 1118687660 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :{^Raven^}: Every definition it returns includes sandboxing. Heck, one simply says "A machine which is implemented in software." < 1118687894 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric : Doesn't "virtual machine" include the idea of sandboxing? <--- my answer would be yes < 1118687905 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :malaprop: At the lowest level a VM is a bytecode interpreter. A brainfuck interpreter interprets brainfuck bytecode. But I think we'll have to agree to disagree on this one. < 1118687962 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :i don't see how a brainfuck interpreter fails to be a machine implemented in software < 1118687978 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :I won't agree to disagree. You're using a term (VM) in place of the proper one (interpreter). < 1118687991 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :well on some level everything's just a virtual turing machine < 1118687993 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :graue: It doesn't include virtual disks, screens, anything. < 1118688033 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :machines don't need to have those things to be machines < 1118688042 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :I'm starting to think that "it's turing complete" is the computer science equivalent of solipsism. < 1118688093 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :And if we're going to go into boring useless theoretical concerns, nothing is a turing machine because they're finite. < 1118688121 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :the things we have, that is. < 1118688411 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :i'll reconnect < 1118688416 0 :tokigun!unknown@unknown.invalid QUIT :"Chatzilla 0.9.68.5 [Firefox 1.0.3/20050414]" < 1118688436 0 :tokigun!~tokigun@dor204226.kaist.ac.kr JOIN :#esoteric < 1118688436 0 :graue!unknown@unknown.invalid PART #esoteric :? < 1118688452 0 :tokigun!unknown@unknown.invalid QUIT :Client Quit < 1118688469 0 :tokigun!~tokigun@dor204226.kaist.ac.kr JOIN :#esoteric < 1118688478 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :back. < 1118688577 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :hi tokigun < 1118688596 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :hello ;) < 1118690266 0 :harkeyahh!unknown@unknown.invalid QUIT :Client Quit < 1118691254 0 :Keymaker!~a@wire74.adsl.netsonic.fi JOIN :#esoteric < 1118691268 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :hello < 1118691382 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :hey < 1118691385 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :hello < 1118691419 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :hi < 1118691734 0 :smott_!unknown@unknown.invalid NICK :smott < 1118693110 0 :harkeyahh!~zillermae@206-81-148-32.slkc.qwest.net JOIN :#esoteric < 1118693129 0 :harkeyahh!unknown@unknown.invalid PRIVMSG #esoteric :sup ChanServ < 1118693317 0 :harkeyahh!unknown@unknown.invalid QUIT :Client Quit < 1118693625 0 :cpressey_!unknown@unknown.invalid PRIVMSG #esoteric :brainfuck has a virtual teletype < 1118693633 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :hm? < 1118693642 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :what's that? < 1118693645 0 :cpressey_!unknown@unknown.invalid PRIVMSG #esoteric :re malaprop's assertion < 1118693670 0 :cpressey_!unknown@unknown.invalid PRIVMSG #esoteric :< malaprop> graue: It doesn't include virtual disks, screens, anything. < 1118693683 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :ok < 1118693699 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :malaprop is a sad sad man < 1118693712 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :if he thinks a language should provide access to a file system < 1118693724 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :heh yeah :) < 1118694041 0 :calamari_!unknown@unknown.invalid QUIT :"Leaving" < 1118694781 0 :harkeyahh!~zillermae@206-81-148-32.slkc.qwest.net JOIN :#esoteric < 1118695033 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :I didn't say a language should, was pointing out that this one didn't. < 1118695044 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric ::) < 1118695073 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :It starts simple: first programmers want access to files. Then before you know it they'll want OpenGL. < 1118695085 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :hehe < 1118695102 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :where's BFSDL? < 1118695192 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :What's BFSDL? < 1118695206 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :I'm familiar with Python's BDFL... < 1118695246 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :nothing :) it was a joke, SDL libraries for brainfuck :) < 1118695258 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :ah, heh < 1118695326 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :Or bfPVM. < 1118695625 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :Keymaker: SDL for Brainfuck? sounds good :) < 1118695706 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :You could see if you can port SWIG. < 1118695735 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :There is EsoAPI and Easel in development as part of he PESOIX specification for esolangs. < 1118695787 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :EsoAPI allows low level disk access (when running as the main OS) and Easel allows file IO and more < 1118696064 0 :jix!unknown@unknown.invalid PART #esoteric :? < 1118696068 0 :jix!jix@p5489F563.dip.t-dialin.net JOIN :#esoteric < 1118696383 0 :sp3tt!unknown@unknown.invalid QUIT :Read error: 104 (Connection reset by peer) < 1118696630 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :yeah. and to note: i am not going to do anything :) < 1118696823 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :hmm. someone search "simpsons" with google.. what add it gives you? < 1118696953 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :A whole lot of pages about the TV show. < 1118696974 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :i mean advertise < 1118696992 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :Got me, blocked. < 1118697000 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :ebay and a warez site < 1118697063 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :ok. then the ads aren't same for us < 1118697174 0 :fizzie!unknown@unknown.invalid PRIVMSG #esoteric :"SEX XXX PORN LIVE SHOWS" was the ad I got. < 1118697226 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :well me too.. :} < 1118698826 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :hehe < 1118698834 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :these simpsons quotes are so funny :D < 1118699009 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :"My Homer is not a communist! He may be a pig, a liar, a communist but he is not a porn star!" -- grandpa < 1118699303 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :"I have been shot eight times this year, and as a result, I almost missed work." -- apu < 1118699468 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :"The Statue of Liberty? Where are we?!" -- milhouse < 1118699790 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :"McBain to base! Under attack by Commie-Nazis!" < 1118700087 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :anyways, i'm off to watch some simpsons. then probably go night photographing. so, see you tomorrow :) < 1118700097 0 :Keymaker!unknown@unknown.invalid PART #esoteric :? < 1118700948 0 :tokigun!unknown@unknown.invalid NICK :tokigun^away < 1118701722 0 :jix!unknown@unknown.invalid QUIT :"Banned from network" < 1118704076 0 :GregorR!~GregorR@c-24-21-138-66.hsd1.or.comcast.net JOIN :#esoteric < 1118709647 0 :harkeyahh!unknown@unknown.invalid PRIVMSG #esoteric :simpsons is on in 20 minutes god i need to watch it < 1118709650 0 :harkeyahh!unknown@unknown.invalid PRIVMSG #esoteric :i am so distressed < 1118709859 0 :heatsink!~heatsink@c-24-61-94-111.hsd1.nh.comcast.net JOIN :#esoteric < 1118709959 0 :harkeyahh!unknown@unknown.invalid PRIVMSG #esoteric :heatsink is 4am like in the nighttime? < 1118709989 0 :heatsink!unknown@unknown.invalid PRIVMSG #esoteric :harkeyahh: yes, in most parts of the world < 1118710013 0 :harkeyahh!unknown@unknown.invalid PRIVMSG #esoteric :wow, he is really a nighttime munchkin < 1118710023 0 :heatsink!unknown@unknown.invalid PRIVMSG #esoteric :who? < 1118710030 0 :harkeyahh!unknown@unknown.invalid PRIVMSG #esoteric :heatsink you have a pretty name < 1118710037 0 :harkeyahh!unknown@unknown.invalid PRIVMSG #esoteric :who did you kill for it? < 1118710049 0 :harkeyahh!unknown@unknown.invalid PRIVMSG #esoteric :the guy i am trying to get a job from < 1118710055 0 :heatsink!unknown@unknown.invalid PRIVMSG #esoteric :are you a bot? < 1118710062 0 :heatsink!unknown@unknown.invalid PRIVMSG #esoteric :you talk like one. < 1118710079 0 :harkeyahh!unknown@unknown.invalid PRIVMSG #esoteric :funny you mention that, because lots of people think I am a bot. < 1118710096 0 :harkeyahh!unknown@unknown.invalid PRIVMSG #esoteric :but I don't look like a bot < 1118710105 0 :harkeyahh!unknown@unknown.invalid PRIVMSG #esoteric :therefore I am not a bot < 1118710196 0 :harkeyahh!unknown@unknown.invalid PRIVMSG #esoteric :Error:#4128 _does not compute_ immediate implosion threshold broken < 1118710198 0 :harkeyahh!unknown@unknown.invalid QUIT :"Chatzilla 0.9.68.5 [Firefox 1.0.4/20050511]" < 1118710269 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :did harkeyhh pass the turing test? < 1118710295 0 :harkeyahh!~zillermae@206-81-148-32.slkc.qwest.net JOIN :#esoteric < 1118710297 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :He must not have been written in GregorR's #Esolang. < 1118710311 0 :harkeyahh!unknown@unknown.invalid PRIVMSG #esoteric :Hello, ChanServ how are you today? < 1118710326 0 :harkeyahh!unknown@unknown.invalid PRIVMSG #esoteric :Fine thank you < 1118710351 0 :harkeyahh!unknown@unknown.invalid PRIVMSG #esoteric :No I haven't, and yes I do. < 1118710501 0 :heatsink!unknown@unknown.invalid PRIVMSG #esoteric :What is going on here? < 1118710521 0 :harkeyahh!unknown@unknown.invalid PRIVMSG #esoteric :an affair < 1118710564 0 :harkeyahh!unknown@unknown.invalid PRIVMSG #esoteric :apparently Jackson got 10 years to life in Juvenile Hall < 1118710610 0 :heatsink!unknown@unknown.invalid PRIVMSG #esoteric :ACTION imagines that harkeyahh looks like a paperclip :3 < 1118710631 0 :harkeyahh!unknown@unknown.invalid PRIVMSG #esoteric :paperclips are rather useful < 1118710645 0 :harkeyahh!unknown@unknown.invalid PRIVMSG #esoteric :I wouldn't mind have such a body < 1118710653 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :as long as they are not animated < 1118710657 0 :harkeyahh!unknown@unknown.invalid PRIVMSG #esoteric :Pliable yet strong < 1118710670 0 :heatsink!unknown@unknown.invalid PRIVMSG #esoteric :flexible, smooth < 1118710695 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :can they do anything other than eject CDs/DVDs? < 1118710706 0 :harkeyahh!unknown@unknown.invalid PRIVMSG #esoteric :Paperclips are very sexy toys < 1118710720 0 :harkeyahh!unknown@unknown.invalid PRIVMSG #esoteric :since they are small, they can go almost anywhere < 1118710795 0 :harkeyahh!unknown@unknown.invalid PRIVMSG #esoteric :OMFG, I must leave. < 1118710804 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :ACTION tries to drive the mental images out of his brain < 1118710847 0 :heatsink!unknown@unknown.invalid PRIVMSG #esoteric :okay, bye harkeyahh < 1118710859 0 :harkeyahh!unknown@unknown.invalid PRIVMSG #esoteric :Sorry, I am not here right now. < 1118710869 0 :heatsink!unknown@unknown.invalid PRIVMSG #esoteric :LIAR < 1118710892 0 :harkeyahh!unknown@unknown.invalid PRIVMSG #esoteric :please refrain from slanderous statements < 1118710939 0 :harkeyahh!unknown@unknown.invalid PRIVMSG #esoteric :I am afraid a deity is toching my inappropriately < 1118710964 0 :heatsink!unknown@unknown.invalid PRIVMSG #esoteric :I'm sure it has seen you naked as well. < 1118710990 0 :harkeyahh!unknown@unknown.invalid PRIVMSG #esoteric :that webcam was not supposed to be public! < 1118711163 0 :harkeyahh!unknown@unknown.invalid NICK :iamnothere < 1118711215 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :nite peeps < 1118711232 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :ACTION toddles off to bed < 1118711315 0 :heatsink!unknown@unknown.invalid PRIVMSG #esoteric :goodngiht {^Raven~} < 1118711396 0 :iamnothere!unknown@unknown.invalid TOPIC #esoteric :Another brainfuck site (http://www.bf-hacks.org/) is open! ~ http://chriscoyne.com/cfdg/ ~ Esolang wiki: http://esolangs.org/wiki/ Please pray for my package to arrive safely in La Puente CA. thnx much! < 1118711584 0 :iamnothere!unknown@unknown.invalid PRIVMSG #esoteric :{^Rave^} wake up < 1118711603 0 :iamnothere!unknown@unknown.invalid PRIVMSG #esoteric :pray for my package before you sleep < 1118711607 0 :iamnothere!unknown@unknown.invalid PRIVMSG #esoteric :it will give you goodluck < 1118711692 0 :kipple!unknown@unknown.invalid QUIT :Remote closed the connection < 1118711714 0 :iamnothere!unknown@unknown.invalid PRIVMSG #esoteric :heatsink how much is your nick? < 1118711761 0 :iamnothere!unknown@unknown.invalid PRIVMSG #esoteric :I will pay $300 in monthly installments of 00.925 < 1118711806 0 :iamnothere!unknown@unknown.invalid PRIVMSG #esoteric :trimonthly $6.50 < 1118711826 0 :iamnothere!unknown@unknown.invalid PRIVMSG #esoteric :annually $10 < 1118711869 0 :iamnothere!unknown@unknown.invalid PRIVMSG #esoteric :I'll tell you what < 1118711898 0 :iamnothere!unknown@unknown.invalid PRIVMSG #esoteric :heatsink $1500 for annual payments of $00.50 < 1118711950 0 :iamnothere!unknown@unknown.invalid PRIVMSG #esoteric :$10,000 for annual payments of $1.00! < 1118711987 0 :heatsink!unknown@unknown.invalid PRIVMSG #esoteric :I require annual payments of $1.00 plus payment of interest at 8% per year compounded monthly. < 1118712045 0 :iamnothere!unknown@unknown.invalid PRIVMSG #esoteric :$10,000 annual payments of $5 annual interest of .25 < 1118712074 0 :iamnothere!unknown@unknown.invalid PRIVMSG #esoteric :interest to be paid in full with the last payment < 1118712097 0 :iamnothere!unknown@unknown.invalid PRIVMSG #esoteric :plus $10,000 for wiring < 1118712113 0 :heatsink!unknown@unknown.invalid PRIVMSG #esoteric :There is no melloroos for monikers! < 1118712140 0 :iamnothere!unknown@unknown.invalid PRIVMSG #esoteric :don't be a mitch about it! I want your nick! < 1118712186 0 :iamnothere!unknown@unknown.invalid PRIVMSG #esoteric :I have made many acceptable offers and you have declined all of them < 1118712239 0 :iamnothere!unknown@unknown.invalid PRIVMSG #esoteric :7th heaven is the stupidest damn show < 1118715260 0 :iamnothere!unknown@unknown.invalid QUIT :Read error: 104 (Connection reset by peer) < 1118717101 0 :wooby!~wooby@ny-lancastercadent4g1-3a-236.buf.adelphia.net JOIN :#esoteric < 1118717376 0 :harkeyahh!~zillermae@206-81-148-32.slkc.qwest.net JOIN :#esoteric < 1118718377 0 :wooby!unknown@unknown.invalid QUIT : < 1118718450 0 :wooby!~wooby@ny-lancastercadent4g1-3a-236.buf.adelphia.net JOIN :#esoteric < 1118718559 0 :harkeyahh!unknown@unknown.invalid QUIT :Read error: 110 (Connection timed out) < 1118718611 0 :GregorR!unknown@unknown.invalid QUIT :Remote closed the connection < 1118718731 0 :GregorR!~GregorR@c-24-21-138-66.hsd1.or.comcast.net JOIN :#esoteric < 1118719093 0 :calamari!~calamari@dialup-4.240.108.86.Dial1.Phoenix1.Level3.net JOIN :#esoteric < 1118719101 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :hi < 1118719415 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :Hoi < 1118719525 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :A fine display of conversational skill, that was. < 1118719569 0 :heatsink!unknown@unknown.invalid PRIVMSG #esoteric :aye < 1118719617 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :Gettin' ready to release DirectNet Beta0.5 :) < 1118719640 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :GregorR: url? < 1118719664 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :http://directnet.sourceforge.net/ < 1118719690 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :(Not related to esoteric programming ;) ) < 1118719755 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :Any OSX users who can verify my ability to create workable DMGs? < 1118720116 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :ACTION tries to figure out how to cvs checkout the gaim plugin < 1118720140 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :It's in Beta0.5 ;) < 1118720158 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :And it's in the main directnet branch, you have to --enable-gaim-plugin to configure it. < 1118720258 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :oic, thanks < 1118720310 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :Also, it's undocumented and unintuitive since Gaim doesn't exactly provide the faculties for multiple connections >_> < 1118720336 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :Err, multiple connections by one plugin in an intuitive way. < 1118720415 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :it's magic :) cvs -z3 -d:pserver:anonymous@cvs.sourceforge.net:/cvsroot/directnet checkout -P directnet < 1118720722 0 :wooby!unknown@unknown.invalid QUIT : < 1118720737 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :Anybody have an HPUX box they want to compile on XD < 1118720744 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :Or Irix, Solaris, ... < 1118720746 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :cool.. configure. Wish I knew how to use that for my apps :) < 1118720763 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :Cygwin? :) < 1118720763 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :It's quite handy once you get the hang of it. < 1118720767 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :MingW. < 1118720774 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :hehe < 1118720786 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :And I have a crosscompiler for that :) < 1118720824 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :./configure: line 20979: cd: /home/calamari/directnet/./src/enc-cyfer/gmp: No such file or directory < 1118720826 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :(fyi) < 1118720849 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :Oh, forgot to mention ... < 1118720857 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :To compile from CVS you have to get GMP and Cyfer... < 1118720863 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :So first you have to run getcyfer.sh < 1118720874 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :I'll make that more intuitive ... in ten minutes XD < 1118720883 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :hehe < 1118720943 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :Just as soon as I get Beta0.5 up :) < 1118721543 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :Tada 8-D < 1118721627 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :hmm, weird.. cvs update didn't do anything < 1118721658 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :do->update < 1118721680 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :That was a different tada ;) < 1118721694 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :That was "Tada, finished releasing Beta0.5" < 1118722079 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :OK, now that's committed to CVS. < 1118722089 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :However, their anonymous CVS server sux, so it won't show up for a few hours. < 1118722107 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :Just go sh getcyfer.sh and aaaaaaaaaall will be well. < 1118722724 0 :harkeyahh!~zillermae@206-81-148-32.slkc.qwest.net JOIN :#esoteric < 1118722741 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :Hola sen~or < 1118722759 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :(I really have to stop speaking broken Spanish) < 1118723784 0 :malaprop!unknown@unknown.invalid QUIT :"quit" < 1118724687 0 :harkeyahh!unknown@unknown.invalid QUIT :"Chatzilla 0.9.68.5 [Firefox 1.0.4/20050511]" < 1118727185 0 :heatsink!unknown@unknown.invalid QUIT :"Leaving" < 1118729031 0 :lindi-!unknown@unknown.invalid QUIT :brown.freenode.net irc.freenode.net < 1118729033 0 :tokigun^away!unknown@unknown.invalid QUIT :brown.freenode.net irc.freenode.net < 1118729061 0 :tokigun^away!~tokigun@dor204226.kaist.ac.kr JOIN :#esoteric < 1118729061 0 :lindi-!~lindi@kulho150.adsl.netsonic.fi JOIN :#esoteric < 1118729856 0 :GregorR-L!~GregorR-L@c-24-21-138-66.hsd1.or.comcast.net JOIN :#esoteric < 1118732221 0 :tokigun^away!unknown@unknown.invalid NICK :tokigun < 1118732913 0 :GregorR-L!unknown@unknown.invalid PRIVMSG #esoteric :"You snagged a perfect girlfriend. Amy's rich, she probably has other characteristics ..." < 1118733061 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :o_O < 1118733086 0 :GregorR-L!unknown@unknown.invalid PRIVMSG #esoteric :Futurama = good show XD < 1118733219 0 :fizzie!unknown@unknown.invalid PRIVMSG #esoteric :I have an irix box, but it doesn't have a C compiler. :p < 1118733227 0 :GregorR-L!unknown@unknown.invalid PRIVMSG #esoteric :Hmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmm < 1118733231 0 :GregorR-L!unknown@unknown.invalid PRIVMSG #esoteric :XD < 1118733249 0 :GregorR-L!unknown@unknown.invalid PRIVMSG #esoteric :In all technicality, I could probably suffice with libc and some headers. < 1118733337 0 :fizzie!unknown@unknown.invalid PRIVMSG #esoteric :(I've been intending to hook that Sun HD box (the one I mentioned re that scsi terminator) to it and move /usr on it or something, but for some reason haven't yet.) < 1118733533 0 :fizzie!unknown@unknown.invalid PRIVMSG #esoteric :I guess I should -> work first. (Can't you use sourceforge's compile farm to try compiling it? There seems to be at least solaris/x86 and solaris/sparc.) < 1118733603 0 :GregorR-L!unknown@unknown.invalid PRIVMSG #esoteric :It works fine on Solaris. < 1118734034 0 :calamari!unknown@unknown.invalid QUIT :Read error: 110 (Connection timed out) < 1118735999 0 :clog!unknown@unknown.invalid QUIT :ended < 1118736000 0 :clog!unknown@unknown.invalid JOIN :#esoteric < 1118738429 0 :sp3tt!~chatzilla@cust-148-133.elhandel.umeaenergi.se JOIN :#esoteric < 1118739548 0 :GregorR-L!unknown@unknown.invalid QUIT :Read error: 110 (Connection timed out) < 1118744384 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :reading Korean Babeled into English is extermeley esoteric < 1118744403 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :I see armies of rabbits invading the woodland :) < 1118744902 0 :puzzlet!unknown@unknown.invalid PRIVMSG #esoteric :Did you read my website? < 1118745192 0 :puzzlet!unknown@unknown.invalid PRIVMSG #esoteric :I wish to do a babelfish bot presentation somewhere in freenode. < 1118745203 0 :puzzlet!unknown@unknown.invalid PRIVMSG #esoteric :if i could fix it to support utf-8 < 1118745646 0 :puzzlet!unknown@unknown.invalid PRIVMSG #esoteric :wait, it must be somewhere other than my website. < 1118745654 0 :puzzlet!unknown@unknown.invalid PRIVMSG #esoteric :{^Raven^}: what did you read? < 1118747154 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :tokigun's blog entry about lost kingdom < 1118747216 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :comes out very poetic < 1118747224 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :puzzlet: hmm... i have to add unicode feature to TiniCube ;) < 1118747302 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :http://dev.tokigun.net/esolang/ i'm making my esolang page. (korean) < 1118747327 0 :tokigun!unknown@unknown.invalid QUIT :Remote closed the connection < 1118747331 0 :puzzlet!unknown@unknown.invalid PRIVMSG #esoteric :tokigun's blog contains translator-unfriendly expressions. < 1118747354 0 :puzzlet!unknown@unknown.invalid PRIVMSG #esoteric :Babelfish is worse though < 1118747404 0 :puzzlet!unknown@unknown.invalid PRIVMSG #esoteric :Take a look at http://puzzlet.org/puzzlet/BabelFish~BabelFishAutomata < 1118747609 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :eep < 1118747698 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :but it's all very interesting to read though < 1118748235 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :ahahaha < 1118748504 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :a functional babelfish language < 1118748505 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :that's crazy < 1118752393 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :ACTION is lost and confused < 1118755898 0 :malaprop!~ph@ppp-68-251-59-237.dsl.chcgil.ameritech.net JOIN :#esoteric < 1118757722 0 :wooby!~wooby@ny-lancastercadent4g1-3a-236.buf.adelphia.net JOIN :#esoteric < 1118757922 0 :jix!jix@p5489E159.dip.t-dialin.net JOIN :#esoteric < 1118757948 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :moin < 1118757972 0 :wooby!unknown@unknown.invalid PRIVMSG #esoteric :hio < 1118757983 0 :wooby!unknown@unknown.invalid PRIVMSG #esoteric :GregorR: DMG works fine < 1118758703 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :? < 1118759517 0 :wooby!unknown@unknown.invalid PRIVMSG #esoteric :of directnet < 1118759521 0 :wooby!unknown@unknown.invalid PRIVMSG #esoteric :i'm able to mount it and whatnot < 1118763413 0 :cmeme!unknown@unknown.invalid QUIT :Remote closed the connection < 1118765217 0 :harkeyahh!~zillermae@206-81-148-32.slkc.qwest.net JOIN :#esoteric < 1118766829 0 :CXI!unknown@unknown.invalid QUIT :Read error: 104 (Connection reset by peer) < 1118766851 0 :CXI!Sanity@dialup-89.105.221.203.acc51-kent-syd.comindico.com.au JOIN :#esoteric < 1118768636 0 :puzzlet!unknown@unknown.invalid NICK :puzzlet_utf8 < 1118768677 0 :puzzlet_utf8!unknown@unknown.invalid NICK :puzzlet < 1118770695 0 :Keymaker!~a@wire74.adsl.netsonic.fi JOIN :#esoteric < 1118770746 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :rh.. me need food. me too hungry x[ < 1118772034 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :take a chef program and cook it.. < 1118772042 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :hmm < 1118772549 0 :harkeyahh!unknown@unknown.invalid QUIT :"Chatzilla 0.9.68.5 [Firefox 1.0.4/20050511]" < 1118773749 0 :wooby!unknown@unknown.invalid QUIT : < 1118774494 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :how do i link "Category:StuffHere" in esowiki? < 1118775578 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :i added small page for stack: http://esolangs.org/wiki/Stack < 1118777023 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :yo < 1118777035 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :Keymaker: I don't get what you mean < 1118777103 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :do you mean that this text is intended for Category:Stack-based? < 1118777302 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :i meant that first i tried to add there a link to that Category:Stack-based < 1118777304 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :but couldn't < 1118777317 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :like "check out stack-based languages" < 1118777414 0 :cpressey_!unknown@unknown.invalid PRIVMSG #esoteric :Keymaker: [[:Category: StuffHere]] < 1118777422 0 :cpressey_!unknown@unknown.invalid PRIVMSG #esoteric :(note the leading colon) < 1118777628 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :thanks, i'll go to add it < 1118779015 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :grrh.. it's annoying to read posts (@ google groups) where people talk about brainfuck and don't understand its usefulness and so on.. grrrrrrrh. release the hounds! < 1118779195 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :At once, your lordship! < 1118779207 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric ::) < 1118779286 0 :puzzlet!unknown@unknown.invalid PRIVMSG #esoteric :anyone knows how to see non-ASCII characters in linux without Xserver? < 1118779344 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :with framebuffer, I guess < 1118779346 0 :sp3tt!unknown@unknown.invalid QUIT :"Chatzilla 0.9.68a [Firefox 1.0.4/20050511]" < 1118779348 0 :harkeyahh!~zillermae@206-81-148-32.slkc.qwest.net JOIN :#esoteric < 1118779400 0 :lindi-!unknown@unknown.invalid PRIVMSG #esoteric :puzzlet: you can change fonts for hardware text mode too < 1118779454 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :lindi-: I guess he means to read Hangul which I'm not sure but is probably > 512 symbols < 1118779493 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :lol < 1118779497 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric ::D < 1118779755 0 :puzzlet!unknown@unknown.invalid PRIVMSG #esoteric :ah, that is the keyword, framebuffer < 1118779773 0 :puzzlet!unknown@unknown.invalid PRIVMSG #esoteric :i can't help forgetting things < 1118782103 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :bye < 1118782105 0 :Keymaker!unknown@unknown.invalid PART #esoteric :? < 1118782249 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :how can anybody possibly not understand the usefulness of brainfuck?!? < 1118782256 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :the most useful language ever!? < 1118782365 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :I'm tainted to add BF to [[Category:High-level]] < 1118782497 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :it's just so intuitive < 1118782979 0 :cmeme!~cmeme@216.184.11.2 JOIN :#esoteric < 1118782996 0 :cmeme!unknown@unknown.invalid QUIT :Remote closed the connection < 1118783042 0 :cmeme!~cmeme@216.184.11.2 JOIN :#esoteric < 1118784525 0 :harkeyahh!unknown@unknown.invalid QUIT :Read error: 145 (Connection timed out) < 1118787524 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :ponders BF optimisation < 1118787549 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :pgimeno: I assume ORK is already there? < 1118787565 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :fizzie: Thanks for checking that, good to know :) < 1118788427 0 :jix!unknown@unknown.invalid QUIT :"Banned from network" < 1118788788 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :i think the list of esoteric languages should include Lisp :) < 1118788822 0 :calamari!~calamari@dialup-4.240.111.7.Dial1.Phoenix1.Level3.net JOIN :#esoteric < 1118789659 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :GregorR: yes, thanks to kipple < 1118789681 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :nite all < 1118789689 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :cya pgimeno < 1118790564 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :LOL < 1118790565 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :Articles in category "Object-oriented paradigm" < 1118790565 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :There is 1 article in this category. < 1118790565 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :O < 1118790565 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric : * ORK < 1118790619 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :hehe < 1118790657 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :I wonder if there can be an oo tarpit, or if there is one already < 1118790700 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :OOPS might be one < 1118790713 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :object oriented particle system < 1118790744 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :Oh, btw, about Lisp, lament: hear hear)))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))) < 1118790744 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :)))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))) < 1118792405 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :is there a Special: page that gives a list of links to pages that haven't been made? < 1118792466 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :aha.. "wanted pages" < 1118795668 0 :kipple!~kipple@163.80-202-100.nextgentel.com JOIN :#esoteric < 1118795679 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :evenin' < 1118795686 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :hi kipple < 1118795714 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :Gregor: there are now 2 articles in the OO category :) < 1118795968 0 :graue!~graue@ip68-100-130-21.dc.dc.cox.net JOIN :#esoteric < 1118796044 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :hi_graue < 1118796112 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :hi calamari < 1118796153 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :ACTION notes that the Monobook "wikipedia" skin looks a lot better than 'classic' :)  < 1118796162 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :yeah. I use that one < 1118796201 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :IMHO it should be the standard skin as it is the one used by wikipedia, and therefore probably most familiar to users < 1118796265 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :graue: is there a special page like Special:WantedPages that'll show even single links to pages that haven't been made yet? < 1118796325 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :also, I'm wondering why there is both a Category:languages page and language_list.. can the language_list page go away? < 1118796393 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :in theory. but not as long as categorization is not complete < 1118796442 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :would be nice to have some weapons of mass-categorization... < 1118796512 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :that shouldn't be hard to do.. I can just click each page and add [[Category:Languages]] < 1118796661 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :actually, what would be better is to leave both pages for now, and only delete items off the language list when a real categorization is complete < 1118796697 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :then the language_list will finally be empty < 1118796758 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :the Language list needs to stay < 1118796784 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :(IMHO, anyway) < 1118796824 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :the language list is nice because it can contain languages that doesn't have an article yet < 1118796916 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :wish there was an automatic way to have it be added to the language list.. I've created a few language articles and never updated the list < 1118797718 0 :lindi-!unknown@unknown.invalid QUIT :brown.freenode.net irc.freenode.net < 1118797785 0 :lindi-!~lindi@kulho150.adsl.netsonic.fi JOIN :#esoteric < 1118797987 0 :graue!unknown@unknown.invalid PART #esoteric :? < 1118798507 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :I updated the HQ9++ page and the main page (hope nobody minds 8-D) < 1118798587 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :why should anybody mind? that is the purpose of a wiki after all < 1118800221 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :GregorR: I've edited your edit :) < 1118800768 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :bbl < 1118800770 0 :calamari!unknown@unknown.invalid QUIT :"Leaving" < 1118800958 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :hmm. should TMMLPTEALPAITAFNFAL be categorized as nondeterministic? < 1118801323 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :on second thought, I think not < 1118802304 0 :kipple!unknown@unknown.invalid PART #esoteric :? < 1118803125 0 :calamari!~calamari@dialup-4.240.69.196.Dial1.Phoenix1.Level3.net JOIN :#esoteric < 1118804163 0 :graue!~graue@ip68-100-130-21.dc.dc.cox.net JOIN :#esoteric < 1118807183 0 :wooby!~wooby@ny-lancastercadent4g1-3a-236.buf.adelphia.net JOIN :#esoteric < 1118807211 0 :wooby!unknown@unknown.invalid PRIVMSG #esoteric :hio < 1118807311 0 :calamari!unknown@unknown.invalid QUIT :Connection timed out < 1118808658 0 :graue!unknown@unknown.invalid PART #esoteric :? < 1118810549 0 :malaprop!unknown@unknown.invalid QUIT :"quit" < 1118812339 0 :calamari!~calamari@dialup-4.240.114.249.Dial1.Phoenix1.Level3.net JOIN :#esoteric < 1118812614 0 :calamari!unknown@unknown.invalid PART #esoteric :? < 1118812919 0 :calamari!~calamari@dialup-4.240.114.249.Dial1.Phoenix1.Level3.net JOIN :#esoteric < 1118812921 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :hi < 1118813729 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :BWAAAAAAAAAAAAAAHAHAHAHA < 1118813730 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :Hi mean hi. < 1118822399 0 :clog!unknown@unknown.invalid QUIT :ended < 1118822400 0 :clog!unknown@unknown.invalid JOIN :#esoteric < 1118824281 0 :calamari!unknown@unknown.invalid QUIT :"Leaving" < 1118825710 0 :comet_11!Sanity@dialup-89.105.221.203.acc51-kent-syd.comindico.com.au JOIN :#esoteric < 1118825717 0 :CXI!unknown@unknown.invalid QUIT :Read error: 54 (Connection reset by peer) < 1118825746 0 :comet_11!unknown@unknown.invalid NICK :CXI < 1118828616 0 :CXI!unknown@unknown.invalid QUIT :Read error: 104 (Connection reset by peer) < 1118829723 0 :CXI!Sanity@dialup-89.105.221.203.acc51-kent-syd.comindico.com.au JOIN :#esoteric < 1118830113 0 :CXI!unknown@unknown.invalid QUIT :"If you're reading this, it's probably x-chat's fault." < 1118830123 0 :CXI!Sanity@dialup-89.105.221.203.acc51-kent-syd.comindico.com.au JOIN :#esoteric < 1118836984 0 :J|x!jix@p5489E159.dip.t-dialin.net JOIN :#esoteric < 1118837589 0 :J|x!unknown@unknown.invalid NICK :jix < 1118837894 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :morning peeps < 1118838035 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :moin < 1118838178 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :have had some really good ideas for BFBASIC but don't have the necessary Java skill to program em :( < 1118838289 0 :kipple!~kipple@163.80-202-100.nextgentel.com JOIN :#esoteric < 1118838341 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :hi < 1118838359 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :hello < 1118838882 0 :J|x!jix@p5489BDBC.dip.t-dialin.net JOIN :#esoteric < 1118838920 0 :jix!unknown@unknown.invalid QUIT :Nick collision from services. < 1118838922 0 :J|x!unknown@unknown.invalid NICK :jix < 1118840402 0 :{^Raven^}!unknown@unknown.invalid NICK :Penance < 1118840423 0 :Penance!unknown@unknown.invalid NICK :{^Raven^} < 1118841746 0 :malaprop!~ph@ppp-68-251-34-174.dsl.chcgil.ameritech.net JOIN :#esoteric < 1118849399 0 :smott!unknown@unknown.invalid PART #esoteric :? < 1118849627 0 :tokigun!~tokigun@dor204226.kaist.ac.kr JOIN :#esoteric < 1118851104 0 :Keymaker!~a@wire74.adsl.netsonic.fi JOIN :#esoteric < 1118851126 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :'ello < 1118851144 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :raven: who says it must be done in java? < 1118851277 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :i need cola < 1118851288 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :ACTION thinks about going to store < 1118851301 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :ACTION decides not to go yet < 1118851372 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :Keymaker: BFBASIC is written in Java so alterations to it need to be in Java too < 1118851383 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :yes, i know that < 1118851424 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :what kind of features they are? < 1118851473 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :so far I have SELECT CASE/WHEN/OTHERWISE/END SELECT worked out < 1118851494 0 :lindi-!unknown@unknown.invalid PRIVMSG #esoteric :{^Raven^}: any url to BFBASIC sources? < 1118851502 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :CASE is nestable. FOR ... STEP for +ve/-ve steps < 1118851517 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :ok < 1118851523 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :Code libraries and source split over multiple files < 1118851531 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :Named functions and procedures < 1118851557 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :and string support which is so badly needed < 1118851645 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :lindi-: http://sourceforge.net/projects/brainfuck/ the source is in the CVS < 1118851661 0 :wooby!unknown@unknown.invalid QUIT : < 1118851682 0 :lindi-!unknown@unknown.invalid PRIVMSG #esoteric :i tried http://lilly.csoft.net/~jeffryj/compilers/bfbasic/bfbasic.zip -- that is older? < 1118851716 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :Calamari's page ^^ has 1.30 and 1.40 is on sourceforge < 1118851727 0 :lindi-!unknown@unknown.invalid PRIVMSG #esoteric :ok < 1118851757 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :I just think that it sucks that I could add all these if it was in a language I was more familiar with < 1118851810 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :named functions and procedures will be able to have parameters too ;) < 1118851838 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :it will mean that libraries of useful BFBASIC routines could be written and INCLUDEd in user code < 1118854155 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :hmm < 1118854631 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :Keymaker: hmm? < 1118854669 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :hm. < 1118854690 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :that is, i can't find how you can check if file exists (in python) < 1118854755 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :as well, i'm hungry and thirsty < 1118854804 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :keymaker: http://diveintopython.org/file_handling/ seems to have some info on that < 1118854854 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :Keymaker: how about this: < 1118854856 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :try: < 1118854864 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric : file = open('file.txt') < 1118854870 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric : # do stuff with file < 1118854873 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :except: < 1118854877 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric : #print error < 1118854893 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :ok < 1118854907 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :should catch IOError and make sure that the errno is 2 just to be specific < 1118854919 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :? < 1118854923 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :what is errno? < 1118854935 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :an attribute of the exception object < 1118854958 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :pull up the interpreter and do 'open("foo")' so you can see the exact exception that's thrown, then catch only that. < 1118855054 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :oah < 1118855065 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :now i see < 1118855237 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :You just don't want to accidentally catch other exceptions is all. < 1118856657 0 :harkeyahh!~zillermae@206-81-148-32.slkc.qwest.net JOIN :#esoteric < 1118856688 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :ok, i'll go to store now < 1118856690 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :bbl < 1118857462 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :well, i didn't go < 1118858506 0 :kipple!unknown@unknown.invalid QUIT :"See you later" < 1118858595 0 :fizzie!unknown@unknown.invalid QUIT :brown.freenode.net irc.freenode.net < 1118858709 0 :fizzie!fis@sesefras.tky.hut.fi JOIN :#esoteric < 1118858741 0 :fizzie_!fis@sesefras.tky.hut.fi JOIN :#esoteric < 1118858741 0 :fizzie!unknown@unknown.invalid QUIT :Read error: 104 (Connection reset by peer) < 1118858868 0 :kipple!~kipple@163.80-202-100.nextgentel.com JOIN :#esoteric < 1118859725 0 :fizzie_!unknown@unknown.invalid NICK :fizzie < 1118860023 0 :jix!unknown@unknown.invalid QUIT :"This computer has gone to sleep" < 1118861021 0 :kipple!unknown@unknown.invalid QUIT :Remote closed the connection < 1118861595 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :hehe, i made up a new esolang < 1118861597 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :http://koti.mbnet.fi/yiap/stuff/unnecessary.html < 1118862647 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :Hm, shouldn't the source files exist but be 0b? < 1118862921 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :No, that would make the source file necessary. < 1118862938 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :Ah, I see. < 1118862975 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :But necessary[1] is a different language. [1] Hypothetical sister language to unnecessary < 1118863248 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :Keymaker: good esolang ;) < 1118864346 0 :jix!jix@p5489BDBC.dip.t-dialin.net JOIN :#esoteric < 1118864674 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :back < 1118864742 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :hehe, cheers < 1118865407 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :i have an idea for a graphical (esoteric.. but writeable) language < 1118865420 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :what kind of? < 1118865470 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :you arrange your program using elements and conect them using.. wires and it has anonymous functions .. and there are no function names.. just symbols < 1118865488 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :that'd be cool < 1118866011 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :wow wow wow wow awesome!!!!!!!!!!!!!!!!!!!!!!! < 1118866037 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :a game i didn't back then couldn't finish or play properly when i had crappy computer, and then forgot it for years, < 1118866052 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :and now when reading jurassic park books thought i could try again, < 1118866061 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :jix: Sounds neat, and a lot like my mental picture of programming. < 1118866064 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :seems to be editable with cool editors that fnas have made < 1118866074 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :*fans < 1118866081 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :bbl < 1118866083 0 :Keymaker!unknown@unknown.invalid PART #esoteric :? < 1118866174 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :jix: aardappel has written a bunch of those, look on his page < 1118866181 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :well, they do have names iirc < 1118866233 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :I believe i had made a language very similar to Keymaker's, year ago < 1118866235 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :*years < 1118866241 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :Called ZEN < 1118866293 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :lament: where is aardappel's page? < 1118866294 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :The coolest part about ZEN was that ZEN programs execute themselves < 1118866311 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :http://wouter.fov120.com/ < 1118866322 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :his languages are at http://wouter.fov120.com/proglang/index.html < 1118866340 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :thanks < 1118866345 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :lament: i know aardappel and i my brother even knows someone who knows the author of aardappel but my language is different (i think so) < 1118866360 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :jix: not the language aardappel, the person aardappel < 1118866374 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :jix: who is probably the person your brother knows :) < 1118866398 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :i must miss read that.. < 1118866414 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :he's like, the saint and the founding father of esoteric languages < 1118866418 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :and cpressey is his prophet < 1118866423 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :he also used to come here < 1118866426 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :the language and the person < 1118866428 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :oh, the cube guy < 1118866434 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :Wouter van Oortmerssen aka Aardappel < 1118866439 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :Languages: Aardappel, Bla, E, Fals.... < 1118866452 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :whoa < 1118866457 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :he wrote False too? < 1118866474 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :exactly < 1118866476 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :that's awesome < 1118866495 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :yes.. i wouldn't know that my brother knows... if he didn't come in atm i was viewing the false page < 1118866501 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :CXI: yeah, he's a genius < 1118866546 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :but usually people just talk about Cube to point that out; not his programming languages < 1118866571 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :Cube's pretty cool, but I wouldn't call it genius material < 1118866619 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :well, whom else do you know who wrote something of that scope by himself? < 1118866662 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :what, a fps? < 1118866672 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :not necessarily an fps < 1118866829 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :Cube looks very neat. Wish I wasn't at work, heh. < 1118866835 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :heh < 1118866838 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :it's pretty cool < 1118866847 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :unfortunately the physics engine is basically a giant hack :D < 1118866856 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :oh? < 1118866877 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :a friend and I had a look at using it for an fps < 1118866889 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :but it got pretty difficult when we realised how much of the physics code we'd need to rewrite < 1118866982 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :it was pretty impressive nonetheless < 1118867010 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :Why was the physics engine unsuitable for your needs? < 1118867053 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :we wanted to do more interesting things with it... object motion, friction against different surfaces, variable gravity < 1118867129 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :the actual engine is sorta... add a bit here, add a bit there, multiply by a number that sounds good, add a bunch of special cases < 1118867142 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :which works fine for the game itself < 1118867148 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :Ah, I dig. < 1118867148 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :but extending it can be hard < 1118867820 0 :Keymaker!~Not@wire74.adsl.netsonic.fi JOIN :#esoteric < 1118867836 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :f**k s**t x{ < 1118867846 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :the cd is lost! < 1118867850 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :fuckfuck? < 1118867855 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :"x{"? < 1118867861 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :emoticon < 1118867867 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :X( = angry < 1118867867 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :the cd of which game? < 1118867874 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :ah, thought it was just a really short swear you censored < 1118867878 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :jurassic park trespasser < 1118867885 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :fck < 1118867890 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :only cd i have lost < 1118867900 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :and i was sure i had seen it lately < 1118867904 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :really annoying < 1118867915 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :just when i was about to play it < 1118867928 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :and just when i found out that there are level editors and stuff for it thesedays < 1118867939 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :just ten minutes ago i found that out < 1118867942 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :I can't find a whole lot of my CDs :( < 1118867944 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :and can't find that cd < 1118867945 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric ::( < 1118867950 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :now i have to buy it again < 1118867955 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :RGGGGGGGGGHHHHHHHHHHH!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! < 1118867955 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :specifically, my Whitlams CD and my copy of Freespace < 1118867957 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :download it? < 1118867962 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :i can't < 1118867978 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :CXI: how many CDs do you have? :S < 1118867984 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :a zillion < 1118867989 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :oh. < 1118868006 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :(be warned that number may not be exact) < 1118868015 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric ::) < 1118868021 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :it's really annoying < 1118868037 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :if i could download and so on, i would probably do that, since i've bought the game before < 1118868042 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :CXI: If you want another copy of Freespace, ask me in a couple days when I'm home and I'll see if I have it to rip for you. < 1118868081 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :well, at least i have two of those nice game boxes featuring a velociraptor < 1118868106 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :oh, and probably i can't find it anywhere since it's probably 5 years old game < 1118868109 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :ACTION dies < 1118868119 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :ACTION only ever uses the original disk as the backup and a copy of it for playing < 1118868133 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :that'd be clever, I should do that instead < 1118868137 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :14:43:03 * {^Raven^} only ever uses the original disk as the backup and a copy < 1118868144 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :oops, pardon < 1118868171 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :there's this pattern < 1118868180 0 :CXI!unknown@unknown.invalid PRIVMSG #esoteric :every time I delete a game off my hard drive the original CD goes missing < 1118868204 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :most publishers offer replacement CDs for a small charge < 1118868291 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :i'm so annoyed. i'll go hunting the game tomorrow. let's hope some small pc store still has copy (for extra low price) < 1118871456 0 :wooby!~wooby@ny-lancastercadent4g1-3a-236.buf.adelphia.net JOIN :#esoteric < 1118872444 0 :wooby!unknown@unknown.invalid QUIT : < 1118874622 0 :jix!unknown@unknown.invalid QUIT :"Banned from network" < 1118874640 0 :CXI!unknown@unknown.invalid QUIT :Read error: 104 (Connection reset by peer) < 1118874641 0 :comet_11!Sanity@dialup-89.105.221.203.acc51-kent-syd.comindico.com.au JOIN :#esoteric < 1118874793 0 :comet_11!unknown@unknown.invalid NICK :CXI < 1118877410 0 :harkeyahh!unknown@unknown.invalid QUIT :Read error: 60 (Operation timed out) < 1118877796 0 :harkeyahh!~zillermae@206-81-148-32.slkc.qwest.net JOIN :#esoteric < 1118880752 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :g'night peeps < 1118882700 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :nite < 1118882710 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :wow. clock is already 3 am < 1118882726 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :time has gone fast when i have been studying jurassic park trespasser < 1118882795 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :Keymaker: i have already made a language that does nothing < 1118882846 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :i can perhaps find it given the esolang archive < 1118882849 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :or perhaps not < 1118883047 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :hee, found my original post suggesting to place the irc channel on freenode :) < 1118883241 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :hmm, cant find it < 1118883250 0 :harkeyahh!unknown@unknown.invalid QUIT :"Chatzilla 0.9.68.5 [Firefox 1.0.4/20050511]" < 1118883303 0 :kipple!~kipple@163.80-202-100.nextgentel.com JOIN :#esoteric < 1118883459 0 :calamari_!~jeffryj@lilly.csoft.net JOIN :#esoteric < 1118883461 0 :calamari_!unknown@unknown.invalid PRIVMSG #esoteric :hi < 1118883528 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :ho < 1118883562 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :cpressey_: ha < 1118883563 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :sorry lament, i didn't know that < 1118883580 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :cpressey_: theres a mail by you to esolang from 2001 < 1118883592 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :cpressey_: about turing-complete vs. "useful" < 1118883629 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :cpressey_: and you propose to differentiate useful languages by building a "controlled oscillator" in them < 1118883640 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :http://esoteric.sange.fi/archive/2001-q3 < 1118883683 0 :calamari_!unknown@unknown.invalid PRIVMSG #esoteric :Keymaker: I've been wanting to rewrite a lot of that bfbasic code, but I kept it the way it was so that Jon could write his game.. didn't want to break it and not be able to get it back together before spring break ended :) < 1118883697 0 :cpressey_!unknown@unknown.invalid PRIVMSG #esoteric :lament: yes, i remember that < 1118883716 0 :cpressey_!unknown@unknown.invalid PRIVMSG #esoteric :(why do i have a tail all of a sudden...?) < 1118883720 0 :calamari_!unknown@unknown.invalid PRIVMSG #esoteric :keymaker: right now all the statements and operators are in a big messy blob.. crappy code basically.. hard to understand and extend < 1118883747 0 :cpressey_!unknown@unknown.invalid NICK :cpressey < 1118883774 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :cpressey: convergent evolution < 1118883794 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :Keymaker: that's okay, i think it's because i never published it... < 1118883835 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :Keymaker: anyway it was called ZEN, null program was the only one, iti did nothing, and thus ZEN programs executed without any need for a physical computer... < 1118883837 0 :calamari_!unknown@unknown.invalid PRIVMSG #esoteric :ACTION wonders why there isn't a Chris Pressey page yet.. too prestigious? < 1118883881 0 :calamari_!unknown@unknown.invalid PRIVMSG #esoteric :might need a table of contents :) < 1118883888 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :Keymaker: i.e. not only each program was a quine, but also a (self'executing) ZEN interpreter < 1118884007 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :calamari: ok < 1118884027 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :lament: ok < 1118884094 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :ACTION dies, temporarily < 1118884097 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :btw, is every Unnecessary program a Unnecessary interpreter too? < 1118884097 0 :calamari_!unknown@unknown.invalid PRIVMSG #esoteric :ACTION just sent everyone an Unnecessary program.. hope you enjoy < 1118884109 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :hey, good work calamari! < 1118884112 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric ::) < 1118884134 0 :calamari_!unknown@unknown.invalid PRIVMSG #esoteric :thanks.. nice language there :) < 1118884140 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :heh, thanks < 1118884180 0 :calamari_!unknown@unknown.invalid PRIVMSG #esoteric :keymaker: are you familiar with flex/bison/yacc, etc ? < 1118884188 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :nope < 1118884197 0 :calamari_!unknown@unknown.invalid PRIVMSG #esoteric :neither am I... unfortunately < 1118884207 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :why should you be? < 1118884208 0 :calamari_!unknown@unknown.invalid PRIVMSG #esoteric :I suspect they would be the best way to redo bfbasic < 1118884213 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :ah < 1118884223 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :what about this python..? < 1118884233 0 :calamari_!unknown@unknown.invalid PRIVMSG #esoteric :it would take care of all the parsing ,which is where the big mess comes in < 1118884241 0 :calamari_!unknown@unknown.invalid PRIVMSG #esoteric :python is cool, I guess... < 1118884246 0 :calamari_!unknown@unknown.invalid PRIVMSG #esoteric :but Java is better! :) < 1118884251 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :nooo! < 1118884279 0 :calamari_!unknown@unknown.invalid PRIVMSG #esoteric :I'm getting more comfortable in python, but I still don't like it nearly as much as Java < 1118884313 0 :calamari_!unknown@unknown.invalid PRIVMSG #esoteric :something about it just seems tacked together and fragile < 1118884337 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :hmm < 1118884476 0 :calamari_!unknown@unknown.invalid PRIVMSG #esoteric :I also like Java's library much more than python's < 1118884499 0 :calamari_!unknown@unknown.invalid PRIVMSG #esoteric :although python does have lots of nifty string stuff.. that makes it bearable :) < 1118884513 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :yes < 1118884526 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :because of that i was suggesting it < 1118884580 0 :calamari_!unknown@unknown.invalid PRIVMSG #esoteric :I suggest that we stick with the current code for now.. although ugly, it does work (except for the bugs).. so once we get the bugs fixed we can port it or whatever < 1118884602 0 :calamari_!unknown@unknown.invalid PRIVMSG #esoteric :the bugs seem to be centralized in the array code < 1118884632 0 :calamari_!unknown@unknown.invalid PRIVMSG #esoteric :I've been meaning to plug it into a bf debugger and check it out.. see if it does what I think it does, etc < 1118884636 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :Java eh... < 1118884645 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :My only problem with Java is that it sucks horribly in every way. < 1118884650 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :Other than that, it's good. < 1118884668 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric ::) < 1118884702 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :ACTION pets C. < 1118884708 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :Ahh, my good friend ... < 1118884709 0 :calamari_!unknown@unknown.invalid PRIVMSG #esoteric :calamari once thought as you do.. you don't know the POWER of the Java side :) < 1118884734 0 :calamari_!unknown@unknown.invalid PRIVMSG #esoteric :I must obey my master < 1118884743 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :Java is too far Object Oriented. Object Orientation is good for certain things, but unlike they hype says, it is NOT good for everything, or even most things. < 1118884763 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :There are several tasks for which OO is perfect. And for those, I use C++ so I can drop out of OO when necessary. < 1118884763 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :ACTION runs to get the popcorn < 1118884765 0 :calamari_!unknown@unknown.invalid PRIVMSG #esoteric :you can do functional programming in Java if you'd like < 1118884780 0 :calamari_!unknown@unknown.invalid PRIVMSG #esoteric :just declare your methods statci < 1118884783 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :But anyway, I just got off work, so now I am to leave :P < 1118884784 0 :calamari_!unknown@unknown.invalid PRIVMSG #esoteric :err imperative < 1118884787 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :mmh.. popcorn.. < 1118884802 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :hehe < 1118884815 0 :calamari_!unknown@unknown.invalid PRIVMSG #esoteric :cya gregor, have fun using c.. I'll toss you some free()'s :) < 1118884834 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :perhaps ORK would be good for this project? < 1118884858 0 :calamari_!unknown@unknown.invalid PRIVMSG #esoteric :perhaps we should just cut out all this fancy stuff and write it in bf < 1118884892 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :yes < 1118884904 0 :calamari_!unknown@unknown.invalid PRIVMSG #esoteric :I would like to bootstrap it someday.. but we're not far along enough yet < 1118884910 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :hehe < 1118884920 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :i was just going to say that :) < 1118884920 0 :calamari_!unknown@unknown.invalid PRIVMSG #esoteric :hey! I got bfasm bootstrapped < 1118884936 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :that's cool < 1118884937 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :hm, you might be able to do functional programming in java... but you'd have to use objects to handle anonymous functions, i think... < 1118884958 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :calamari_: re bfasm: right on! < 1118884965 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :bootstraps R kewl < 1118884971 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :yeah < 1118884983 0 :calamari_!unknown@unknown.invalid PRIVMSG #esoteric :cpressey: thanks.. I can't believe my wife put up with me doing it.. I was glued to the computer for days.. couldn't quit :) < 1118884992 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :hehe < 1118885023 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :have you even uploaded it anywhere? < 1118885028 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :the bootstrap? < 1118885030 0 :calamari_!unknown@unknown.invalid PRIVMSG #esoteric :yeah, it's on my webpage < 1118885043 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :ah. i need to check < 1118885043 0 :calamari_!unknown@unknown.invalid PRIVMSG #esoteric :its in the bfasm zip < 1118885045 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :it out < 1118885045 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :ok < 1118885048 0 :calamari_!unknown@unknown.invalid PRIVMSG #esoteric :the c file is actually the one in extras < 1118885061 0 :calamari_!unknown@unknown.invalid PRIVMSG #esoteric :yeah, I don;t think I released it before the bootstrap was done < 1118885072 0 :calamari_!unknown@unknown.invalid PRIVMSG #esoteric :it's been a while tho < 1118885113 0 :calamari_!unknown@unknown.invalid PRIVMSG #esoteric :I need to redo some of the stuff.. bfbasic has made improvements to some of the bf code < 1118885145 0 :calamari_!unknown@unknown.invalid PRIVMSG #esoteric :well anyhow.. I need to go home.. cya all later on < 1118885162 0 :calamari_!unknown@unknown.invalid QUIT :"<=K" < 1118885183 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :bye < 1118885199 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :wow. that bfasm.b sure is neat.. :) < 1118885210 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :anyways, i need to go to. it's 3:30 am. < 1118885215 0 :Keymaker!unknown@unknown.invalid QUIT :"I've seen this déjà vu before.." < 1118889468 0 :calamari!~calamari@dialup-4.240.150.111.Dial1.Phoenix1.Level3.net JOIN :#esoteric < 1118889504 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :hi < 1118889568 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :hullo < 1118889689 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :hi raven.. hows the island? < 1118889725 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :pretty good, < 1118889771 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :there was a minor riot in town earlier with the G8 summit peeps but nothing too bad < 1118889796 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :hows you? < 1118889978 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :i've been pondering BFBASIC enhancements but am not sure of the current state of play < 1118890077 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :have got some good ideas about how to implement strings < 1118890820 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :raven: I'm fine.. a little tired :) < 1118890852 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :good ideas about strings.. cool. Are they basic-like or c-like? < 1118890863 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :in other words.. garbage collection < 1118890943 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :C like with a fixed maximum length set on initialisation. < 1118890990 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :current idea is that a string can be treated internally as a numeric array < 1118890997 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :of course < 1118891012 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :the nice thing is that it doesn't need to be null terminated < 1118891021 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :with all string handling operations being treated internally as array transformations < 1118891056 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :yeah, they can be but there is no value in [<] or [>] due to how array elements are stored in memory < 1118891089 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :no I'm saying it doesn't need to be null terminated < 1118891116 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :It would be easiest to navigate around strings if they were double-null-terminated... < 1118891117 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :or are you suggesting something different than a numeric array? < 1118891143 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :no, just a rehular numeric array < 1118891158 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :if you want the string to be immutable, then you don't even need to skip cells < 1118891164 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :then you could null terminate it < 1118891216 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :what about a bunch of immutable strings and a malloc? < 1118891235 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :haven't thought about that < 1118891239 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :then you could imitate variable length strings < 1118891280 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :it'd be similar to current array code, but each "cell" would have a width value < 1118891288 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :Whoops, I just bought another year on codu.org when I already had XD < 1118891298 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :Now I'm good through '07 though, so no prob :P < 1118891339 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :hm.. now that I think of it.. that wouldn't really work < 1118891360 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :well it could, I guess with null termination < 1118891376 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :it seems that it will be more effiecent to define a string as a fixed sized array < 1118891377 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :it'd be an interesting challenge < 1118891387 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :yeah, it would be.. < 1118891421 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :string constants could be handled internally by the interpreter and inlined into the compiled code < 1118891427 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :but say you did something like A$=B$+C$.. it would take B$ and C$, determinae a new length for A$, and copy B$ and C$ into the space < 1118891429 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :but I am not sure about their value < 1118891485 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :you would need to initialise A$ somewhere also specifying the maximum length of A$ < 1118891513 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :yeah, it'd be right with the variable < 1118891525 0 :kipple!unknown@unknown.invalid PART #esoteric :? < 1118891588 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :lots of string operations seem to be fairly simple < 1118891604 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :currently I think it's var B A element 0 element 0, etc.. so it'd be something like: maxlength, length, 0, elements, 0 < 1118891621 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :probably needs a bit of tweaking .. need to map it out on paper < 1118891677 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :there wouldn't really be a free(), strings would just persist and grow, or be overwritten < 1118891720 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :i am not sure how to make such a heap work in brainfuck < 1118891729 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :you don't need one < 1118891731 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :hence the fixed allocations < 1118891747 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :there'd just be a "temporary" string that is used < 1118891789 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :for example, in A$=B$+C$, it doesn't know about A$ yet, because of the parsing order.. to it's actually like TEMP$=B$+C$ < 1118891799 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :then A$=TEMP$ < 1118891817 0 :harkeyahh!~zillermae@206-81-148-32.slkc.qwest.net JOIN :#esoteric < 1118891839 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :only problem with this scheme is that things like MID$ wouldn't work < 1118891849 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :that's probably not great < 1118891871 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :not at all. MID$ is fairly simple < 1118891876 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :well MID$ would work if the exact offset was given, but otherwise, nope < 1118891893 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :should still be able to work < 1118891904 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :for example if it's a constant that can hardcode some >>>>'is the file, you're all set < 1118891920 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :MID$ can be decomposed into a FOR...NEXT loop < 1118891923 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :but if you're saying MID$(A$,X,Y), you're stuck < 1118891947 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :because it has no way to get to element X on its own < 1118891967 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :that would require using regular arrays with 2 elements per character < 1118891968 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :no, FOR temp = X TO Y:do something with _strA(temp):NEXT < 1118891975 0 :harkeyahh!unknown@unknown.invalid PRIVMSG #esoteric :calamari, {^Raven^} is always right, get over yourself. < 1118891981 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :harkeyahh: hahaha < 1118891996 0 :harkeyahh!unknown@unknown.invalid PRIVMSG #esoteric :talking about VB? < 1118892017 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :rofl < 1118892036 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :Hmmmmmmm, implementing VB in BF. < 1118892039 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :Now that sounds like fun. < 1118892045 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :Almost as fun as self testicular mutilation. < 1118892062 0 :harkeyahh!unknown@unknown.invalid PRIVMSG #esoteric :self testicular gesticulation bahaha < 1118892089 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :I feel sorry for vb.. it started out great, especially vb-dos < 1118892099 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :DIM A$(40) becomes DIM _strA(42):_strA(0)=40 (maxlen):_strA(1)=0 (current length) < 1118892124 0 :harkeyahh!unknown@unknown.invalid PRIVMSG #esoteric :self testicular mastication my ass calamari < 1118892131 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :the string itself is stored in _strA(2)..._strA(42) < 1118892140 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :raven: what I'm trying to say is that you can't access individual array elements because you have no way to get to them.. the first [>] goes straight to the end of the string < 1118892163 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :harkeyahh: umm.. I didn't say that ;) < 1118892199 0 :harkeyahh!unknown@unknown.invalid PRIVMSG #esoteric :it was hypothetically implied calamari < 1118892211 0 :harkeyahh!unknown@unknown.invalid PRIVMSG #esoteric :for your convenience < 1118892213 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :raven: unless you'd like to use regular array code, in which case this whole malloc scheme becomes irrelevant :) < 1118892232 0 :harkeyahh!unknown@unknown.invalid PRIVMSG #esoteric :please come again calamari, and bring some fish with you < 1118892242 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :harkeyahh: are you high? < 1118892253 0 :harkeyahh!unknown@unknown.invalid PRIVMSG #esoteric :no i'm actually below sea level < 1118892258 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :hhahaha < 1118892272 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :calamari: my current my entire idea is based on using regular array code. Just because I know that in concept it should work < 1118892312 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :raven: yeah..probably best < 1118892343 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :raven: might be able to make the strings mutable with that.. but maybe it's too much work < 1118892366 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :just having the basics would be great :) < 1118892379 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :calamari: that all depends on what the impact code size/efficiency is < 1118892478 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :calamari: it should give us at least INPUT PRINT ASC LEFT$ MID$ RIGHT$ INKEY$ < 1118892487 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :it'd be just like regular array operatings, as you say.. but there'd be a lot of them < 1118892509 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :SPACE$ and STRING$ are nice too < 1118892517 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :as well as ASC < 1118892524 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :that's my only concern is the large amount of code that will be generated, but I am not sure that there is any way to avoid that < 1118892525 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :oops, didn't see it hiding in there :) < 1118892544 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :ASC A$ becomes _strA(2) < 1118892567 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :(if length in _strA(1) is not NULL) < 1118892585 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :well, if we examine the array clode closely (which I think we'll need to to find the existing bugs), we could probably code bf native versions of each of those and save some statements < 1118892618 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :otheriwse, we'd be building it on top of existing bbfbasic statements.. that could get bloated < 1118892659 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :yeah, we might need two variants, one for handling MID$(A$,1,2) and another for MID$(A$,X,Y) < 1118892680 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :the first variant should be possible to code very efficiently < 1118892731 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :you'd still need a temp variable.. < 1118892737 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :that's something to think about < 1118892763 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :hopefully it'd be to the right of all current memory to allow it to grow very large if needed < 1118892800 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :yes, I think that we could get away with declaring a temp string as large as the largest string < 1118892846 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :and also.. check out something like A$ = B$ + MID$(C$ + MID$(D$, A, B), X, Y) + E$ < 1118892884 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :hmm.. I think it can work :) < 1118892900 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :there isn't really any complex order of operations with strings < 1118892918 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :one temp variable can handle th entire thing, step by step < 1118892931 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :neato < 1118892947 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :yeah. If we need to print a string larger than the temp we can do it on the fly < 1118892958 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :but only for printing < 1118892970 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :it'd need to be the rest of memory.. take input for an example of that < 1118893012 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :unless you wanted to do something like INPUT$(numchars) which would be more responsible < 1118893029 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :wouldn't want to be known for bring buffer overflows to bf :) < 1118893112 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :_t1=0:REPEAT:_to=INKEY:_strA(_t1)=_t0:_t1=_t1+1:UNTIL _t0=10 OR _t0=13:_strA(1)=_t1-1 < 1118893157 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :or UNTIL _t0=10 OR _t0=13 OR _t1>=_strA(0) to avoid the overflow < 1118893190 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :above would be equivalent to INPUT A$ < 1118893395 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :well, I'm all for the idea of strings in bfbasic, it'll cause some parsing headaches and such of course, but I think we can handle it. the main thing though is fixing the current bugs first < 1118893411 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :otherwise we're doomed w.r.t. arrays :) < 1118893573 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :that's the kick in the teeth really, nothing (string related) can be done until then. < 1118893714 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :I like the stuff that you put on the brainfuck agorithms page on the esowiki < 1118893722 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :looks familiar ;) < 1118893833 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :thanks .. we should fact check that array code .. hehehe < 1118893872 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :still weird, because i did test it while writing it and all seemed fine < 1118893909 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :need to port my bfadebug to linux < 1118894024 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :w00t, just got DN b0.6 out, much nicer build system now :) < 1118894042 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :0.6 already? I'm way behind with my 0.4 < 1118894064 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :0.4 to 0.5 was a huge change, 0.5 to 0.6 had no code changes :P < 1118894102 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :0.4 to 0.5 was after implementing tons o' features and then letting it languish while I tracked down one nasty bug for a few months >_< < 1118894214 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :yay, it complained about my lack of gmp < 1118894279 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :Heheh :P < 1118894296 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :I assume you just got CVS? < 1118894536 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :yeah < 1118894551 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :"cvs update -d" < 1118894599 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :Is there any reason you haven't downloaded gmp and cyfer/ < 1118894601 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :*? < 1118894771 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :what are they? < 1118894829 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :synaptics says I did have libgmp3 < 1118895460 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :It compiles them in statically because they work a bit funkily in DN. < 1118895467 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :You have to run getcyfer.sh (like it says) < 1118895470 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :Then it'll all be happy. < 1118895479 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :GMP = GNU Muli-Precision library < 1118895483 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :Cyfer = an encryption library < 1118895666 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :GregorR: Nice hacker test you've got on your site, gonna have to go test some peeps with that < 1118896261 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :ACTION wonders whether A) {^Raven^} wandered off of my site or B) {^Raven^} is mocking my use of a wiki for DN ... < 1118896289 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :Ahh, the one on the Cyfer page. < 1118896292 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :I did not write Cyfer. < 1118896492 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :ACTION ponders that it's 4:30 am and he should have been asleep hours ago < 1118896516 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :I chose option A. < 1118896617 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :ACTION waves nite to all the esopeeps and toddles off to bed (again) < 1118896686 0 :harkeyahh!unknown@unknown.invalid QUIT :"Chatzilla 0.9.68.5 [Firefox 1.0.4/20050511]" < 1118897322 0 :ChanServ!unknown@unknown.invalid QUIT :brown.freenode.net irc.freenode.net < 1118897322 0 :fizzie!unknown@unknown.invalid QUIT :brown.freenode.net irc.freenode.net < 1118897387 0 :calamari!unknown@unknown.invalid QUIT :brown.freenode.net irc.freenode.net < 1118897388 0 :CXI!unknown@unknown.invalid QUIT :brown.freenode.net irc.freenode.net < 1118897388 0 :tokigun!unknown@unknown.invalid QUIT :brown.freenode.net irc.freenode.net < 1118897388 0 :malaprop!unknown@unknown.invalid QUIT :brown.freenode.net irc.freenode.net < 1118897388 0 :lindi-!unknown@unknown.invalid QUIT :brown.freenode.net irc.freenode.net < 1118897388 0 :{^Raven^}!unknown@unknown.invalid QUIT :brown.freenode.net irc.freenode.net < 1118897388 0 :cpressey!unknown@unknown.invalid QUIT :brown.freenode.net irc.freenode.net < 1118897388 0 :puzzlet!unknown@unknown.invalid QUIT :brown.freenode.net irc.freenode.net < 1118897388 0 :pgimeno!unknown@unknown.invalid QUIT :brown.freenode.net irc.freenode.net < 1118897388 0 :mtve!unknown@unknown.invalid QUIT :brown.freenode.net irc.freenode.net < 1118897388 0 :ZeroOne!unknown@unknown.invalid QUIT :brown.freenode.net irc.freenode.net < 1118897388 0 :cmeme!unknown@unknown.invalid QUIT :"Client terminated by server" < 1118897420 0 :ChanServ!ChanServ@services. JOIN :#esoteric < 1118897420 0 :calamari!~calamari@dialup-4.240.150.111.Dial1.Phoenix1.Level3.net JOIN :#esoteric < 1118897420 0 :CXI!Sanity@dialup-89.105.221.203.acc51-kent-syd.comindico.com.au JOIN :#esoteric < 1118897420 0 :fizzie!fis@sesefras.tky.hut.fi JOIN :#esoteric < 1118897420 0 :tokigun!~tokigun@dor204226.kaist.ac.kr JOIN :#esoteric < 1118897420 0 :malaprop!~ph@ppp-68-251-34-174.dsl.chcgil.ameritech.net JOIN :#esoteric < 1118897420 0 :lindi-!~lindi@kulho150.adsl.netsonic.fi JOIN :#esoteric < 1118897420 0 :{^Raven^}!~{^Raven^}@82-38-204-252.cable.ubr05.shef.blueyonder.co.uk JOIN :#esoteric < 1118897420 0 :cpressey!nobody@d154-20-76-195.bchsia.telus.net JOIN :#esoteric < 1118897420 0 :puzzlet!~puzzlet@61.247.148.38 JOIN :#esoteric < 1118897420 0 :pgimeno!pgimeno@124.Red-80-59-211.pooles.rima-tde.net JOIN :#esoteric < 1118897420 0 :ZeroOne!~vsaalo@kekkonen.cs.hut.fi JOIN :#esoteric < 1118897420 0 :mtve!mtve@mtve.vm.jvds.com JOIN :#esoteric < 1118897420 0 :irc.freenode.net!unknown@unknown.invalid MODE #esoteric :+o ChanServ < 1118897450 0 :cmeme!~cmeme@216.184.11.2 JOIN :#esoteric < 1118897595 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :hmm < 1118897895 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :http://gregorr.homelinux.org/scrabble/scrabble.php = libc scrabble values :) < 1118897953 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :scrabble? < 1118897993 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :GregorR: you mean English word game? < 1118898029 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :Except that I'm making it libc :) < 1118898041 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :;) < 1118898043 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :libc scrabble > luser English scrabble < 1118898072 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :fprintf is worth 7 points < 1118898099 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :libc scrabble... good! < 1118898109 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :pthread_mutex_lock is worth 21 XD < 1118898154 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :i wondered why is there "_" letter ;) < 1118898176 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :Heheh :) < 1118898354 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :http://page.tokigun.net/obfuscation/file/2004/md5calc.bf < 1118898359 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :oops < 1118898395 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :i have to paste it in other window.. :S < 1118899606 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :lalala < 1118900061 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :Grr, how do you change the bgcolor of a td in JS >_< < 1118900274 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :GregorR: if you hate MSIE, use :hover css psuedo-selector. if not, use this.style.backgroundColor(probably) in inline script. < 1118900581 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :found my SMETANA interpreter that i don't think I ever published: < 1118900582 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :(lambda s=__import__('sys'),f=lambda f,l,p,n=lambda l,p:map(int,__import__('re').findall('\d+',l[p])):p>=len(l)and l or len(n(l,p))==3 and f(f,l[:n(l,p)[1]]+[l[n(l,p)[2]]]+l[n(l,p)[1]+1:n(l,p)[2]]+[l[n(l,p)[1]]]+l[n(l,p)[2]+1:],p+1)or f(f,l,n(l,p)[1]):s.stdout.writelines(f(f,file(s.argv[1]).readlines(),0)))() < 1118900627 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :except it dosen't work < 1118900656 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :but i remember it working with an older python :( < 1118900659 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :fuck < 1118900686 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :oh, i forgot to pass a command-line argument, nvm < 1118900780 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :lament: do you like obfuscated python? ;) < 1118900804 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :okay, this interpreter officially doesn't work :( < 1118900816 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :tokigun: you bet < 1118900835 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :i think you like this one: http://page.tokigun.net/obfuscation/file/2004/tenma.py < 1118900851 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :(not very obfuscated however) < 1118900906 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :pretty < 1118900942 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :GregorR: sorry for this silly question.. but what do I connect to with directnet? I tried your ip but it did not connect. < 1118900942 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :it contains interpreter, assembler, disassembler of whitespace. < 1118900985 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :and what's with all the hex digits.. I assume it's not a Numberix program :) < 1118901451 0 :calamari!unknown@unknown.invalid QUIT :"bbl" < 1118902757 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :OK, scrabble board = incredibly difficult to parse O_O < 1118905077 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :http://giki.sourceforge.net/scrabble.php < 1118905087 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :Still lacking many of the rules of scrabble, but it's basically functional :) < 1118905796 0 :cmeme!unknown@unknown.invalid QUIT :Read error: 54 (Connection reset by peer) < 1118905846 0 :cmeme!~cmeme@216.184.11.2 JOIN :#esoteric < 1118905864 0 :cmeme!unknown@unknown.invalid QUIT :Remote closed the connection < 1118905909 0 :cmeme!~cmeme@216.184.11.2 JOIN :#esoteric < 1118908799 0 :clog!unknown@unknown.invalid QUIT :ended < 1118908800 0 :clog!unknown@unknown.invalid JOIN :#esoteric < 1118912087 0 :puzzlet!unknown@unknown.invalid QUIT :"Lost terminal" < 1118912349 0 :puzzlet!~puzzlet@61.247.148.38 JOIN :#esoteric < 1118917891 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :should this go in wiki somehow? < 1118917892 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :http://z3.ca/~lament/pictures/flow.gif < 1118917901 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :probably not :) < 1118920160 0 :kipple!~kipple@163.80-202-100.nextgentel.com JOIN :#esoteric < 1118927194 0 :{^Raven^}!unknown@unknown.invalid QUIT :Remote closed the connection < 1118927366 0 :J|x!jix@p5489AFCE.dip.t-dialin.net JOIN :#esoteric < 1118927436 0 :J|x!unknown@unknown.invalid NICK :jix < 1118936095 0 :CXI!unknown@unknown.invalid QUIT :Read error: 104 (Connection reset by peer) < 1118936188 0 :CXI!Sanity@dialup-89.105.221.203.acc51-kent-syd.comindico.com.au JOIN :#esoteric < 1118937119 0 :CXI!unknown@unknown.invalid QUIT :Excess Flood < 1118937146 0 :CXI!Sanity@dialup-89.105.221.203.acc51-kent-syd.comindico.com.au JOIN :#esoteric < 1118939847 0 :{^Raven^}!~{^Raven^}@82-38-204-252.cable.ubr05.shef.blueyonder.co.uk JOIN :#esoteric < 1118944889 0 :lament_!~lament@S010600110999ad06.vc.shawcable.net JOIN :#esoteric < 1118945212 0 :lament!unknown@unknown.invalid QUIT :Read error: 110 (Connection timed out) < 1118946859 0 :CXI!unknown@unknown.invalid QUIT :Connection reset by peer < 1118946902 0 :CXI!Sanity@dialup-89.105.221.203.acc51-kent-syd.comindico.com.au JOIN :#esoteric < 1118948019 0 :jix!unknown@unknown.invalid PART #esoteric :? < 1118948315 0 :jix!jix@p5489AFCE.dip.t-dialin.net JOIN :#esoteric < 1118948765 0 :lament_!unknown@unknown.invalid NICK :lament < 1118951261 0 :CXI!unknown@unknown.invalid QUIT :Read error: 60 (Operation timed out) < 1118952382 0 :sp3tt!~chatzilla@cust-148-133.elhandel.umeaenergi.se JOIN :#esoteric < 1118952809 0 :tokigun!unknown@unknown.invalid QUIT :Read error: 104 (Connection reset by peer) < 1118953553 0 :tokigun!~tokigun@dor204226.kaist.ac.kr JOIN :#esoteric < 1118953670 0 :jix!unknown@unknown.invalid QUIT :"Banned from network" < 1118953691 0 :jix!jix@p5489AFCE.dip.t-dialin.net JOIN :#esoteric < 1118953766 0 :calamari!~calamari@dialup-4.240.114.144.Dial1.Phoenix1.Level3.net JOIN :#esoteric < 1118954039 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :hey calamari: did you see the article on slashdot today about that javascript shell? < 1118954048 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :reminded me of Esoshell :) < 1118954164 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :hi kipple, all < 1118954180 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :no, let me look .. had /. open just haven't read it yet :) < 1118954199 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :kipple: JS/UIX? < 1118954202 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :well the site is off-line (big surprise) < 1118954203 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :yes < 1118954209 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :mirrordot link: http://www.mirrordot.org/stories/1c1bf041ca7144dbe4b35249a8db7dff/index.html < 1118954229 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :kipple: yes /. effect ;) i saw the site months ago. < 1118954424 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :cool! < 1118954452 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :whoever wrote this has even less of a life than I do :) < 1118954637 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :i'm thinking about 99 bottles of beer in Whirl. < 1118954662 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :it makes my head dizzy... :S < 1118954704 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :you should not drink the beer until after you're finished programming < 1118954717 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :uhm http://esolangs.org/wiki/BF_instruction_minimalization i got down to 4 instructions (but thats a .. hack) < 1118954815 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :hix: what are the 4 instructions? < 1118954818 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :err jix < 1118954842 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :kipple: i cannot drink the beer ;) < 1118954849 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :X U M and L < 1118954878 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :but U M and L have arguments ( there are still just X U M and L in the code) < 1118954894 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :X is flip the current bit < 1118954902 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :U is User and is used for in and output < 1118954908 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :M is used for moving < 1118954911 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :and L for looping < 1118954954 0 :sp3tt!unknown@unknown.invalid PRIVMSG #esoteric :Ow. That instruction minimalization hurts my brain even more than standard BF. < 1118954955 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :hmm < 1118954958 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :bf instructions don't take arguments :) < 1118954963 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :yes < 1118954968 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :it isn't brainfuck < 1118954979 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :then... what is THE arguments? < 1118954990 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :X U M and L < 1118955014 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :ULX moves up or down (i don't know.. have to recheck my specs) < 1118955016 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :like UX, UM, UL, LX, ....? < 1118955017 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :how can u be used for both input and output? < 1118955021 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :uh... MLX moves up or down < 1118955055 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :U takes a code as argument.. if the cell after evaluating the argument is zero input one output (or the other way around) < 1118955077 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :after the argument is evaluated the current cell is set to the value of the cell before the evaluation stated < 1118955105 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :I'm pretty sure what I have for the 5 instructions isn't going to work.. but that's okay :) < 1118955121 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :and because i didn't wanted to ad () or []{} i used a hack for the arguments < 1118955134 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :L takes one instruction as argument LL takes 2 LLL take 3... < 1118955170 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :and if you want an L instruction as argument of L you have to add 2 X instructions < 1118955182 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :jix: ah... then one instruction "block" (instruction + arguments) ends with X always? < 1118955185 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :I think I tested almost all the really simple solutions.. the problems were that they were very dependent on what the data was.. 0 would stay 0, but 1 might stay 1, or it might go into an infinite loop, etc < 1118955190 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :tokigun: no < 1118955203 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :hmm < 1118955207 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :calamari: your 8->7 translation is unoptimal < 1118955246 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :http://www.rpi.edu/~hughes/boof/ here is a shorter one < 1118955249 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :i didn't understand... have to think about it < 1118955249 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :jix: the goal wasn't to have 7 instructions < 1118955258 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :yes but your [ code is sooooo long < 1118955265 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :jix: I don't care :) < 1118955279 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :ok < 1118955280 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :that wasn't the point.. just wanted to dshow that it was bf complete < 1118955308 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :I quote from the article: " (most likely not optimized)" < 1118955313 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :i didn't say it isn't bf complete.. i just wanted to inform you that there is a shorter conversion < 1118955334 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :yeah, I think I saw one on a website.. but I wouldn't be able to use that without permission from the author < 1118955378 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :i have an idea for 5 instructions < 1118955434 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :but the memory usage may explode < 1118955584 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :i'm trying to combine . and , < 1118955595 0 :sp3tt!unknown@unknown.invalid QUIT :"Chatzilla 0.9.68a [Firefox 1.0.4/20050511]" < 1118955761 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :the only way I can think of to combine . and , would be to have it depnd on which instruction was executed last (or some similar cheating), or having a predefined I/O area, in which case both instructions can be eliminated < 1118955778 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :no it's just a replacement table < 1118955808 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :no idea what you meant by that < 1118955857 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :i removed the . and , instruction and added one which can be represented with the existing ones .. the same thing as you did < 1118955879 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :so .. would be output output < 1118955892 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :how do I do input? < 1118955903 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :wait i'm writing it down atm < 1118955928 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :note: any number of .'s will still be output :) < 1118955934 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :yes < 1118955937 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :of course < 1118955992 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :the definition of ; is [<.}]<}[<,}]< < 1118956047 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :and the translation from your 6 instruction set to the new 5 one is: '>' => '>>' , '<' => '<<' , '.' => '}<};' , ',' => '};' < 1118956051 0 :lindi-!unknown@unknown.invalid QUIT :Read error: 104 (Connection reset by peer) < 1118956094 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :oh wait < 1118956110 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :'>' doesn't exists < 1118956118 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :i create a new table < 1118956272 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :I'm not sure that qualifies either (although maybe my 5 inst solution doesn't either).. in essense you're constructing an if/else that does either one or the other. Feeling like cheating to me, but I dunno < 1118956297 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :if else .. where? < 1118956361 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :my reduction can be represented the same as yours .. i don't see a difference < 1118956371 0 :lindi-!~lindi@kulho150.adsl.netsonic.fi JOIN :#esoteric < 1118956394 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :jix: i'm not saying its invalid.. i'm just saying it feels like cheating to me :) < 1118956421 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :it's like the 8->7 translation < 1118956425 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :but I'm still checking it out < 1118956485 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :seems like you'd want [}<}. rather than [<. because otherwise you're always outputting a 0 for on of the bits? < 1118956497 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :on->one < 1118956540 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :why do i output 0 for them? < 1118956566 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :ah wait there is another mistake < 1118956573 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :well, maybe it's not that simple < 1118956595 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :ok i need to expand the memory by 3 < 1118956610 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :you'd start with 1, but then it goes left, so you're outputting x 1 x x x x x x < 1118956631 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :every 2nd bit is a bit only used for the ; instruction < 1118956642 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :data temp data temp.... < 1118956658 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :; doesn't exist.. I use . and , < 1118956669 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :they are a little different than bool < 1118956682 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :oh < 1118956683 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :since they input and output all 8 bits at once < 1118956696 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :no problem < 1118956710 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :I think that should actually make it easier :) < 1118956717 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :then i think i wanted yours.. and i can use the temp bit used in + and - < 1118956744 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :what bit is the temp bit .. 0 or 8 ? < 1118956753 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :0 ok < 1118956781 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :[}<}.<}] < 1118956801 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :hmm does that work < 1118956815 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :no will loop forever < 1118956828 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :no < 1118956837 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :will destroy the bit 0 of the output byte < 1118956861 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :if it's 1, it will get 1 x x x x x x x x, then you go left once, then right and flip, so 0 x x x x x x x x, then you exit < 1118956892 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :I'm using < = < and } = >@ < 1118956898 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :i too < 1118956905 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :doesn't [}.<] work ? < 1118956914 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :urg no < 1118956936 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :i think it should be [}<}.<<}] < 1118956948 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :. doesn't move the pointer < 1118956963 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :write it with > and @ < 1118956982 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :[>.<@] is [}<}.<<}] < 1118956997 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :> => }<} < => < and @ => <} < 1118957011 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :hmm, yeah you're right < 1118957016 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :but than we have a problem < 1118957031 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :because @ = <} < 1118957037 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :no problem, why < 1118957049 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :we destoryed the input or output bit < 1118957058 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :that's okay.. just use two < 1118957075 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :for example (I'll use the easier syntax so I don't mess it up): < 1118957096 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :ok but we have to rewrite the bf=> 5ins table < 1118957115 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :>[>.<@]<[>,<@] < 1118957163 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :}<}[}<}.<<}]<[}<},<<}] < 1118957183 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric ::) < 1118957216 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :anyone else have an opinion on this? < 1118957226 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :no one understands us ;) < 1118957237 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :seems legit to me, according to the rules I laid down in the article < 1118957264 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :ACTION has no opinion at all about this (except perhaps a headache) < 1118957267 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :uhm why are you skipping 10 bits in the 8->7 translation? < 1118957277 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :jix: because I'm unoptimal < 1118957285 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :yes but can't we reuse that bit < 1118957292 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :its bit 0 and 9 right ? < 1118957301 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :daniel is a bf genius < 1118957308 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :ACTION also has no opnion but headache < 1118957317 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :opinion* < 1118957319 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :I could never get close to the bf optimization he can do < 1118957356 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :jix: that stuff doesn't matter though.. that's only when translating back to bf < 1118957407 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :jix: but if I'm understanding you, yeah, the bf translation might need to change.. dunno < 1118957420 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :yes but i have an idea to make it a bit more optimal (optimal as in we don't have to change the translation ;) < 1118957443 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :do you have an account on the wiki? < 1118957456 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :yes < 1118957457 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :jix < 1118957465 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :okay, I'll edit, one sec < 1118957499 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :>>>>>>>>>[<<<<<<<<.>>>>>>>>@]<<<<<<<<<[>,<@] would work without changing the current translation < 1118957528 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :or }<}}<}}<}}<}}<}}<}}<}}<}}<}[<<<<<<<<.}<}}<}}<}}<}}<}}<}}<}}<}<}]<<<<<<<<<[}<},<<}] < 1118957560 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :i introduced cfdg at hanirc and some people interested in it. (especially my friend) < 1118957581 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :hmm is it ok to ad a }<} at the beginning of every translation ? < 1118957602 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :because than we could use the short ; representation AND the old translation table < 1118957614 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :calamari: ? < 1118957682 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :away for 15 min < 1118957689 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :If you'd like to optimizae the translations, that's cool < 1118957700 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :doesn't matter much to me, though :) < 1118957734 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :5:36 am... oops. < 1118957768 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :i don't want to optimize it.. i just don't want to change it (because thats to much work) < 1118957770 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :away < 1118957875 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :I think [}<}.<<}]<[}<},<<}] is better < 1118957904 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :the leading > wasn't needed, because it's taken care of in the ., translations < 1118958053 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :away < 1118958057 0 :tokigun!unknown@unknown.invalid NICK :tokigun^away < 1118958470 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :hmm, what about [.<]<[,<] 0 0(1) gives output and results 0 0 x x x x x x x x, 0 1(0) gives input and results 0 0 x x x x x x x x < 1118958664 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :cool.. looks good, I'm going with it :) < 1118958678 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :no that doesn't work < 1118958702 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :wait < 1118958709 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :what is your . and , translation < 1118958742 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :. = [@]>[@]>[@]@; (before } tanslation) < 1118958768 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :no need for [@] arn't the bits always 0 ? < 1118958769 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :, = [@]>[@]@>[@]; < 1118958780 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :jix: depends on what was there < 1118958811 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :that can't work the. is at position 0 (relative to ; call) and the , at position -1 < 1118958834 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :but i have another idea < 1118958860 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :jix: huh? < 1118958867 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :it's fine < 1118958872 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :[.<]<[,<] < 1118958875 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :trace it through on paper if you need to < 1118958893 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :it's a little tricky, sure.. but it works < 1118958909 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :start with 0 0 1 and the pointer at 1 < 1118958935 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :the pointer is at 2 < 1118958950 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :I meant at the 1.. sorry < 1118958975 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :than it may work but with . = [@]>[@]>[@]@; and , = [@]>[@]@>[@]; it doesn't < 1118959109 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :even better would be [.@]<[,<] < 1118959116 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :does . and , output the current bit+7 or the next bit+7 < 1118959126 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :current bit < 1118959159 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :actually, nm on [.@] < 1118959174 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :that messes up the original value, so it couldn't be converted back to . < 1118959213 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :how do you do the ] is still ] thing at 8->7 ? < 1118959243 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :what? < 1118959283 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :on the 8->7 instruction step ] is still ] .. but can't the current bit be zero but the data bits not? < 1118959323 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :huh? [ only tests a single bit < 1118959332 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :] does not test anything < 1118959364 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :yes but.. take a look at the BF BitChanger table < 1118959375 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :] just jumps back to [ < 1118959388 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :so all the weight of testing the byte is in [ < 1118959398 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :yes and [ jumps back to after the ] if value is zero < 1118959409 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :right < 1118959457 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :lets think of: 0[1 0 0 0 0 0 0 0] the [ part is the data... this will exit the loop with your translation table .. but it shouldn't < 1118959547 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :did you put this in an interpreter to check? < 1118959559 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :no < 1118959561 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :did you ? < 1118959565 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :nope :P < 1118959600 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :i think we should use the boolfuck thing.. the boolfuck interpreter is pd .. i assume the documentation too < 1118959601 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :I should... < 1118959607 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :I need to get going for now, though < 1118959612 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :it's been fun :) < 1118959634 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :hehe sure < 1118959815 0 :calamari!unknown@unknown.invalid QUIT :"cya all" < 1118960444 0 :jix!unknown@unknown.invalid QUIT :"Banned from network" < 1118960787 0 :CXI!~Sanity@dialup-9.104.221.203.acc51-kent-syd.comindico.com.au JOIN :#esoteric < 1118963101 0 :harkeyahh!~zillermae@206-81-148-32.slkc.qwest.net JOIN :#esoteric < 1118963601 0 :CXI!unknown@unknown.invalid QUIT :Read error: 104 (Connection reset by peer) < 1118963623 0 :CXI!~Sanity@dialup-9.104.221.203.acc51-kent-syd.comindico.com.au JOIN :#esoteric < 1118964945 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :hi y'all < 1118964959 0 :deltab!~deltab@82-46-140-217.cable.ubr02.smal.blueyonder.co.uk JOIN :#esoteric < 1118965031 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :we need to get urban to come here as well < 1118965052 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :hehe < 1118965064 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :I don't think he's much into esoteric languages these days... < 1118965111 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :kipple: "programming is like sex, you make one mistake and support it the rest of your life" < 1118965116 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :he clearly made his mistake :) < 1118965131 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :haha :D < 1118965318 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :I don't think he's done too much work supporting it... < 1118965333 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :yeah, what an asshole < 1118965340 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :stupid parachute dude < 1118965350 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :err... huh? < 1118965673 0 :deltab!unknown@unknown.invalid PRIVMSG #esoteric :he enjoys skydiving and juggling hard drives, according to Wikipedia < 1118965685 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :there was a picture of him skydiving on his page < 1118965687 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :but i can't find it < 1118965689 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :or the page < 1118965890 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :google image search for brainfuck gives all the wrong results < 1118966090 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :I think it gives several interesting results :) < 1118966097 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :like this: http://my.2000i.de/esolang2002/esolang-teaser.jpg < 1118966125 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :hahaha wtf is that. < 1118966141 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :brilliant. < 1118966192 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :I think it is a poster for a talk about esoteric programming < 1118966220 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :hmmm < 1118966232 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :i don't get it < 1118966237 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :what does this smetana program do? < 1118966246 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :Step 1. Swap step 1 with step 2 < 1118966249 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :Step 2. Go to step 1 < 1118966290 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :swaps indefinitely? < 1118966298 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :swaps 2 times then halts < 1118966298 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :why? < 1118966304 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :why? < 1118966333 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :cpressey: yeah, that's what i think it should do < 1118966370 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :yes. that seems to be right < 1118966423 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :this means my interpreter is broken < 1118966769 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :hm, that's right, i see the bug now < 1118966915 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :interesting, my interpreter is completely broken < 1118967094 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :phew < 1118967134 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :the interpreter was completely broken, yet the brokenness didn't affect the funcitonality of the smallfuck stuff < 1118967146 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :i.e. it still works :) < 1118967223 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :that's an interesting definition of "completely broken" < 1118967296 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :it was broken for all cases when a swap instruction referenced itself < 1118967303 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :which apparently the smallfuck stuff never does < 1118967416 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :and i guess other than smallfuck stuff, there aren't very many smetana programs :( < 1118967549 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :i think repeatingly running a smetana program might lead to interesting results < 1118967731 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :simplest case, an on-off switch: < 1118967740 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :Step 1. Swap step 3 with step 4. < 1118967747 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :Step 2. Go to step 42 < 1118967760 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :Step 4. (on) < 1118967765 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :Step 3. (off) < 1118967775 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :(swap step 3 with step 4 before reading) < 1118968771 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :ACTION performs an act of abominable herecy: adds a print instruction to SMETANA! < 1118968781 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :heresy < 1118968826 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :Step 1. Print "Hello world!". < 1118971200 0 :harkeyahh!unknown@unknown.invalid PART #esoteric :? < 1118971336 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :hm < 1118971355 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :looks like 99 bottles of beer would take more code than there's text in it :( < 1118971362 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :i.e. the cheapest version is to just use print statements < 1118972055 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :ha < 1118972069 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :well, it wouldn't be the first, I think < 1118972414 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :gotta go. bye < 1118972418 0 :kipple!unknown@unknown.invalid PART #esoteric :? < 1118974319 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :Step 1. Swap step 2 with step 4. < 1118974322 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :Step 2. Swap step 5 with step 6. < 1118974323 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :Step 3. Go to step 5. < 1118974323 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :Step 4. Swap step 5 with step 7. < 1118974323 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :Step 5. Print "C". < 1118974323 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :Step 6. Print "B". < 1118974325 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :Step 7. Print "A". < 1118974328 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :Step 8. Print "\n". < 1118974330 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :Step 9. Go to step 1. < 1118974586 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :could be shortened by a step, of course. < 1118982603 0 :malaprop!unknown@unknown.invalid QUIT :"sleep" < 1118986486 0 :comet_11!~Sanity@dialup-136.89.221.203.acc50-kent-syd.comindico.com.au JOIN :#esoteric < 1118986518 0 :CXI!unknown@unknown.invalid QUIT :Nick collision from services. < 1118986520 0 :comet_11!unknown@unknown.invalid NICK :CXI < 1118986684 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :I improved my libc scrabble game :) < 1118986687 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :Now it has bonuses :) < 1118988769 0 :GregorR!unknown@unknown.invalid QUIT :"Leaving" < 1118988851 0 :GregorR!~GregorR@c-24-21-138-66.hsd1.or.comcast.net JOIN :#esoteric < 1118992972 0 :tokigun^away!unknown@unknown.invalid NICK :tokigun < 1118995199 0 :clog!unknown@unknown.invalid QUIT :ended < 1118995200 0 :clog!unknown@unknown.invalid JOIN :#esoteric < 1118996737 0 :sp3tt!~sp3tt@cust-148-133.elhandel.umeaenergi.se JOIN :#esoteric < 1118996945 0 :sp3tt!unknown@unknown.invalid QUIT :Client Quit < 1118997002 0 :sp3tt!~sp3tt@cust-148-133.elhandel.umeaenergi.se JOIN :#esoteric < 1118997046 0 :sp3tt!unknown@unknown.invalid PART #esoteric :? < 1118997180 0 :sp3tt!~sp3tt@cust-148-133.elhandel.umeaenergi.se JOIN :#esoteric < 1118997187 0 :sp3tt!unknown@unknown.invalid PART #esoteric :? < 1118997529 0 :sp3tt!~sp3tt@cust-148-133.elhandel.umeaenergi.se JOIN :#esoteric < 1118997630 0 :sp3tt!unknown@unknown.invalid QUIT :"Leaving" < 1118997664 0 :sp3tt!~sp3tt@lite-148-133.umenet.net JOIN :#esoteric < 1118998273 0 :tokigun!unknown@unknown.invalid QUIT :"Chatzilla 0.9.68.5 [Firefox 1.0.3/20050414]" < 1119001645 0 :kipple!~kipple@163.80-202-100.nextgentel.com JOIN :#esoteric < 1119002679 0 :tokigun!~tokigun@dor204226.kaist.ac.kr JOIN :#esoteric < 1119004141 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :lament: lol @ http://z3.ca/~lament/pictures/flow.gif - Hofstadter would probably enjoy it very much < 1119004198 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :re Urban Müller's old homepage: http://web.archive.org/web/20040903174220/http://ftp.wustl.edu/~umueller/ < 1119004231 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :re SMETANA print instruction: now the next challenge is 99bob :) < 1119004390 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :I think that Müller is now working for a company offering a search engine < 1119004471 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :BTW, according to his homepage Müller spends (spent?) "too much time on IRC" (ircnet) < 1119004765 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :he's probably one of these: http://tel.search.ch/result.de.html?all=urban+mueller < 1119012785 0 :sp3tt!unknown@unknown.invalid QUIT :"BitchX-1.1-final -- just do it." < 1119014480 0 :CXI!unknown@unknown.invalid QUIT :"If you're reading this, it's probably x-chat's fault." < 1119015481 0 :CXI!~Sanity@dialup-104.89.221.203.acc50-kent-syd.comindico.com.au JOIN :#esoteric < 1119015883 0 :jix!jix@p5489B8D7.dip.t-dialin.net JOIN :#esoteric < 1119017331 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :pgimeno: Urban is number 14 on that list < 1119017363 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :thanks {^Raven^} < 1119017522 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :So we're stalking him now? < 1119017552 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :no, just using publicly available information put online bu Urban himself < 1119021100 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :I'm sure he put his phone number online so that people could call him and ask things like "so, dude, what should a cell contain after reading EOF?" ;) < 1119021154 0 :malaprop!~ph@ppp-68-251-34-174.dsl.chcgil.ameritech.net JOIN :#esoteric < 1119022752 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :kipple: questions like that are answered by reading the original/using the original compiler < 1119022761 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :it should all be self evident < 1119022786 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :*the souce code of < 1119022987 0 :Keymaker!~Not@wire74.adsl.netsonic.fi JOIN :#esoteric < 1119023022 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :*sighhhhh* < 1119023624 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :hey, cool < 1119023632 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :ACTION phones müller < 1119023636 0 :jix!unknown@unknown.invalid PART #esoteric :? < 1119023640 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :ok, not really :p < 1119023641 0 :jix!jix@p5489B8D7.dip.t-dialin.net JOIN :#esoteric < 1119023736 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :hm. müller doesn't mention brainfuck on his site.. how that can be possible?! < 1119023775 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :he has interesting hobbies, though < 1119024207 0 :louis_!~louis@clouis.padinet.com JOIN :#esoteric < 1119024358 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :Keymaker: I don't think he really cares much about it < 1119024385 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :yeah < 1119024388 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric ::( < 1119024413 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :must go eat. < 1119024570 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :Raven: I don't have an Amiga, so I can't use it, and I don't read assembler < 1119024606 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :the interpreter says -1 though, and that's what I'm sticking with, but I'm not 100% sure the compiler does the same < 1119025821 0 :louis_!unknown@unknown.invalid PART #esoteric :? < 1119026796 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :Maybe - juuuuust MAYBE (read: certainly) - Urban just doesn't want to go into a job interview and have the interviewer say "Oh ... yeah ... you're the guy who wrote Brainfuck ..." < 1119026811 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :I mean, esoteric programming is fun and all, but we should respect his right to live it down. < 1119026830 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :agreed < 1119026850 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :anyway, I'm categorizing NULL as a Non-textual language. any objections? < 1119026972 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :Makes sense to me. < 1119027009 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :so now Piet doesn't need to feel so alone anymore :) < 1119027487 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :kipple: I agree to you. < 1119027694 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :hmm < 1119027708 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :can I add my own Hello, world program in Whirl page? < 1119027715 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :omg < 1119027720 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :Whirl -> NULL < 1119028249 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric ::) < 1119028255 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :go ahead, i'd say < 1119028257 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :;) < 1119028290 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :hmm < 1119028551 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :rgh. i can do nothing < 1119028601 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :and it's annoyingly 25 celsius hot here¨ < 1119028605 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :i hate summer < 1119028655 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :18°C here < 1119028668 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :ah.. < 1119028672 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :but 17-26 is ok for me < 1119028677 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :d'oh < 1119028690 0 :tokigun!unknown@unknown.invalid QUIT :Remote closed the connection < 1119028707 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :i'd rather take -17 - -26 :) < 1119028714 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :brr < 1119028735 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :too bad the previous winters have been so warm < 1119028737 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :at least i think so < 1119028758 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :a few weeks ago we had 35° < 1119028780 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :thats really annoying < 1119028787 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :arrrgh < 1119028793 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :where are you, btw? < 1119028802 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :Bremen, Germany < 1119028807 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :wow < 1119028814 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :i didn't know there's so warm in germany < 1119028822 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :it isn't always so warm < 1119028826 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :yeah < 1119028833 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :but still really warm, that day < 1119028850 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :it was just for 2 days.. the weeks before and the weeks after that days were 9-15°C < 1119028861 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :ok < 1119028890 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :but last week i was in france < 1119028900 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :ok < 1119028903 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :it was hot.... < 1119028907 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :too hot for me < 1119028913 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric ::) < 1119028924 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :did you see that eiffel tower? < 1119028952 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :no i wasn't in Paris < 1119028957 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :ok < 1119028974 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :well, i haven't seen it < 1119028984 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :haven't visited france :( < 1119028988 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :i was at the Cote d'Azur (near Monaco or was it already Monaco?) < 1119028996 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :no idea < 1119029249 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :should i add Unnecessary to esowiki? :) < 1119029317 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :why? < 1119029351 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :for fun < 1119029359 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :to joke languages < 1119029416 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :does HQ9+ ignore any non HQ9+ characters ? < 1119029425 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :dunno < 1119029449 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :because if it does i have a Q less quine: Hello, world! < 1119029523 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :hey, you're right < 1119029529 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :never thought about that < 1119029530 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric ::) < 1119029620 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :it doesn't... print_string "Unknown command: "; print_char c; < 1119029651 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :grh :( < 1119029681 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :otherwise it would've been neat new quine for that language < 1119029735 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :or well, it isn't officially said anywhere.. i think < 1119029744 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :that's just unofficial interpreter < 1119029749 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :;) < 1119029755 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :no its the reference implementation < 1119029799 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :yes, one the site, but can't find anywhere the fact < 1119029816 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :"Those that I've managed to find are listed below." < 1119029837 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :oh < 1119029869 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :that doesn't clearly mean it's official. the author should've made more clear whether the language reports other characters as error or ignores them < 1119029897 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :anyways, you could e-mail the author :) < 1119030633 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :ACTION goes to play commander keen 5 < 1119032769 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :rgh < 1119032777 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :bye < 1119032784 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :and thanks for all the fish < 1119032788 0 :Keymaker!unknown@unknown.invalid QUIT :"I've seen this déjà vu before.." < 1119033820 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :ACTION ponders < 1119035982 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :ACTION ponders what {^Raven^} is pondering < 1119036706 0 :e!felis@bzq-207-69.red.bezeqint.net JOIN :#esoteric < 1119036720 0 :e!unknown@unknown.invalid QUIT :Client Quit < 1119037637 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :and again the SEX instruction (COSMAC 1802 cpu) < 1119038012 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :LOL < 1119038029 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :Bow chicka bow wow. < 1119038044 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :I'm under the distinct impression that Berlios registration is borked :(* < 1119038167 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :oh, my Choon submission was accepted < 1119038192 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :i'm going to write 99 bob for the ELF II computer < 1119038196 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :Hmm, never mind ... apparently fourth time's a charm XD < 1119038202 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :but first i need an assembler for that cpu < 1119038672 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :ACTION hates writing GUI apps for Windows but is forced to today < 1119038809 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :ACTION explodes < 1119038992 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :I use FLTK. < 1119038999 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :Just makes the whole portability thing muuuuch easier. < 1119039010 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :And it's small enough to reasonably compile statically into the binary. < 1119039244 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :The entire program is 41 lines of code, but need to add a few hundred extra for the IF. Grrr... < 1119039912 0 :tokigun!~tokigun@dor204226.kaist.ac.kr JOIN :#esoteric < 1119041074 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :I'll just make it a CLI tool for DOS and let the user deal with it < 1119044997 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :c:\app\addcust.exe /name="John Doe" /address="666th street, Moon" /phone="(+12)3456789" < 1119045020 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :Customer "John Doe" added. Use brwscust.exe to list data. < 1119045139 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :(forgot the C:\> prompt, sorry) < 1119045336 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :I'm designing 99 Bottles of Beer in Whirl.... yeah so difficult. < 1119045692 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :whirl is a PITA to code in (though you can compress the sources pretty well, like 8:1 at worst) < 1119045714 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :PITA? < 1119045732 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :pain in the arse < 1119045743 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :ah... < 1119045751 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :i see. < 1119045808 0 :jix!unknown@unknown.invalid QUIT :"Banned from network" < 1119045951 0 :calamari!~calamari@dialup-4.240.114.137.Dial1.Phoenix1.Level3.net JOIN :#esoteric < 1119046029 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :speaking of the moon: http://www.userfriendly.org/cartoons/archives/04jan/uf006348.gif < 1119046065 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :hi calamari < 1119046173 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :hi pgimeno < 1119046364 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :pgimeno: I used to be majorly "into" writing GUI software, these day I write portable, multi-platform CLI stuff wherever possible < 1119047140 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :hmm < 1119047164 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :http://leporidae.tokigun.net/.service/99bob.txt psuedo code of 99 bob... < 1119047203 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :though i should explain this meta-language. :p < 1119047583 0 :Keymaker!~Not@wire74.adsl.netsonic.fi JOIN :#esoteric < 1119047713 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :that vaguely reminds me of my planning of the "cat" program in Malbolge < 1119047718 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :tokigun: yeah, that's gonna be a good challenge. good luck. < 1119047719 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :hi Keymaker < 1119047721 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :hi < 1119047747 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :Keymaker: hello. / thanks :) < 1119047756 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric ::) < 1119047789 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :the jumping is hard < 1119047831 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :(never tried, but at least that i got from the language specification..) < 1119047842 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :(or well, there doesn't read that, but i thought it is hard) < 1119047848 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :yes... i have many issues and i'm finding solutions of them. < 1119047861 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :Keymaker: I downloaded your sample Unnecessary source and works perfectly. Do you have more samples I can download to get a feeling of how it works? < 1119047886 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :some of them have been solved (perhaps) but sometimes another problem has been appeared :( < 1119047912 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric ::( < 1119047917 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :Keymaker: How about Unnecessary interpreter for web? < 1119047920 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :pgimeno: try hello.unn < 1119047940 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :oh! trying now < 1119047945 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :heh. that could be fun :) < 1119047967 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :i could make one in php < 1119048037 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :by the way, anyone seen hitchcock's the birds? < 1119048043 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :i just saw it before came here < 1119048047 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :really good :) < 1119048054 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :now i'm afraid of birds, though < 1119048093 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :tweet < 1119048110 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :aaaargh < 1119048113 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :nice, http://koti.mbnet.fi/yiap/stuff/hello.unn also compiles and runs, though it doesn't print "Hello, world". I'll activate debugging to see what's wrong. < 1119048128 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric ::D take your time < 1119048144 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :6:43 am KST... i get to sleep ;) < 1119048150 0 :tokigun!unknown@unknown.invalid NICK :tokigun^away < 1119048150 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric ::) hehe ok < 1119048184 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :good nite tokigun^away < 1119048199 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :is most of europe gmt? < 1119048207 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :dunno < 1119048240 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :never heard of kst :) < 1119049108 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :most of europe is CET = GMT+1/2 (currently 2 because of DST) < 1119049126 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :(with a relaxed concept of "most") < 1119049446 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :http://www.timeanddate.com/library/abbreviations/timezones/eu/cet.html < 1119049478 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :does anyone know of some good references for cross-compiling brainfuck into something more efficient? < 1119049484 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :nope < 1119049498 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :Raven: there's that bf cpu where it can run native ;) < 1119049589 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :bbl.. food < 1119049594 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric ::) < 1119049596 0 :calamari!unknown@unknown.invalid QUIT :"Leaving" < 1119049710 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :There are a bunch of BF compilers that compile BF into C. < 1119049734 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :too many < 1119049743 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :And a few of those combine things like >>> into one += 3 < 1119049764 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :and mostly they are written in c < 1119049805 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :btw, here's unnecessary interpreter for web use: < 1119049805 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :http://koti.mbnet.fi/yiap/stuff/unnecessary.php?program=hello.unn&debug=on < 1119049828 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :i've got a brainfuck optimisation engine that I'm working on that spits out code in whatever language you fancy < 1119049845 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :well, what if i fancy brainfuck? :) < 1119049853 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :erm... < 1119049859 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :it outputs brainfuck too < 1119049859 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :or well, thue then :) < 1119049908 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :you'd have to write a set of rules to decompile the internal code to whichever language < 1119049929 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric ::) < 1119049976 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :anyways, nice project < 1119049985 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :i'd like to get together some more information than the optimisations that I already have < 1119049997 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :i;'m sure there's stuff i've not thought about < 1119050538 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :for an extreme case it reduces my Lost Kingdom from 2.1 million raw brainfuck instructions down to 147,000 instructions < 1119050630 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :and that could be improved further < 1119050653 0 :fizzie!unknown@unknown.invalid PRIVMSG #esoteric :My befunge compiler does some optimizations too, so I guess it could be used for compiling brainf*ck (by translating first to befunge). I should just clean it up and write a code-generating backend, currently it can only spit out simple C code. < 1119050678 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :that's pretty good, raven < 1119050682 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :fizzie: do you have a link? < 1119050820 0 :fizzie!unknown@unknown.invalid PRIVMSG #esoteric :I only have some generated output in the interweb ( http://gehennom.org/~fis/utm.html => http://gehennom.org/~fis/out.c.txt ), not the compiler sources. Oh, and http://gehennom.org/~fis/re.bf.txt -> http://gehennom.org/~fis/re.bef.txt for the "oh gods that's horrible" brainf*ck->befunge translation. < 1119050837 0 :fizzie!unknown@unknown.invalid PRIVMSG #esoteric :I'm not quite sure what re.bf did. Probably something related to regular expressions. < 1119051043 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :fizzie: is there the C output of re.bef < 1119051053 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :looks pretty good < 1119051135 0 :fizzie!unknown@unknown.invalid PRIVMSG #esoteric :Not really, since g/p don't work in the C-code-creation-backend. That could be easily fixed, though, since the 'p's in that translated-brainf*ck code don't do any self-modification. I think there were some known bugs in the compiler still, though. < 1119051233 0 :fizzie!unknown@unknown.invalid PRIVMSG #esoteric :Oh well. This part of Europe is EET (GMT+3 at the moment, with the DST) so it's 01:34am, and a ~early morning tomorrow, so -> sleeps now. Night. < 1119051245 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :goodnight < 1119051602 0 :calamari!~calamari@dialup-4.240.111.103.Dial1.Phoenix1.Level3.net JOIN :#esoteric < 1119051607 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :re's < 1119051835 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :nite < 1119051858 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :(thanks heaven i'm on summer vacation (and have no summer job either ;))) < 1119051901 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :slacker! < 1119052349 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric ::) < 1119052362 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :well, i tried, but nobody hired me! < 1119052390 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :well, doesn't matter. i get to stay awake late < 1119052397 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :though, can't get money < 1119052438 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :lots of free time to come up with a new language < 1119052447 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :yeah < 1119052464 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :too bad i'm reading to final exams < 1119052468 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :or dunno what those are called < 1119052478 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :fizzie could probably translate but he went away < 1119052526 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :I'm curious what the sentence looks like natively < 1119052608 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :which one :D < 1119052634 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :the one you couldn't translate < 1119052668 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :ah. i'm talking about the big exams you need to get trough to get out from high school, or whatever would be the translation < 1119052678 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :school systems are annoyingly so different in different places < 1119052707 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :anyways, i could probably get through it without reading, but i'm hoping/going to get good grades < 1119052730 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :are high school exams common? I didn't have to take an exam to graduate.. but I know they started testing a few years ago < 1119052755 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :well, here there has been these exams/'writings' for years < 1119052767 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :essay? < 1119052767 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :probably 50 years or more, at least < 1119052780 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :? < 1119052793 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :oh, just wondering if that was the word you meant < 1119052797 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :ah < 1119052800 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :well, dunno :) < 1119052854 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :anyways, since what's the point studying (read: wasting time to that crap) and take low grades in the final exams? nothing, so i'll try to get as good as i can < 1119052854 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :so, write me some nice trance music.. you europeans are good at that :) < 1119052868 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :yeah < 1119052880 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric ::) < 1119052902 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :and therefore, i must read.. (although, i could probably take a small weekend break ;)) < 1119052913 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :and trance.. i wish i could compose it :) < 1119053066 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :Keymaker: what kind of music do you compost atm < 1119053070 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :*compose < 1119053079 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :*if any < 1119053088 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :at the moment? nothing :) but tried something earlier today < 1119053098 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :well, i try to get monotrack with industrial flavour < 1119053108 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :nice < 1119053117 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric ::) < 1119053152 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :ACTION usually writes ambient classical < 1119053161 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :ok < 1119053183 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :as well, i must note: i don't know anything about music, i just try to find nice sounds, tweak and edit them and try to get it sound nice < 1119053191 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :i have zero knowledge of any theory :) < 1119053195 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :ACTION plays along to songs on his harmonica.. no musical talent here.. hehe < 1119053221 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :hehe < 1119053231 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :keymaker: I've listened to plenty of mods that were made just that way, and they are great < 1119053252 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :i've heard some pretty amazing stuff made from loops and samples from peeps with no musical knowledge < 1119053287 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :yeah < 1119053303 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :hopefully talent or intelligence is not required :9 < 1119053356 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :raven: heard of glastonbury? wondering if that is some kind of concert center? < 1119053437 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :calamari: Glastonbury is a small village, the festival is held in a big field(s) on a farm < 1119053468 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :oic.. cool. < 1119053497 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :calamari: people going there bring tents, food and stuff. It can get pretty muddy especially if it rains < 1119053517 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :is it free? < 1119053611 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :here's pleny of festivals < 1119053617 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :(not that i'd visit them) < 1119053673 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :why not? < 1119053757 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :well < 1119053765 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :no idea < 1119053768 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :trance is so small in the us.. most is lame dance stuff.. you guys have it lucky over there < 1119053775 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :yep < 1119053784 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :one thing is what i would like to see < 1119053805 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :in week or so, my absolutely favourite, SCOOTER, comes to one festival. < 1119053813 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :tickets are about £125 gbp or $229 usd or 186 euros < 1119053826 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :it's one of the biggest festivals around, on midsummer, and there's also other good electronic music < 1119053848 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :would love to see them < 1119053862 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :raven: wow, that's pretty steep..no wonder they camp out < 1119053905 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :nothing actually stops me from going, in fact folks have been trying to get me going there since they know i like scooter so much. < 1119053913 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :either the way, for some reason i don't go < 1119053939 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :i'll complain for weeks how stupid i am, when it's gone and i can read from web how scooter fans say "AWESOME GIG!!!!!" < 1119053997 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :as well, very expensive tickets, raven < 1119054013 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :they're a lot cheaper around here < 1119054034 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :a lot < 1119054042 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :Apparently is is well worth it, thousands of peeps over 2 days with several stages open at the same time < 1119054082 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :do you like happy hardcore? < 1119054092 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :me? < 1119054101 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :sure < 1119054102 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :yes, that as well :) < 1119054108 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :cool :) < 1119054139 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :oh, you're talking about music.. yes, that as well. < 1119054144 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :(lame joke) < 1119054163 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :ACTION thinks he gets the joke but isn't sure < 1119054215 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric ::) but anyways, < 1119054225 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :almost any electronic music is fine < 1119054326 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :but not noise or whatever it's called < 1119054336 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :like where there is just pure noise < 1119054351 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :like for example white noise combined with some annoying sounds < 1119054366 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :stuff that hurts ears.. no thanks < 1119054610 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :you mean pop music ;) < 1119054614 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :hehe < 1119054672 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :"harsh noice" is the category, i guess < 1119054707 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :ACTION digs rock, metal and trance < 1119054738 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :The Germans are pretty good for metal < 1119054763 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :and trance.. good ol' germantrance :) < 1119054778 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :(althouhg, no idea about metal, i hate that noise) < 1119054790 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :yeah lol, didn't the Germans invent trance? < 1119054821 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :dunno < 1119054836 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :at least they produce and listen it a lot < 1119055281 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :hmm, the birds make more noise than usually (outside).. i hope they don't plan an attack < 1119055310 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :they're out to get you < 1119055419 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :aargh seagulls!!!!!! < 1119055584 0 :malaprop!unknown@unknown.invalid QUIT :Read error: 54 (Connection reset by peer) < 1119055621 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :hm. i'm tired.. and hungry. i've eaten almost nothing this summer.. like only once a day, usually noodles. nothing else the whole day < 1119055750 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :i'll go to pile up z's < 1119055780 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :nite < 1119055782 0 :Keymaker!unknown@unknown.invalid QUIT :"I've seen this déjà vu before.." < 1119055875 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :i'm gonna go to bed to and avoid programming some more < 1119055982 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :got to get some ideas together for a text adventure programming competition that started a few days ago < 1119056034 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :game engine has to be 2,899 bytes maximum with a 8,192 byte data file < 1119056204 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :good luck! :) < 1119056234 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :Thx! I won last year < 1119056425 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :haha < 1119056446 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :lament: ? < 1119056452 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :{^Raven^}: what languages are accepted? < 1119056502 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :lament: loads, mainly it's if it can be run on any of a huge list of platforms < 1119056513 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :*on one of < 1119056518 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :do they accept Thue? :) < 1119056550 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :how about sed? :) < 1119056555 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :probably, although i'd contact the organiser < 1119056559 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :how about Inform? < 1119056563 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :(ha-ha) < 1119056587 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :if you can do it in 2,899 bytes of source code with a max 8k data file < 1119056627 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :ORK is the best for the task, it's so compact... < 1119056639 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :Here you go: You are in a room. Exits to the north, east, south, west. (repeat) < 1119056661 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :page is at http://www.geocities.com/dunric/advcomp.html < 1119056684 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :I hope that's not the same dunric I know < 1119056700 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :Is there more than one? < 1119056727 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :ACTION cannot imagine PAP x 2 < 1119056777 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :uhoh, it is :) < 1119056802 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :I know him from efnet #rgvc (or should I say used to know.. presently banned) < 1119056839 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :he occasionally posts a giant flame to rec.games.video.classic.. I think I was mentioned once.. lol < 1119056853 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :(although, iirc, in a positive light) < 1119056904 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :hehe, anyways.. pretty cool < 1119057910 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :ACTION goes to bed < 1119057914 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :nite peeps < 1119060325 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :that sounds like an interesting contest... < 1119061993 0 :malaprop!~ph@adsl-69-212-194-131.dsl.chcgil.ameritech.net JOIN :#esoteric < 1119062245 0 :graue!~graue@ip68-100-130-21.dc.dc.cox.net JOIN :#esoteric < 1119062316 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :who's this iamnothere dolt who has a package? < 1119062333 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :i hope it gets to La Puente all broken and covered with oats < 1119063113 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :I know < 1119063152 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :here's what needs to be done: < 1119063162 0 :lament!unknown@unknown.invalid TOPIC #esoteric :Another brainfuck site (http://www.bf-hacks.org/) is open! ~ http://chriscoyne.com/cfdg/ ~ Esolang wiki: http://esolangs.org/wiki/ Please pray for my package to arrive safely in Mumbai, India. thnx much! < 1119063187 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :now that's something i can wholeheartedly support < 1119064255 0 :kipple!unknown@unknown.invalid QUIT :Read error: 110 (Connection timed out) < 1119066915 0 :pgimeno!unknown@unknown.invalid QUIT :Read error: 104 (Connection reset by peer) < 1119066969 0 :pgimeno!pgimeno@124.Red-80-59-211.pooles.rima-tde.net JOIN :#esoteric < 1119067498 0 :calamari_!~calamari@dialup-4.240.111.226.Dial1.Phoenix1.Level3.net JOIN :#esoteric < 1119067873 0 :calamari!unknown@unknown.invalid QUIT :Read error: 104 (Connection reset by peer) < 1119076180 0 :graue!unknown@unknown.invalid PART #esoteric :? < 1119077248 0 :calamari_!unknown@unknown.invalid NICK :calamari < 1119081599 0 :clog!unknown@unknown.invalid QUIT :ended < 1119081600 0 :clog!unknown@unknown.invalid JOIN :#esoteric < 1119081710 0 :calamari_!~calamari@dialup-4.240.150.96.Dial1.Phoenix1.Level3.net JOIN :#esoteric < 1119082244 0 :calamari!unknown@unknown.invalid QUIT :Read error: 60 (Operation timed out) < 1119085793 0 :tokigun^away!unknown@unknown.invalid NICK :tokigun < 1119088686 0 :calamari_!unknown@unknown.invalid QUIT :"Leaving" < 1119089271 0 :jix!jix@p5489B8D7.dip.t-dialin.net JOIN :#esoteric < 1119089463 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :moin < 1119092182 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :... < 1119096150 0 :puzzlet!unknown@unknown.invalid PRIVMSG #esoteric :hey tokigun < 1119096338 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :puzzlet: why? < 1119096428 0 :tokigun!unknown@unknown.invalid QUIT :"Chatzilla 0.9.68.5 [Firefox 1.0.3/20050414]" < 1119098089 0 :J|x!jix@p5489EE67.dip.t-dialin.net JOIN :#esoteric < 1119098127 0 :jix!unknown@unknown.invalid QUIT :Nick collision from services. < 1119098129 0 :J|x!unknown@unknown.invalid NICK :jix < 1119100203 0 :tokigun!~tokigun@dor203183.kaist.ac.kr JOIN :#esoteric < 1119102514 0 :kipple!~kipple@163.80-202-100.nextgentel.com JOIN :#esoteric < 1119106243 0 :jix!unknown@unknown.invalid QUIT :"This computer has gone to sleep" < 1119108343 0 :jix!jix@p5489EE67.dip.t-dialin.net JOIN :#esoteric < 1119108980 0 :graue!~graue@ip68-100-130-21.dc.dc.cox.net JOIN :#esoteric < 1119117099 0 :ionas!~ionas@IP-213157005086.dialin.heagmedianet.de JOIN :#esoteric < 1119117108 0 :ionas!unknown@unknown.invalid PART #esoteric :? < 1119118488 0 :comet_11!Sanity@dialup-104.89.221.203.acc50-kent-syd.comindico.com.au JOIN :#esoteric < 1119118748 0 :CXI!unknown@unknown.invalid QUIT :Read error: 104 (Connection reset by peer) < 1119132842 0 :comet_11!unknown@unknown.invalid QUIT :Read error: 145 (Connection timed out) < 1119136117 0 :graue!unknown@unknown.invalid QUIT :"Leaving" < 1119136190 0 :tokigun!unknown@unknown.invalid QUIT :"rebooting" < 1119136325 0 :tokigun!~tokigun@dor203183.kaist.ac.kr JOIN :#esoteric < 1119140069 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :quiet today... < 1119140130 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :true < 1119141607 0 :calamari!~calamari@dialup-4.240.69.116.Dial1.Phoenix1.Level3.net JOIN :#esoteric < 1119141616 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :hi < 1119141700 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :hello < 1119142274 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :hello < 1119142402 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :moin calamari < 1119142573 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :i'm writing low-level psuedo code of 99bob in whirl... eh. < 1119143455 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :jix: I need to write up a bool debugger so it's easier to verify solutions :) < 1119143477 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :yes that would help a lot < 1119145458 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :hmmm < 1119145470 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :http://zenith.sparcs.net/dev/whirl99bob.txt < 1119145487 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :i've just finished low-level psuedo code of 99bob in whirl. < 1119145502 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :(still hard to understand) < 1119148174 0 :jix!unknown@unknown.invalid QUIT :"Banned from network" < 1119153657 0 :calamari_!~calamari@dialup-4.240.114.136.Dial1.Phoenix1.Level3.net JOIN :#esoteric < 1119153734 0 :calamari!unknown@unknown.invalid QUIT :Read error: 104 (Connection reset by peer) < 1119153853 0 :CXI!Sanity@dialup-130.89.221.203.acc50-kent-syd.comindico.com.au JOIN :#esoteric < 1119154763 0 :kipple!unknown@unknown.invalid QUIT :Read error: 110 (Connection timed out) < 1119156275 0 :pgimeno!unknown@unknown.invalid QUIT :brown.freenode.net irc.freenode.net < 1119156275 0 :puzzlet!unknown@unknown.invalid QUIT :brown.freenode.net irc.freenode.net < 1119156336 0 :fizzie!unknown@unknown.invalid QUIT :brown.freenode.net irc.freenode.net < 1119156336 0 :deltab!unknown@unknown.invalid QUIT :brown.freenode.net irc.freenode.net < 1119156455 0 :deltab!~deltab@82-46-140-217.cable.ubr02.smal.blueyonder.co.uk JOIN :#esoteric < 1119156455 0 :fizzie!fis@sesefras.tky.hut.fi JOIN :#esoteric < 1119156469 0 :pgimeno!pgimeno@124.Red-80-59-211.pooles.rima-tde.net JOIN :#esoteric < 1119156469 0 :puzzlet!~puzzlet@61.247.148.38 JOIN :#esoteric < 1119167999 0 :clog!unknown@unknown.invalid QUIT :ended < 1119168000 0 :clog!unknown@unknown.invalid JOIN :#esoteric < 1119168835 0 :calamari_!unknown@unknown.invalid QUIT :Read error: 110 (Connection timed out) < 1119169087 0 :calamari!~calamari@dialup-4.240.108.245.Dial1.Phoenix1.Level3.net JOIN :#esoteric < 1119172960 0 :tokigun!unknown@unknown.invalid QUIT :Read error: 131 (Connection reset by peer) < 1119172962 0 :tokigun_!~tokigun@dor203183.kaist.ac.kr JOIN :#esoteric < 1119172964 0 :tokigun_!unknown@unknown.invalid NICK :tokigun < 1119175501 0 :jix!jix@p5489EE67.dip.t-dialin.net JOIN :#esoteric < 1119175531 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :moin < 1119176274 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :hi jix < 1119176285 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :messing with that debugger.. < 1119176308 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :hehe < 1119176326 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :actually I should say messing with Swing, since I haven't written a line of interpreter code yet < 1119176527 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :hehe use ruby/tk < 1119176553 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :(he means python) < 1119176563 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :no ruby < 1119176602 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :pythen is nice but i prefer ruby's syntax and core features and stdlib < 1119176603 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :I've written a couple new LayoutManager's today.. but they should come in handy in the future < 1119176733 0 :pul!pul@221.147.217.228 JOIN :#esoteric < 1119176737 0 :pul!unknown@unknown.invalid PART #esoteric :? < 1119177468 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :jix: http://images.kidsquid.com/bool.png < 1119177528 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :nice < 1119177637 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :jix: thanks :) < 1119178314 0 :Keymaker!~Not@wire74.adsl.netsonic.fi JOIN :#esoteric < 1119178330 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :calamari: looks good < 1119178346 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :bool probably is some language? < 1119178488 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :it's 1bit brainfuck < 1119178525 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :ah < 1119178539 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :i thougth that was called boolfuck < 1119178549 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :calamari and me are trying to minimize the brainfuck instruction set without adding extra rules just by creating new instructions that can be build out of the old ones < 1119178555 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :boolfuck is different < 1119178559 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :ah yes < 1119178562 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :boolfuck is LE and has bit output < 1119178571 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :ok < 1119178596 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :good luck < 1119178710 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :anyways, i'll be back later. bye < 1119178713 0 :Keymaker!unknown@unknown.invalid QUIT :"I've seen this déjà vu before.." < 1119179673 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :jix: added the menu.. going to bed :) < 1119179687 0 :calamari!unknown@unknown.invalid QUIT :"<=K" < 1119179731 0 :kipple!~kipple@163.80-202-100.nextgentel.com JOIN :#esoteric < 1119179833 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :moin kipple < 1119179842 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :hi < 1119181914 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :morning < 1119182714 0 :J|x!jix@p5489EE67.dip.t-dialin.net JOIN :#esoteric < 1119182865 0 :jix!unknown@unknown.invalid QUIT :Nick collision from services. < 1119182868 0 :J|x!unknown@unknown.invalid NICK :jix < 1119183750 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :anyone know who runs the esoteric.sange.fi mailing list? < 1119183990 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :I don't know, but it might be the same guy that runs the brainfuck archive < 1119184015 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :do you know who that is? < 1119184025 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :Panu Kalliokoski, pkalliok@cs.helsinki.fi < 1119184029 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :http://esoteric.sange.fi/brainfuck/ < 1119184136 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :cheers kipple < 1119184564 0 :J|x!jix@p5489CDED.dip.t-dialin.net JOIN :#esoteric < 1119184681 0 :Keymaker!~a@wire74.adsl.netsonic.fi JOIN :#esoteric < 1119184718 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :'ello < 1119184749 0 :J|x!unknown@unknown.invalid PRIVMSG #esoteric :moin < 1119184756 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :afternoon < 1119184773 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric ::) < 1119185029 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :there is no new-line in morse code (the real, not the programming language), right? < 1119185072 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :yes < 1119185079 0 :tokigun!unknown@unknown.invalid QUIT :"Chatzilla 0.9.68.5 [Firefox 1.0.3/20050414]" < 1119185097 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :ok < 1119185229 0 :jix!unknown@unknown.invalid QUIT :Read error: 110 (Connection timed out) < 1119185321 0 :J|x!unknown@unknown.invalid NICK :jix < 1119185456 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :there are end of message and internal seperator codes < 1119185463 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :yeah < 1119185463 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :^ Keymaker: < 1119185467 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :yeah < 1119186966 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :I've been working on a project that may be of interest to the esolang community < 1119187033 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :it's a website that may or may not be useful < 1119187071 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :if you want to take a peek msg me privately and I'll give you the URL < 1119187089 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :but I don't want it public until I've got permission < 1119187119 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :I'd appreciate some comments if anyone is willing < 1119189514 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :ok < 1119192812 0 :Keymaker!unknown@unknown.invalid PART #esoteric :? < 1119193315 0 :tokigun!~tokigun@dor203183.kaist.ac.kr JOIN :#esoteric < 1119193341 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :hello < 1119193512 0 :Keymaker!~a@wire74.adsl.netsonic.fi JOIN :#esoteric < 1119193527 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :Keymaker: I've finished 99bob in whirl :) < 1119193559 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :(i have to optimize but it works) < 1119193581 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :woooooooaaaaaah < 1119193588 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :i can't believe my ears :D < 1119193596 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :that's really cool! < 1119193605 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :wait a minute :) < 1119193608 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :ok < 1119193618 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :i wonder what the guy that invented whirl will say about that.. < 1119193672 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :be sure to e-mail him it < 1119193849 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :Keymaker: http://zenith.sparcs.net/dev/99bottle.wr < 1119193881 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :woah < 1119193901 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :it weighs 20,332 instructions < 1119193915 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric ::) < 1119193932 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :amazing < 1119193945 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :it was generated by my own whirl assembler < 1119193947 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :it's a lot instructions smaller than some slarty's hello world < 1119193963 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :ok < 1119193979 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :slarty's hello world program gave me the idea about memory initialization < 1119196150 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :optimized 20,322 instructions -> 19,722 instructions < 1119196168 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :good < 1119196955 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :i've an idea for a new brainfuck dialect < 1119196963 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :cool! < 1119196973 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :2d < 1119196979 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :hm? < 1119196979 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :[|+|[ < 1119196980 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :|-] ] < 1119196987 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :is a programm that loops forever < 1119196988 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :it is 2d < 1119196992 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :ok < 1119197007 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :the program is equivalent to [-]+[] < 1119197012 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :in standard bf < 1119197017 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :yeah < 1119197096 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :the commands are: []+-<>,. |^%"$ and maybe (i'm unsure) macros < 1119197110 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric ::) < 1119197146 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :the dialect throws the symmetry out of window :) < 1119197170 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :hm? < 1119197199 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :well, i think brainfuck is very symmetric with [ ] and , . and + - and < > < 1119197202 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :19,162 instructions. hmm... < 1119197216 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :the dialect has instructions like | and ^ and so on < 1119197221 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :oops, 19,158 instructions. < 1119197237 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :| is a reverse-mode-stop < 1119197250 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :maybe i should add a reverse-mode-start < 1119197313 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :ok new instruction set: [] +- <> ,. !? ^v '. < 1119197320 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :urgh < 1119197329 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :'.' is used twice ^^ < 1119197332 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric ::) < 1119197343 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :that looks better < 1119197367 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :i need to symmetric characters for up and down < 1119197374 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :two < 1119197403 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :9 and 6? < 1119197409 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :hah < 1119197410 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :yes < 1119197415 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :[] +- <> ,. !? ^v 96 < 1119197457 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric ::) as we know, aesthetics is the most important thing in esolangs.. < 1119197458 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :and i need an exit character... @ < 1119197473 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :that seems good < 1119197517 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :!,[@ < 1119197517 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric : .] < 1119197519 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :is cat < 1119197561 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :i suggest you writing some specification of the instructions.. sometime < 1119197566 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :yes < 1119197580 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :but i've to do my homework :( < 1119197584 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric ::( < 1119197643 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :but it's only 3,5 weeks until summer holidays :) < 1119197650 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric ::) < 1119197682 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :ah... i have final exam tomorrow. oops :( < 1119197694 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric ::( < 1119197694 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :18,508 instructions. < 1119197702 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :nice work tokigun < 1119197917 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :i need a name for my dialect < 1119197952 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :hmm < 1119198112 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :YABAL < 1119198121 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :Yet Another Brainfuck A Like < 1119198127 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :that's good < 1119198177 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :argh homework... YABAL... homework.. YABAL... homework... URGH < 1119198181 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :yabal... < 1119198183 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :yaball... < 1119198195 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :18,294 instruction, anyway < 1119198201 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :good < 1119198215 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :going to get it below 10000? ;) < 1119198235 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :Keymaker: hmm... :p < 1119198240 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :hmm Yet Another Brainfuck A Like (Language?) .. YABAL..YABALL? < 1119198253 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :it looks like YA BALL < 1119198286 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :i'm going to write down the specs after the next 2 pages homework < 1119198298 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :ok < 1119199105 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :well, back to program in bf.. :) < 1119200241 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :i found 2 ways for converting bf->YABALL < 1119200251 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :the first produces polyglots < 1119200259 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :the 2nd YABALL only programs < 1119200278 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :the 2nd is more compact and more YABALL style code < 1119200339 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :hmm polyglots.. < 1119200348 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :that sounds like a neat way < 1119200677 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :i have a new nice cat ( and i'm still not done with homework 0o...) < 1119200683 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :!,[@ < 1119200684 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :!.]? < 1119201108 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :is 'fraction bar' this: _ < 1119201109 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :?? < 1119201124 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :_ is underscore < 1119201132 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :ah i see now < 1119201136 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :then what is fracion bar? < 1119201146 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :no idea < 1119201150 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :d'oh :( < 1119201212 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :the fraction bar is the line in a fraction but i don't think its an ascii character < 1119201246 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :hm < 1119201248 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :can be < 1119201250 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :maybe slash / < 1119201255 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :no.. < 1119201263 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :i'm reading morse code entry at wikipedia < 1119201271 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :and there is no picture of fraction bar < 1119201289 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :or well, with picture i mean ascii < 1119201539 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :but in ascii representation i use / for the fraction bar < 1119201559 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :eg: 1/2 1212/1231234 6/9 < 1119201587 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :yeah < 1119201611 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :but there is slash '/' that is -··-· < 1119201626 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :yes but there is no other ascii representation for a fraction bar < 1119201634 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :ah < 1119201641 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :i guess not, then < 1119201648 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :at least i'll ignore it if there is :) < 1119201667 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :jix: you mean slash and fraction bar look same but they are different letters? < 1119201735 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :no < 1119201747 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :hmm < 1119201756 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :in ascii there is just one / and no other character that is usefull for representing a fraction bar < 1119201783 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :i see.. < 1119201802 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :how about unicode? (bad joke) < 1119202598 0 :sp3tt!~chatzilla@cust-148-133.elhandel.umeaenergi.se JOIN :#esoteric < 1119202608 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :17,826 instructions. < 1119202624 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :cool < 1119202914 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :hmm i should add a cronjob for downloading the wiki database < 1119203261 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :hmmm, i got a new quine idea while writing another brainfuck program < 1119203266 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :better test the idea later < 1119204282 0 :tokigun!unknown@unknown.invalid QUIT :"quit" < 1119205378 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :is it normal that a wiki page is that slow? < 1119205834 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :HELLO WORLD!.... . .-.. .-.. --- .-- --- .-. .-.. -.. -.-.-- .-.-. < 1119205892 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :(there should be 7 spaces at one place, i hope this opera chat didn't trim them..) < 1119205901 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :(it at least don't show them) < 1119206850 0 :sp3tt_!~chatzilla@lite-148-133.umenet.net JOIN :#esoteric < 1119207422 0 :J|x!jix@p5489CDED.dip.t-dialin.net JOIN :#esoteric < 1119207456 0 :jix!unknown@unknown.invalid QUIT :Nick collision from services. < 1119207460 0 :J|x!unknown@unknown.invalid NICK :jix < 1119207695 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :done.. < 1119207697 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :http://www.bf-hacks.org/hacks/morse.b < 1119207706 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :read from http://www.bf-hacks.org/programs.html how to use it < 1119207707 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric ::) < 1119207751 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :it's surprisingly time-consuming to write that kind of program. the hardest part is to keep switching windows to look at wikipedia article etc.. < 1119207761 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :i hope wikipedia article has the right morse codes.. < 1119207766 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :anyways, gotta go. < 1119207767 0 :Keymaker!unknown@unknown.invalid PART #esoteric :? < 1119207964 0 :sp3tt!unknown@unknown.invalid QUIT :Read error: 110 (Connection timed out) < 1119208032 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :http://esolangs.org/wiki/YABALL specs done < 1119208633 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :anyone wants to write a YABALL interpreter for me? < 1119208792 0 :tokigun!~tokigun@dor203183.kaist.ac.kr JOIN :#esoteric < 1119208812 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :15,556 instructions < 1119208830 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :tokigun: http://esolangs.org/wiki/YABALL < 1119208839 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :@15,556 cool < 1119208844 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :;) < 1119209200 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :tokigun: do you want to write a YABALL interpreter for me < 1119209232 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :hmm i've to read spec before writing it < 1119209253 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :after final exam (22 june) ;) < 1119209261 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :(to 22 june) < 1119209299 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :hmm i thought in the next.. say 2 hours ;) < 1119209305 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :;) < 1119209317 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :http://zenith.sparcs.net/dev/99bottle.wr < 1119209357 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :it's time to go public? < 1119209384 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :no idea < 1119209389 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :i like the wave pattern at the end < 1119209394 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :;) < 1119209426 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :i'm considering c(or whatever)-whirl polyglot < 1119209479 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :c-brainfuck-ruby < 1119209497 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :uh whirl-bf-ruby < 1119209507 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :ruby... i know it but cannot use very well. < 1119209519 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :whirl-bf-YABALL < 1119209524 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :cannot -> don't < 1119209526 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :oh! < 1119209539 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :if you give me bf code i can convert it to a bf-YABALL polyglot < 1119209545 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :;) < 1119209568 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :and you can fill any spaces in the code with 1s and 0s < 1119209748 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :i'm done with homework! < 1119209764 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :i just have to put it together and print it < 1119209769 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :yay! < 1119211148 0 :sp3tt__!~chatzilla@cust-148-133.elhandel.umeaenergi.se JOIN :#esoteric < 1119211185 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :jix: the YABALL article doesn't list the , and . operators < 1119211195 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :aren't they used? < 1119211222 0 :sp3tt__!unknown@unknown.invalid NICK :sp3tt < 1119211320 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :urgh < 1119211331 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :the cat example uses them, and also a @ operator which isn't mentioned < 1119211342 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :hehe < 1119211352 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :homework+specwriting doesn't work < 1119211362 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :i should scan my homework for the @ operator ;) < 1119211472 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :fixed < 1119211642 0 :sp3tt_!unknown@unknown.invalid QUIT :Read error: 145 (Connection timed out) < 1119211699 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :kipple: any comments about YABALL < 1119211724 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :looks nice, but too close to BF for my taste < 1119211785 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :its hard not getting to close to any other language < 1119211791 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :too < 1119211937 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :the concept of different modes is interesting. that's pretty original I think < 1119212123 0 :sp3tt__!~chatzilla@lite-148-133.umenet.net JOIN :#esoteric < 1119212153 0 :sp3tt!unknown@unknown.invalid QUIT :Nick collision from services. < 1119212165 0 :sp3tt__!unknown@unknown.invalid NICK :sp3tt < 1119212168 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :I don't understand the cat example: when the [ moves the IP down, why doesn't the ] cause it to go right back up again, causing an endless loop? < 1119212205 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :because it's in normal mode and moves right after moving down < 1119212241 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :ah, I see < 1119212264 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :guess I'm thinking befunge < 1119212305 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :my first esolang was a vary simple fungoid < 1119212389 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :are the cells signed or wrapping? < 1119212407 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :signed or unsigned makes no difference < 1119212411 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :but they are wrapping < 1119212481 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :well, signed makes a difference if you try to output a negative number... at least it doesn't say anything about that < 1119212507 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :ok they are unsigned < 1119212532 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :" Values less than 32768 are reserved for future extensions" < 1119212546 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :do you mean _more_? < 1119212563 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :more? < 1119212582 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :greater I mean < 1119212626 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :0-255 stdout 256-511 stderr 512 close stdout 513 close stderr 514-32767 reserved 32768-?? custom < 1119212632 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :or is it Values >513 and < 32768? < 1119212642 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :ah yes < 1119212676 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :0-255 are also less than 32768, so you might want to be more precise ;) < 1119212693 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :feel free to clean that part up.. it's a wiki < 1119212721 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :ok, if you aren't editing it now... < 1119213006 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :1107 bytes already... bloody bloatware! {^Raven^}, i'm not sure whether to thank you or to curse you for bringing that contest to my attention < 1119213028 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :what contest? < 1119213036 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :golfing? < 1119213045 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :i want to golf! < 1119213062 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :ACTION hands jix a driver < 1119213090 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :jix: http://www.geocities.com/dunric/advcomp.html < 1119213177 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :hmmh < 1119213181 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :my english isn't that good < 1119213227 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :a german text adventure.. would be a lot easier for me (even tho the german grammar is horrible) < 1119213275 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :well, engrish has its charms too :) Just think of Zero Wing < 1119213322 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :zero wing? < 1119213344 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :"All your base are belong to us!" < 1119213348 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :ah ^^ < 1119213367 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :someone set us up the bomb... < 1119213378 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :what happen? < 1119213405 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :may i use other platforms than those on the page? < 1119213428 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :jix: you'd have to ask the person holding the contest < 1119213455 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :i < 1119213455 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :i'm thinking of a COSMAC ELF II < 1119213463 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :heh. < 1119213479 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :well, if there's a free emulator... there's always a chance < 1119213482 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :with a 1802 cpu < 1119213500 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :http://www.tinyelf.com/ is for mac os x < 1119213578 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :away < 1119213928 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :that's an interesting contest. though the rules are a bit confusing... < 1119214079 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :yeah < 1119214104 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :i wonder how much abuse they'll be subject to. < 1119214152 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :is linux an allowed platform? < 1119214199 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :I guess they'll have to be lenient with the rules < 1119214490 0 :sp3tt!unknown@unknown.invalid QUIT :"Chatzilla 0.9.68a [Firefox 1.0.4/20050511]" < 1119215283 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :i am assuming that *any* programming language is acceptable < 1119215297 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :as long as...etc < 1119215358 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :cpressey: I'm still on paper < 1119215549 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :cpressey: I'm going to max mine out at 2,899 bytes. I wish the organiser would decide on a definate limit with no leeway < 1119215649 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :*definite - bah < 1119215868 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :it says that the listed platforms include what is allowed but doesn't state the competition is limited to them only < 1119216235 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :in what languages are your adventures? < 1119216317 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :i've finished 99 bottles of beer in whirl: http://page.tokigun.net/obfuscation/file/99bottle.wr < 1119216352 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :tokigun: yay < 1119216369 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :for this I am using BBC BASIC, was tempted to use 6502 but BASIC is more efficient < 1119216414 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :maybe i'm going to use ti-89/92(+)/v200 basic < 1119216424 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :or chipmunk basic < 1119217073 0 :Keymaker!~a@wire74.adsl.netsonic.fi JOIN :#esoteric < 1119217085 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :'ello < 1119217092 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :tokigun: good job! < 1119217120 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :;) < 1119217147 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :i'm writing a letter to author... < 1119217154 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :cool < 1119218018 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :cpressey: what programming language are you using? < 1119218279 0 :calamari!~calamari@dialup-4.240.114.196.Dial1.Phoenix1.Level3.net JOIN :#esoteric < 1119218363 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :hi calamari < 1119218418 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :Keymaker: http://sparcs.kaist.ac.kr/~tokigun/dev/whirl99bob.txt < 1119218420 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :moin calamari < 1119218431 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :my Whirl assembler script ;) < 1119218436 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :hello calamari < 1119218438 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :wow < 1119218447 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :it is just a script.. but it helps me a lot < 1119218458 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :yeah.. confuses me a lot < 1119218558 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :so, that's the code you feed for your whirl assembler and it generates the 01 stuff? < 1119218563 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :yes < 1119218582 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :ok. btw, is the assembler available? < 1119218598 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :this script is assembler < 1119218615 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :oooh < 1119218618 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :main function is whirlasm, whirlasmtable. < 1119218653 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :first it assembles the given code, using whirlasm() < 1119218654 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :hey, is that python? < 1119218656 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :yes < 1119218659 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :ah < 1119218703 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :then it generates table that program uses, using whirltable() < 1119218710 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :yes < 1119218726 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :hi key, jix & toki :) < 1119218729 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :table is translated to whirl psuedo-code, using whirlasmtable(). < 1119218731 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :calamari: hello ;) < 1119218743 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :toki... in Korean it means "rabbit". ;) < 1119218755 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric ::) < 1119218758 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :anyway... < 1119218778 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :program psuedo-code and table psuedo-code is combined, < 1119218794 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :and assembled again using whirlasm. < 1119218799 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :be vewwy vewwy quiet.. I'm hunting wabbits! < 1119218800 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :ok < 1119218806 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :so, the assembler could be used for any other program as well, when changing stuff inside p = r""" .... """ to some other..? < 1119218849 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :Keymaker: yes, but there are many restrictions. < 1119218857 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :ok < 1119218880 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :jix: assembly language < 1119218900 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :currently my assembler cannot preserve ring state... i.e. selected ring, selected instruction of each ring, direction of each ring. < 1119218913 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :rabbit gun? < 1119218953 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :cpressey: for what cpu/computer? < 1119218958 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :lament: hmm < 1119219001 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :lament: "-gun" is suffix in Korean/Japanese... < 1119219020 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :it has some nuance... eh... i don't know how to explain it. :S < 1119219060 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :Keymaker: so i have to arrange ring state manually... /0, /1, !blah/blah command is used for this reason. < 1119219071 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :jix: 286/MS-DOS 2.0 < 1119219071 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :ok < 1119219098 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :maybe some 386 instructions if i get lazy :) < 1119219109 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :cool, that script was written tomorrow :) < 1119219145 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :calamari: what script? :) < 1119219159 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :whirl99bob.txt < 1119219167 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :ah ;) < 1119219184 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :it is 6:13 am Monday here. < 1119219195 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric ::) < 1119219205 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :early riser < 1119219221 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :i don't think he has even gone sleepin' < 1119219240 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :Keymaker: gave him the benefit of the doubt :) < 1119219254 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric ::) < 1119219258 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :i have exam in 9:00 am, 11:00 am... so i didn't get to sleep ;) < 1119219276 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :heh < 1119219346 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :I stayed up way too late last night working on that java gui.. barely made it to church this morning < 1119219378 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric ::) < 1119219826 0 :jix!unknown@unknown.invalid QUIT :"Banned from network" < 1119221938 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :yes! i'm at 1011 instructions now.. < 1119221939 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :http://bf-hacks.org/hacks/quine.b < 1119221964 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :i hope to break the 1000 limit soon (although not tonight) < 1119222070 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :good luck ;) < 1119222092 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :cheers < 1119222580 0 :puzzlet!unknown@unknown.invalid PRIVMSG #esoteric :wow, bf quine < 1119222610 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :heh, my first weights 7000+ instructions < 1119222636 0 :puzzlet!unknown@unknown.invalid PRIVMSG #esoteric :My quine written in Aheui - http://puzzlet.org/puzzlet/%EC%95%84%ED%9D%AC~%EC%BD%B0%EC%9D%B8 < 1119222646 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :i've gotten ideas randomly, like for example doing something and then "hey, i could try that trick" and so on :) < 1119222660 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :wow < 1119222664 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :looks cool :) < 1119222684 0 :puzzlet!unknown@unknown.invalid PRIVMSG #esoteric :and sounds crazy in Korean < 1119222691 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :heh < 1119222739 0 :puzzlet!unknown@unknown.invalid PRIVMSG #esoteric :by the way how you get ideas while doing some other things? < 1119222751 0 :puzzlet!unknown@unknown.invalid PRIVMSG #esoteric :you must be multi-threaded < 1119222751 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :well, dunno < 1119222754 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :hehe < 1119222786 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :that just happens. i'm doing something non-brainfuck related and then i get some idea i could try :) < 1119222806 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :can be that the language has modified my brains.. < 1119222921 0 :puzzlet!unknown@unknown.invalid PRIVMSG #esoteric :probably. < 1119222976 0 :puzzlet!unknown@unknown.invalid PRIVMSG #esoteric :i sometimes feel funge iterator points wander around in my brain < 1119222990 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :heh < 1119222995 0 :puzzlet!unknown@unknown.invalid PRIVMSG #esoteric :or aren't they instruction pointers? < 1119223007 0 :puzzlet!unknown@unknown.invalid PRIVMSG #esoteric :forgot what IP stands for < 1119223020 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :not sure < 1119223102 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :instruction pointer seems correct < 1119223340 0 :heatsink!~heatsink@c-24-61-94-111.hsd1.nh.comcast.net JOIN :#esoteric < 1119223361 0 :heatsink!unknown@unknown.invalid PRIVMSG #esoteric :cool mumbai is spelled correctly < 1119223388 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :what is that stuff? < 1119223416 0 :heatsink!unknown@unknown.invalid PRIVMSG #esoteric :? < 1119223466 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :that package from mumbai < 1119223480 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :i don't get the line in topic.. < 1119223497 0 :heatsink!unknown@unknown.invalid PRIVMSG #esoteric :no se. < 1119223578 0 :puzzlet!unknown@unknown.invalid PRIVMSG #esoteric :nose. < 1119224996 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :oh no.. i have dentist time today, in ~10 hours < 1119225006 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric ::( grrrrrrh < 1119225017 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :well, good nite < 1119225020 0 :Keymaker!unknown@unknown.invalid PART #esoteric :? < 1119227230 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :bbiaw.. phone < 1119227235 0 :calamari!unknown@unknown.invalid QUIT :"Leaving" < 1119229464 0 :graue!~graue@ip68-100-130-21.dc.dc.cox.net JOIN :#esoteric < 1119229489 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :anyone written a quine in Qdeql yet? < 1119229686 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :my guess: no ;) < 1119229938 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :kipple, what have you been up to? < 1119229967 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :not too much :) < 1119229979 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :currently I'm pondering about the next Kipple version < 1119230020 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :Kipple07? < 1119230034 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :hehe. no 05 < 1119230041 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :that should be done by now < 1119230042 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :hurry up with it < 1119230055 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :what's the rush? < 1119230061 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :oh, I was just jesting < 1119230071 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :actually I like kipple so much fundamentally that I've been thinking about the possibility of making a non-esoteric language resembling it < 1119230083 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :really? < 1119230087 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :yeah, it's cool having stacks built in like that < 1119230290 0 :calamari!~calamari@dialup-4.240.69.32.Dial1.Phoenix1.Level3.net JOIN :#esoteric < 1119230293 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :hi < 1119230309 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :hi < 1119230328 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :hello < 1119230363 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :hi graue, kipple < 1119230383 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :that reminds me, I need to set up a cron job for that download :) < 1119230441 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :you need to write a quine in Qdeql < 1119230466 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :and it needs to be more than 0 bytes long < 1119230488 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :I wonder if there can be a tc language for which there is no quine < 1119230518 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :ah, that reminds me to forbid null programs in the Kipple spec :) < 1119230537 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :calamari: that is an interesting question! < 1119230957 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :graue: is & the only way to enqueue a byte in qdeql? < 1119231006 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :oh.. nm, I see it in \ < 1119231076 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :wait though.. when starting off there is nothing in the queue, so how do you get started besides input? < 1119231142 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :unless you start off with a single item in the queue.. then you could do -\ < 1119232124 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :\ reads 0 if the queue is empty < 1119232130 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :same as anything that reads from the queue < 1119232152 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :(that also means you can get a 0 byte by doing = to an empty queue, or get a 255 byte by doing - to an empty queue) < 1119232179 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :\ and & are the only ways to enqueue something when starting from a nonempty queue < 1119232197 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :of course there can be a TC language with no quine < 1119232201 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :Turing machines can't do output < 1119232209 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :there isn't a qdeql article in the wiki. do you have a link to the spec? < 1119232211 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :Smallfuck is a TC language with no quine < 1119232214 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :www.oceanbase.org/graue/qdeql < 1119232247 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :ACTION bookmarks it this time < 1119232287 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :if the queue is empy, how can you dequeue.. isn't that an error? < 1119232316 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :no, it returns 0 < 1119232320 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :oh, I see it in the spec now :) < 1119233403 0 :kipple_!~kipple@163.80-202-100.nextgentel.com JOIN :#esoteric < 1119233403 0 :kipple!unknown@unknown.invalid QUIT :Read error: 131 (Connection reset by peer) < 1119233718 0 :heatsink!unknown@unknown.invalid PRIVMSG #esoteric :calamari: turing proved that any TC language has a quine < 1119233836 0 :kipple_!unknown@unknown.invalid QUIT :"See you later" < 1119234063 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :heatsink, um, that's not true < 1119234067 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :it cannot be < 1119234076 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :TC languages are not obligated to provide any form of output < 1119234094 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :and you can't just say "any TC language with output" because what if it can't output all of the characters used in its source? < 1119234120 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :what if it throws a "This programming language is (C) 1999 ME! All rights reserved" message into the beginning of the output and using that is invalid? < 1119234134 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :you would need a totally different definition than "TC language" in order to provide anything meaningful like that < 1119234946 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :graue: if it throws that into the beginning of output it's okay, because the quine when run will automatically output that too < 1119234959 0 :heatsink!unknown@unknown.invalid PRIVMSG #esoteric :I'm pretty sure that the only output of a turing computer is what that computer writes on the tape (which is also its input) < 1119234997 0 :heatsink!unknown@unknown.invalid PRIVMSG #esoteric :So any program that has the same contents of the tape when it halts is a turing machine quine. < 1119234999 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :graue: oh wait.. yeah :) < 1119235017 0 :heatsink!unknown@unknown.invalid PRIVMSG #esoteric :That is different from having a separate I/O channel, I guess < 1119235032 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :graue: so I think that's pretty good evidence against quines :) < 1119235045 0 :heatsink!unknown@unknown.invalid PRIVMSG #esoteric :http://www.cs.cornell.edu/Courses/cs682/2004sp/Lectures/l34-recthm.pdf first page talks about the relation of quines to the fixpoint operator < 1119236047 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :since a UTM has to have a description of a TM on its tape when it starts... seems dreadfully easy to make a quine ;) < 1119236079 0 :heatsink!unknown@unknown.invalid PRIVMSG #esoteric :heh < 1119236625 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :bbl < 1119236627 0 :calamari!unknown@unknown.invalid QUIT :"Leaving" < 1119237601 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :heatsink, for the memory to be the code when the program finishes is not possible in many Turing-complete languages < 1119237613 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :the memory may not be a sequence of bytes (like code usually is) < 1119237679 0 :heatsink!unknown@unknown.invalid PRIVMSG #esoteric :that makes sense. < 1119242513 0 :GregorR!unknown@unknown.invalid QUIT :Remote closed the connection < 1119243928 0 :heatsink!unknown@unknown.invalid QUIT :"Leaving" < 1119247569 0 :graue!unknown@unknown.invalid PART #esoteric :? < 1119248661 0 :tokigun!unknown@unknown.invalid QUIT :Read error: 110 (Connection timed out) < 1119249618 0 :tokigun!~tokigun@dor204226.kaist.ac.kr JOIN :#esoteric < 1119254399 0 :clog!unknown@unknown.invalid QUIT :ended < 1119254400 0 :clog!unknown@unknown.invalid JOIN :#esoteric < 1119270024 0 :tokigun!unknown@unknown.invalid QUIT :"Chatzilla 0.9.68.5 [Firefox 1.0.3/20050414]" < 1119273812 0 :jix!jix@p5489BD9C.dip.t-dialin.net JOIN :#esoteric < 1119274517 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :moin < 1119275118 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :! < 1119276175 0 :tokigun!~tokigun@dor204226.kaist.ac.kr JOIN :#esoteric < 1119276520 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :moin tokigun < 1119276561 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :away < 1119276618 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :hello < 1119280608 0 :kipple!~kipple@163.80-202-100.nextgentel.com JOIN :#esoteric < 1119287159 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :back < 1119288014 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :i'm writing a YABALL interpreter atm < 1119288252 0 :tokigun!unknown@unknown.invalid QUIT :"Chatzilla 0.9.68.5 [Firefox 1.0.3/20050414]" < 1119290913 0 :Keymaker!~a@wire74.adsl.netsonic.fi JOIN :#esoteric < 1119290926 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :'elgooggro < 1119291342 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :YABALL interpreter done < 1119291642 0 :azurespace!azurespace@219.251.173.198 JOIN :#esoteric < 1119291652 0 :azurespace!unknown@unknown.invalid PART #esoteric :? < 1119291780 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :underflow..grrr < 1119292585 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :found the bug.. < 1119292621 0 :tokigun!~tokigun@dor204226.kaist.ac.kr JOIN :#esoteric < 1119294849 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :yeaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaah!!!! < 1119294858 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :i got the quine under 1000 instructions < 1119294859 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :http://bf-hacks.org/hacks/quine.b < 1119294864 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :933 instructions < 1119294869 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :neat < 1119294870 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :the previous version was 1011 < 1119294873 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :thanks < 1119294901 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :so, neatly 78 instructions less :) < 1119294970 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :my goal was to get a quine under 1000 instructions, and i finally succeeded. now i don't write bf quines for a while, i'll do other kind of programs :) < 1119295104 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :(in bf, of course) < 1119295109 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :anyways, must go. < 1119295111 0 :Keymaker!unknown@unknown.invalid PART #esoteric :? < 1119296188 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :ok YABALL interpreter is linked on the wiki < 1119296650 0 :GregorR!~GregorR@c-24-21-138-66.hsd1.or.comcast.net JOIN :#esoteric < 1119296682 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :I need a good dictionary of words related to esoteric programming to use for my scrabble clone :P < 1119297199 0 :CXI!unknown@unknown.invalid QUIT :Read error: 104 (Connection reset by peer) < 1119297246 0 :CXI!Sanity@dialup-130.89.221.203.acc50-kent-syd.comindico.com.au JOIN :#esoteric < 1119298480 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :an entire dictionary? good luck... (the wiki is a good starting place) < 1119298505 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :are language names acceptable? < 1119299194 0 :J|x!jix@p5489BD9C.dip.t-dialin.net JOIN :#esoteric < 1119299268 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :kipple: technichally no because they are proper nouns but you could make an exception < 1119299304 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :yes, I know the normal rules < 1119299374 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :but an esoteric scrabble that does not allow words like brainfuck or funge? I'd say allow it < 1119299402 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :definatekly < 1119299919 0 :jix!unknown@unknown.invalid QUIT :Read error: 110 (Connection timed out) < 1119300679 0 :graue!~graue@ip68-100-130-21.dc.dc.cox.net JOIN :#esoteric < 1119301575 0 :J|x!unknown@unknown.invalid NICK :jix < 1119301797 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :My fault. The word "dictionary" is inaccurate here. < 1119301801 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :I really just mean "word list" < 1119301813 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :Hell, doesn't even have to be words. < 1119301905 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :I'm just trying to think of some bizarre dictionaries for my bizarre scrabble clone. Currently the only one I have is the libc symbol list :) < 1119301950 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :I tried to play as "Himself" in one of your games, but I couldn't come up with anything that would fit < 1119302104 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :so just copy all the language names and make a wordlist out of those, and related terms < 1119302118 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :funge, quine, stack, queue, cell, turing, etc < 1119302155 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :how about TMMLPTEALPAITAFNFAL with triple word score? < 1119302169 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :it's longer than 15 letters, so it can't be done :( < 1119302228 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :My board uses 20 letters. < 1119302235 0 :csaba!csaba@P-6.182.EUnet.yu JOIN :#esoteric < 1119302253 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :great then < 1119302254 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :The problem is, my libc symbol dictionary has 2,800 something words, and it's really, REALLY tough. < 1119302260 0 :csaba!unknown@unknown.invalid PRIVMSG #esoteric :Hi, I've finished writing a visual Turing machine designer. If you're interested check it out: an be done? < 1119302260 0 :csaba!unknown@unknown.invalid PRIVMSG #esoteric :[21:40] hmm maybe firefox will do < 1119302263 0 :csaba!unknown@unknown.invalid PRIVMSG #esoteric :an be done? < 1119302264 0 :csaba!unknown@unknown.invalid PRIVMSG #esoteric :[21:40] hmm maybe firefox will do < 1119302283 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :Didn't have the copy buffer you thought you did? :) < 1119302284 0 :csaba!unknown@unknown.invalid PRIVMSG #esoteric :http://sourceforge.net/projects/visualturing/ < 1119302285 0 :csaba!unknown@unknown.invalid PRIVMSG #esoteric :I'm interested in what you think < 1119302290 0 :csaba!unknown@unknown.invalid PRIVMSG #esoteric :yeah < 1119302310 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :GregorR, libc has a lot of repetition < 1119302333 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :e.g. the fact that you can make all of vsprintf, vprintf, vsnprintf, snprintf, sprintf, printf, and fprintf, doesn't help much < 1119302346 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :Even so, the list of languages and common elements in esoteric languages would be well under 1000, probably under 500. < 1119302359 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :"quine," "cell," and "turing" are easy < 1119302377 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :don't make me write this wordlist for you < 1119302381 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :lol < 1119302393 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :I'll look in to it when not at work ;) < 1119302415 0 :csaba!unknown@unknown.invalid PRIVMSG #esoteric :Turing machine is considered esoteric language? < 1119302435 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :no, but we like to prove that esoteric languages are equivalent to Turing machines < 1119302443 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :because that means they can compute lots of stuff < 1119302446 0 :csaba!unknown@unknown.invalid PRIVMSG #esoteric :ah < 1119302474 0 :csaba!unknown@unknown.invalid PRIVMSG #esoteric :so basically it's propaganda to fool people into using esoteric languages? :) < 1119302525 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :uh, no. It's for proving the usefulness of the language < 1119302546 0 :csaba!unknown@unknown.invalid PRIVMSG #esoteric :anyone used brainfuck? < 1119302560 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :ha! < 1119302578 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :anyone not used brainfuck here? < 1119302591 0 :csaba!unknown@unknown.invalid PRIVMSG #esoteric :I've downloaded an interpreter and now I've showing it to everyone to see what kind of people exist < 1119302601 0 :csaba!unknown@unknown.invalid PRIVMSG #esoteric :they're like omg < 1119302604 0 :csaba!unknown@unknown.invalid PRIVMSG #esoteric :lol < 1119302610 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :turing machines are very much like an esoteric language < 1119302619 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :they're about as hard to write programs for as brainfuck. < 1119302628 0 :csaba!unknown@unknown.invalid PRIVMSG #esoteric :check out my program: < 1119302628 0 :csaba!unknown@unknown.invalid PRIVMSG #esoteric :[22:20] "quine," "cell," and "turing" are easy < 1119302628 0 :csaba!unknown@unknown.invalid PRIVMSG #esoteric :[22:20] don't make me write this wordlist for you < 1119302632 0 :csaba!unknown@unknown.invalid PRIVMSG #esoteric :damn < 1119302637 0 :csaba!unknown@unknown.invalid PRIVMSG #esoteric :http://sourceforge.net/projects/visualturing/ < 1119302654 0 :csaba!unknown@unknown.invalid PRIVMSG #esoteric :I designed a machine which calculates factoriel in less than 5 minutes < 1119302661 0 :malaprop_!~ph@ppp-68-251-76-97.dsl.chcgil.ameritech.net JOIN :#esoteric < 1119302977 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :that's cool < 1119302983 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :wait, a factorial of what? < 1119303010 0 :csaba!unknown@unknown.invalid PRIVMSG #esoteric :well, 5! is |||||| and you'd get 125+1 lines in the end ;) < 1119303022 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :i see < 1119303056 0 :csaba!unknown@unknown.invalid PRIVMSG #esoteric :it's cute to look at the machine head going left and right, doing stuff etc... < 1119303082 0 :malaprop!unknown@unknown.invalid QUIT :Read error: 110 (Connection timed out) < 1119303113 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :csaba: the factorial of 5 is 120 < 1119303118 0 :csaba!unknown@unknown.invalid PRIVMSG #esoteric :oops < 1119303134 0 :csaba!unknown@unknown.invalid PRIVMSG #esoteric :I'm really tired, I haven't slept normally for 3 days < 1119303328 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :it is cool that you made this < 1119303372 0 :csaba!unknown@unknown.invalid PRIVMSG #esoteric :does it run at yourplace? I'm worried that because it's written in Java people might have problems in starting it < 1119303489 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :I don't have java < 1119304142 0 :lindi-!unknown@unknown.invalid PRIVMSG #esoteric :csaba: just create a native binary and people can run it just like any other program < 1119304211 0 :csaba!unknown@unknown.invalid PRIVMSG #esoteric :I've placed a start.exe which runs the "java -jar Turing.jar" command... it should work if JVM is installed... < 1119304260 0 :lindi-!unknown@unknown.invalid PRIVMSG #esoteric :csaba: yeah, but you can make it turing.exe with GCC < 1119304317 0 :csaba!unknown@unknown.invalid PRIVMSG #esoteric :well ok, I'll make an exe... < 1119304395 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :Doesn't it use swing? Is there a swing for GCJ? < 1119304407 0 :lindi-!unknown@unknown.invalid PRIVMSG #esoteric :GregorR: yep < 1119304486 0 :lindi-!unknown@unknown.invalid PRIVMSG #esoteric :GregorR: and it's improving at a steady pace < 1119304625 0 :lindi-!unknown@unknown.invalid PRIVMSG #esoteric :although it seems to have some issues... < 1119305270 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :csaba: always use the name of the containing folder for a zip/tgz file.. it's a lot easier to find the folder that way.. < 1119305355 0 :csaba!unknown@unknown.invalid PRIVMSG #esoteric :jix: rename the zip file to Turing.zip ? < 1119305368 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :i can't guess the name of the folder < 1119305406 0 :csaba!unknown@unknown.invalid PRIVMSG #esoteric :ok I'll keep that in mind < 1119305411 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :but i like sticking the archive and folder together in a sorted list.. < 1119305483 0 :csaba!unknown@unknown.invalid PRIVMSG #esoteric :well I was just happy I finished the damn thing, I haven't slept normally for 3 days because of it... didn't think about how to name the zip file ;) < 1119305507 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :hehehe < 1119305594 0 :csaba!unknown@unknown.invalid PRIVMSG #esoteric :ok, I'll compile an exe file tomorrow... might as well add a readme.txt... now I'm going to bed... < 1119305612 0 :csaba!unknown@unknown.invalid QUIT :" HydraIRC -> http://www.hydrairc.com <- IRC for those that like to be different" < 1119306671 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :g'nite < 1119306685 0 :jix!unknown@unknown.invalid QUIT :"Banned from network" < 1119313810 0 :heatsink!~heatsink@c-24-61-94-111.hsd1.nh.comcast.net JOIN :#esoteric < 1119314652 0 :tokigun!unknown@unknown.invalid NICK :tokigun^away < 1119314652 0 :kipple!unknown@unknown.invalid QUIT :Read error: 104 (Connection reset by peer) < 1119314962 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :ACTION has spent the last 4 hours fighting off DoS attacks < 1119315172 0 :heatsink!unknown@unknown.invalid PRIVMSG #esoteric :are they still there? < 1119315203 0 :heatsink!unknown@unknown.invalid PRIVMSG #esoteric :or have they abated < 1119315231 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :i have blocked the attacks, but am leaving the server off overnight < 1119315289 0 :heatsink!unknown@unknown.invalid PRIVMSG #esoteric :good work < 1119315291 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :one was from the US and one from Bucarest < 1119315328 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :two seperate incidents in 8 hours and completely unrelated to boot < 1119315385 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :one attacker has given up and the other one should soon < 1119315428 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :but it's ruining things for everybody < 1119315457 0 :heatsink!unknown@unknown.invalid PRIVMSG #esoteric :Are they using much of your bandwidth? < 1119315477 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :every last scrap < 1119315486 0 :heatsink!unknown@unknown.invalid PRIVMSG #esoteric :ouch. < 1119315494 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :just enough for a really slow ssh to the server < 1119315501 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :*left < 1119315558 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :I've had to take 8 domains and 20 sites offline and severely knacker another < 1119315585 0 :heatsink!unknown@unknown.invalid PRIVMSG #esoteric :Is there anyone upstream who can filter packets? < 1119315668 0 :heatsink!unknown@unknown.invalid PRIVMSG #esoteric :ACTION looks up "knacker" in the dictionary < 1119315681 0 :kipple!~kipple@163.80-202-100.nextgentel.com JOIN :#esoteric < 1119315682 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :There's no need to do that as I can block the attacking hosts < 1119315715 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :But everyone is being reported < 1119315810 0 :heatsink!unknown@unknown.invalid PRIVMSG #esoteric :1 [British]: a buyer of worn-out domestic animals or their carcasses for use especially as animal food or fertilizer < 1119315810 0 :heatsink!unknown@unknown.invalid PRIVMSG #esoteric :2 [British]: a buyer of old structures for their constituent materials < 1119315810 0 :heatsink!unknown@unknown.invalid PRIVMSG #esoteric :I didn't know there was an authority to report DOSes to. < 1119315830 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :knacker (usu) = someone who buys up old horses for slaughter < 1119315861 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :there isn't, you just report them to their ISP < 1119315870 0 :heatsink!unknown@unknown.invalid PRIVMSG #esoteric :ok < 1119315934 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :if it was a distributed denial of service attack i might need to get my ISP to filter packets aswell but no need this time < 1119316891 0 :malaprop_!unknown@unknown.invalid QUIT :Read error: 145 (Connection timed out) < 1119317551 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :sweet... first attacker has been told off and is now offline and their ISP has aplogised profusely :D < 1119317629 0 :heatsink!unknown@unknown.invalid PRIVMSG #esoteric :awesome! Powa brutha! (or sistah!) < 1119317654 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :ACTION checks... < 1119317665 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :definately male < 1119317714 0 :heatsink!unknown@unknown.invalid PRIVMSG #esoteric :Hmm... I don't usually need to check... < 1119317728 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :i *love* it when I win < 1119317750 0 :heatsink!unknown@unknown.invalid PRIVMSG #esoteric ::) < 1119317806 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :ACTION has booby traps on some of his sites which automatically report certain types of abuse < 1119317827 0 :heatsink!unknown@unknown.invalid PRIVMSG #esoteric :you get this often I guess < 1119317837 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :no just twice today < 1119317853 0 :heatsink!unknown@unknown.invalid PRIVMSG #esoteric :Have you tested the boobytraps? < 1119317887 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :I can't test them, I might end up getting my own net access blocked < 1119317925 0 :heatsink!unknown@unknown.invalid PRIVMSG #esoteric :ACTION looks away < 1119317926 0 :heatsink!unknown@unknown.invalid PRIVMSG #esoteric :yeah... < 1119317928 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :but the occasional email from ISP abuse departments tells me that they work fine < 1119318025 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :there's no way that legit people can accidentally trip them, they just get the bad guys < 1119318089 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :what really sucks is that I know that a lot of ISPs and other service providers do nothing about abuse originating from their networks < 1119318311 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :anyways, I'm off to bed < 1119318315 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :nite all < 1119318405 0 :heatsink!unknown@unknown.invalid PRIVMSG #esoteric :goondight raven < 1119319382 0 :kipple!unknown@unknown.invalid PART #esoteric :? < 1119319674 0 :malaprop!~ph@ppp-68-251-68-78.dsl.chcgil.ameritech.net JOIN :#esoteric < 1119319729 0 :kipple!~kipple@163.80-202-100.nextgentel.com JOIN :#esoteric < 1119323506 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :http://grables.sourceforge.net/libc.php?view=0 < look at this awesome game. < 1119323509 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :I played liblongjmp < 1119323513 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :Err, siglongjmp. < 1119323526 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :I cannot believe that fate handed me siglongjmp!!! How friggin' lucky am I?! < 1119323845 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :hehe < 1119323857 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :cool scrabble variant! < 1119323889 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :Thanks ^_^ < 1119323915 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :Because the dictionary is so small, I had to give 30 tiles instead of 7 XD < 1119323919 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :And it's still tough. < 1119324157 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :I'm not very familiar with libc, but an esoteric themed version would be great! (if you can find enough words) < 1119324169 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :That's the problem. < 1119324175 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :I was discussing that here before. < 1119324182 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :I know < 1119324187 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :libc has 2,800+, and it's incredibly difficult. < 1119324484 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :Oooooooooooooooooooooh < 1119324485 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :I know. < 1119324499 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :How about I just download the logs from #esoteric, and any word in there goes XD < 1119324765 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :haha < 1119324809 0 :kipple!unknown@unknown.invalid PRIVMSG #esoteric :anyway. gotta go to bed. I'm leaving town for a couple of weeks tomorrow, so see you all later < 1119325010 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :Bye < 1119325194 0 :kipple!unknown@unknown.invalid PART #esoteric :? < 1119328482 0 :tokigun^away!unknown@unknown.invalid NICK :tokigun < 1119330445 0 :heatsink!unknown@unknown.invalid QUIT :"Leaving" < 1119335648 0 :calamari!~calamari@dialup-4.240.69.176.Dial1.Phoenix1.Level3.net JOIN :#esoteric < 1119335685 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :hi < 1119335861 0 :malaprop_!~ph@ppp-68-251-66-184.dsl.chcgil.ameritech.net JOIN :#esoteric < 1119335903 0 :malaprop!unknown@unknown.invalid QUIT :Read error: 104 (Connection reset by peer) < 1119336632 0 :wooby!~wooby@ny-lancastercadent4g1-3a-236.buf.adelphia.net JOIN :#esoteric < 1119336920 0 :tokigun!unknown@unknown.invalid QUIT :Read error: 104 (Connection reset by peer) < 1119336923 0 :tokigun_!~tokigun@dor204226.kaist.ac.kr JOIN :#esoteric < 1119336925 0 :tokigun_!unknown@unknown.invalid NICK :tokigun < 1119336934 0 :wooby!unknown@unknown.invalid PRIVMSG #esoteric :hi < 1119337123 0 :graue!unknown@unknown.invalid QUIT :Read error: 145 (Connection timed out) < 1119337736 0 :graue!~graue@ip68-100-130-21.dc.dc.cox.net JOIN :#esoteric < 1119338743 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :hi wooby < 1119338789 0 :wooby!unknown@unknown.invalid PRIVMSG #esoteric :howdy < 1119339212 0 :graue_!~graue@ip68-100-130-21.dc.dc.cox.net JOIN :#esoteric < 1119339236 0 :graue!unknown@unknown.invalid QUIT :Read error: 145 (Connection timed out) < 1119339241 0 :graue_!unknown@unknown.invalid NICK :graue < 1119340284 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :hi graue < 1119340344 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :hello < 1119340799 0 :clog!unknown@unknown.invalid QUIT :ended < 1119340800 0 :clog!unknown@unknown.invalid JOIN :#esoteric < 1119342878 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :whew, finally got the gui functioning, now just need to implement the model < 1119343868 0 :kipple!~kipple@163.80-202-100.nextgentel.com JOIN :#esoteric < 1119344173 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :hi kipple < 1119345120 0 :sp3tt!~chatzilla@lite-148-133.umenet.net JOIN :#esoteric < 1119345730 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :hi sp3tt < 1119345749 0 :sp3tt!unknown@unknown.invalid PRIVMSG #esoteric :Hi. < 1119346598 0 :kipple!unknown@unknown.invalid PART #esoteric :? < 1119349915 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :Step seems to be fully working :) < 1119349941 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :only two buttons left (Pass, Run) and I'm done < 1119349948 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :what are you doing? < 1119349967 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :graue: writing a bit/bool debugger as a Java gui app < 1119349972 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :great < 1119350578 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :mornin < 1119351425 0 :calamari!unknown@unknown.invalid QUIT :Read error: 110 (Connection timed out) < 1119351602 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :oh wow, I just found a Beatnik interpreter for DOS that I wrote in 2002 < 1119351622 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :who knew such things existed? < 1119354606 0 :jix!jix@p5489BD9C.dip.t-dialin.net JOIN :#esoteric < 1119354629 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :hi jix < 1119354638 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :moin graue < 1119354839 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :i'm going to mirror the mysql dumps from the wiki < 1119355317 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :great < 1119355329 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :have you written a XUML spec yet? < 1119355394 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :no and there is an error in my interpreter or converter < 1119355409 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :but i wrote YABALL spec and interpreter < 1119355554 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :I am interested in XUML because of its name beginning with the letter X < 1119355675 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :hehe < 1119355687 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :that was the reason for inventing XUML < 1119356833 0 :J|x!jix@p5489B2A5.dip.t-dialin.net JOIN :#esoteric < 1119356869 0 :jix!unknown@unknown.invalid QUIT :Nick collision from services. < 1119356871 0 :J|x!unknown@unknown.invalid NICK :jix < 1119357967 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :weekly crontab for downoading the mysql dumps to http://esolangs.org.bu.jix.qz-b.de/wiki_db/ < 1119366808 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :is someone here (excepting me) able to find all (real) solutions for x for all real a and b for (2x + a + b)^3 = (x + a)^3 + (x + b)^3 < 1119366873 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :what is character 0x1e? < 1119366908 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :uhm trash from copying it from a (german) website < 1119366913 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :http://www.mathematik-olympiaden.de/Aufgaben/42/3/42133a/42133a.html < 1119366923 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :no, i have no idea how to find real solutions for that < 1119366935 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :hehe < 1119366940 0 :lindi-!unknown@unknown.invalid PRIVMSG #esoteric :jix: http://paste.debian.net/833 < 1119366961 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :nah without a cas < 1119366995 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :computer aided solvatron? < 1119367008 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :computer-algebra-system < 1119367031 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :i did it with my brain < 1119367040 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :my brain is a computer chip < 1119371655 0 :Keymaker!~a@wire74.adsl.netsonic.fi JOIN :#esoteric < 1119371739 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :'ello < 1119371741 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :am i here? < 1119371765 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :yes < 1119371775 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :ok < 1119372182 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :hmm < 1119372193 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :who is a master of esolang webring? < 1119372201 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :no idea < 1119372227 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :iirc he was taken to mental hospital < 1119372228 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :i forgot to add the ring fragment to my page < 1119372239 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :(joke) < 1119372245 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :;) < 1119373444 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :http://fun.sdinet.de/pics/english/rock_rule.jpg < 1119373538 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :hehe :) < 1119374050 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :well.. must go. i'll have blade marathon today. all three blade movies. gotta get snacks and lemonade from store. < 1119374058 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric ::) < 1119374059 0 :Keymaker!unknown@unknown.invalid PART #esoteric :? < 1119374759 0 :J|x!jix@p5489B2A5.dip.t-dialin.net JOIN :#esoteric < 1119374793 0 :cpressey!unknown@unknown.invalid QUIT :Remote closed the connection < 1119374805 0 :cpressey!nobody@d154-20-76-195.bchsia.telus.net JOIN :#esoteric < 1119374841 0 :jix!unknown@unknown.invalid QUIT :Nick collision from services. < 1119374843 0 :J|x!unknown@unknown.invalid NICK :jix < 1119375165 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :i'm trying to write a 2k text-adventure in ruby < 1119375305 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :oh < 1119375330 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :oh? < 1119375402 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :can you show me the progress? < 1119375458 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :i have no story (yet) < 1119375463 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :but i'm writing story less code atm < 1119375475 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :(fight engine,io handling...) < 1119375509 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :421 bytes.. hmm i could compress the code usign my own algorithm or using zlib(because it's in the ruby stdlib) < 1119375511 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :hmm < 1119375520 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :do you have a nice idea for a story? < 1119375534 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :no idea < 1119375720 0 :sp3tt!unknown@unknown.invalid QUIT :"Chatzilla 0.9.68a [Firefox 1.0.4/20050511]" < 1119376096 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :no one has an idea < 1119376551 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :how about a homeless kid finds a discarded laptop on the streets of a city slum, connects to an unsecured wireless network, and begins learning about esoteric programming languages? < 1119378517 0 :J|x!jix@p5489B2A5.dip.t-dialin.net JOIN :#esoteric < 1119378550 0 :jix!unknown@unknown.invalid QUIT :Nick collision from services. < 1119378551 0 :J|x!unknown@unknown.invalid NICK :jix < 1119378567 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :P"You are a small mouse, kept in a too small cage. Your mission is to escape from the cage." < 1119378643 0 :wooby!unknown@unknown.invalid PRIVMSG #esoteric :graue: that's an awesome idea < 1119378654 0 :wooby!unknown@unknown.invalid PRIVMSG #esoteric :story of my life :) < 1119379340 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :wooby, seriously? < 1119379447 0 :wooby!unknown@unknown.invalid PRIVMSG #esoteric :well, i wasn't homeless... but my first computers were always discarded heh < 1119379447 0 :J|x!jix@p5489B2A5.dip.t-dialin.net JOIN :#esoteric < 1119379455 0 :wooby!unknown@unknown.invalid PRIVMSG #esoteric :and that wasn't really wireless heh < 1119379463 0 :wooby!unknown@unknown.invalid PRIVMSG #esoteric :more like... unsecured bbs < 1119379480 0 :jix!unknown@unknown.invalid QUIT :Nick collision from services. < 1119379485 0 :J|x!unknown@unknown.invalid NICK :jix < 1119379515 0 :wooby!unknown@unknown.invalid PRIVMSG #esoteric :there was that one "homeless hacker" guy who did some cheesy exploit on the new york times < 1119381094 0 :jix!unknown@unknown.invalid QUIT :"This computer has gone to sleep" < 1119383470 0 :wooby!unknown@unknown.invalid QUIT : < 1119383800 0 :wooby!~wooby@ny-lancastercadent4g1-3a-236.buf.adelphia.net JOIN :#esoteric < 1119383864 0 :tokigun!unknown@unknown.invalid QUIT :Read error: 104 (Connection reset by peer) < 1119383875 0 :tokigun_!~tokigun@dor204226.kaist.ac.kr JOIN :#esoteric < 1119383877 0 :tokigun_!unknown@unknown.invalid NICK :tokigun < 1119383883 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :hi tokigun < 1119385088 0 :jix!jix@p5489B2A5.dip.t-dialin.net JOIN :#esoteric < 1119385130 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :back < 1119386860 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :my text-adventure game engine is done about 500byte < 1119387096 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :and imo it has the right code-size / feature balance < 1119387165 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :mine's about 2000 bytes at present < 1119387178 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :just engine or game < 1119387184 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :engine < 1119387201 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :are you going to use an external datafile? < 1119387207 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :hell yes < 1119387216 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :hehe < 1119387228 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :i'm trying to do it without one < 1119387602 0 :graue!unknown@unknown.invalid QUIT :Remote closed the connection < 1119387610 0 :graue!~graue@ip68-100-130-21.dc.dc.cox.net JOIN :#esoteric < 1119387721 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :700 bytes without text and code compression < 1119387728 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :1 room implemented < 1119387836 0 :lindi-!unknown@unknown.invalid PRIVMSG #esoteric :jix: is that for x86 and DOS? < 1119387846 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :no its written in ruby < 1119387863 0 :lindi-!unknown@unknown.invalid PRIVMSG #esoteric :ok < 1119387927 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :nah that story doesn't work.. i need a new story < 1119392781 0 :jix!unknown@unknown.invalid QUIT :"Banned from network" < 1119395918 0 :wooby!unknown@unknown.invalid QUIT : < 1119396513 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :ACTION likes the idea of having competition this year < 1119396520 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :good luck to all :) < 1119396553 0 :malaprop_!unknown@unknown.invalid QUIT :Read error: 104 (Connection reset by peer) < 1119398568 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :back down to 1551 bytes ;) < 1119398920 0 :malaprop!~ph@adsl-69-208-101-159.dsl.chcgil.ameritech.net JOIN :#esoteric < 1119401026 0 :tokigun!unknown@unknown.invalid QUIT :"Chatzilla 0.9.68.5 [Firefox 1.0.3/20050414]" < 1119402891 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :new (i.e., old) Beatnik interpreter if anyone cares: http://www.oceanbase.org/graue/stupid/BEATNIK.c < 1119402981 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :pity Beatnik has only one stack and is therefore computationally useless < 1119406643 0 :graue!unknown@unknown.invalid PART #esoteric :? < 1119406821 0 :tokigun!~tokigun@dor204226.kaist.ac.kr JOIN :#esoteric < 1119415097 0 :tokigun!unknown@unknown.invalid QUIT :Remote closed the connection < 1119415719 0 :GregorR!unknown@unknown.invalid QUIT :Remote closed the connection < 1119418971 0 :GregorR!~GregorR@c-24-21-138-66.hsd1.or.comcast.net JOIN :#esoteric < 1119427199 0 :clog!unknown@unknown.invalid QUIT :ended < 1119427200 0 :clog!unknown@unknown.invalid JOIN :#esoteric < 1119429453 0 :tokigun!~tokigun@dor204226.kaist.ac.kr JOIN :#esoteric < 1119435771 0 :CXI!unknown@unknown.invalid QUIT :Connection timed out < 1119441646 0 :lament!unknown@unknown.invalid QUIT :Remote closed the connection < 1119442187 0 :lament!~lament@S010600110999ad06.vc.shawcable.net JOIN :#esoteric < 1119447297 0 :graue!~graue@ip68-100-130-21.dc.dc.cox.net JOIN :#esoteric < 1119447641 0 :jix!jix@p5489F1EF.dip.t-dialin.net JOIN :#esoteric < 1119447667 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :moin < 1119448513 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :hi jix < 1119448550 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :is there a wiki page with a list of wiki db mirrors? < 1119448550 0 :lindi-!unknown@unknown.invalid QUIT :Read error: 104 (Connection reset by peer) < 1119448575 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :i think one exists a few minutes in the future, by which time you will have created it < 1119448579 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :but not at this time, no < 1119448596 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :are there any other public mirrors < 1119448630 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :there are mirrors of the sql file, but i don't think there are any mirroring the actual browsable content < 1119448869 0 :lindi-!~lindi@kulho150.adsl.netsonic.fi JOIN :#esoteric < 1119448881 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :graue: where are they? < 1119449103 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :one of them is at http://rune.krokodille.com/lang/wiki-backup/ < 1119449169 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :I've seen others mentioned here, but I can't find them at the moment < 1119450196 0 :CXI!Sanity@dialup-215.89.221.203.acc50-kent-syd.comindico.com.au JOIN :#esoteric < 1119451635 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :i just noticed it's better to first have a story for a text adventure and than start writing it < 1119451661 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :oh and not just the beginning of the story but the whole game story < 1119451720 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :cpressey: how far are you with your engine? < 1119452683 0 :jix!unknown@unknown.invalid QUIT :"Banned from network" < 1119452694 0 :jix!jix@p5489F1EF.dip.t-dialin.net JOIN :#esoteric < 1119454339 0 :graue_!~graue@ip68-100-130-21.dc.dc.cox.net JOIN :#esoteric < 1119454339 0 :graue!unknown@unknown.invalid QUIT :Read error: 104 (Connection reset by peer) < 1119454386 0 :graue_!unknown@unknown.invalid NICK :graue < 1119456145 0 :tokigun!unknown@unknown.invalid QUIT :Read error: 104 (Connection reset by peer) < 1119456148 0 :tokigun_!~tokigun@dor204226.kaist.ac.kr JOIN :#esoteric < 1119456151 0 :tokigun_!unknown@unknown.invalid NICK :tokigun < 1119456210 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :hi tokigun < 1119456259 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :hello < 1119456803 0 :tokigun!unknown@unknown.invalid QUIT :Read error: 104 (Connection reset by peer) < 1119456806 0 :tokigun_!~tokigun@dor204226.kaist.ac.kr JOIN :#esoteric < 1119456808 0 :tokigun_!unknown@unknown.invalid NICK :tokigun < 1119456819 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :....oops < 1119457723 0 :tokigun!unknown@unknown.invalid QUIT :Read error: 104 (Connection reset by peer) < 1119460411 0 :tokigun!~tokigun@dor204226.kaist.ac.kr JOIN :#esoteric < 1119460627 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :ACTION watches the big red rubber tokigun bouncing ;) < 1119460649 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :heh < 1119460677 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :hmm < 1119460690 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :i don't know why i was disconnected < 1119462181 0 :graue!unknown@unknown.invalid PART #esoteric :? < 1119462312 0 :graue!~graue@ip68-100-130-21.dc.dc.cox.net JOIN :#esoteric < 1119462483 0 :tokigun!unknown@unknown.invalid QUIT :Read error: 104 (Connection reset by peer) < 1119462483 0 :tokigun_!~tokigun@dor204226.kaist.ac.kr JOIN :#esoteric < 1119462484 0 :tokigun_!unknown@unknown.invalid NICK :tokigun < 1119462491 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :is someone else writing an entry for the 2k text-adventure competition? < 1119462542 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :not really < 1119462615 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :i want application + string file (i'm going to supply a german and an english string file) to be less than 1.5k < 1119462620 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :but that's hard < 1119462701 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :what's the correct english word for a cage wall (the grid thing)? < 1119462914 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :fence < 1119462962 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :ok thanks < 1119464073 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric : < 1119464075 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :Kang Seonghoon strikes again, this time with the classic "99 Bottles of Beer" implemented in a shocking 15,556 instructions! Beyond cool! The code is also available here. < 1119464080 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :;) < 1119464109 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :it's time to buy some foods... < 1119464314 0 :graue!unknown@unknown.invalid QUIT :Remote closed the connection < 1119464350 0 :graue!~graue@ip68-100-130-21.dc.dc.cox.net JOIN :#esoteric < 1119464864 0 :J|x!jix@p5489F1EF.dip.t-dialin.net JOIN :#esoteric < 1119465028 0 :jix!unknown@unknown.invalid QUIT :Nick collision from services. < 1119465029 0 :J|x!unknown@unknown.invalid NICK :jix < 1119467265 0 :J|x!jix@p5489F1EF.dip.t-dialin.net JOIN :#esoteric < 1119467854 0 :jix!unknown@unknown.invalid QUIT :Connection timed out < 1119468889 0 :J|x!unknown@unknown.invalid NICK :jix < 1119469371 0 :graue!unknown@unknown.invalid QUIT :Read error: 110 (Connection timed out) < 1119469942 0 :tokigun!unknown@unknown.invalid QUIT :"Chatzilla 0.9.68.5 [Firefox 1.0.3/20050414]" < 1119470181 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :i have 1000bytes game (50% clean code i think i will shrink it down to 700byte) and ~600 bytes lang-file i think i have 30% of the game done < 1119470752 0 :pgimeno!unknown@unknown.invalid QUIT :Read error: 54 (Connection reset by peer) < 1119472659 0 :BlurredWe!~weasel@dnvrapanas20poolc25.dnvr.uswest.net JOIN :#esoteric < 1119472669 0 :BlurredWe!unknown@unknown.invalid PRIVMSG #esoteric :heh, sweet...didn't know about this channel < 1119472728 0 :BlurredWe!unknown@unknown.invalid PRIVMSG #esoteric :so here's what I want to do: a shell script that runs under windows .bat interpreter and also under the sh interpreter. All it needs to do is 'echo "1 2 3" > $2' < 1119472957 0 :tokigun!~tokigun@dor204226.kaist.ac.kr JOIN :#esoteric < 1119472968 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :hello < 1119472997 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :jix: I am working on a game, for the competition < 1119473014 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :{^Raven^}: 2k text-adventure competition? < 1119473026 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :tokigun: yeah < 1119473051 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :hmm < 1119473089 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :finally author of whirl replied me that he updated page. < 1119473096 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :http://bigzaphod.org/whirl/ < 1119474394 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :{^Raven^}: how far are you with your text-adventure? < 1119475048 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :jix: at the end of the initial planning stage < 1119475851 0 :graue!~graue@ip68-100-130-21.dc.dc.cox.net JOIN :#esoteric < 1119476272 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :{^Raven^}: at 17pm i was at the end of the planning stage < 1119476279 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :now i'm at the end of the coding stage < 1119476479 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :sounds good < 1119476669 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :jix: I'm looking forward to see what you come up with < 1119476949 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :jix: my engine is "done", if "done" means "it works and runs what i have for my game so far." i still have a significant list of improvements that i still want to make to it, though < 1119477364 0 :graue!unknown@unknown.invalid QUIT :Remote closed the connection < 1119477470 0 :graue!~graue@ip68-100-130-21.dc.dc.cox.net JOIN :#esoteric < 1119477560 0 :graue!unknown@unknown.invalid QUIT :Remote closed the connection < 1119477718 0 :graue!~graue@ip68-100-130-21.dc.dc.cox.net JOIN :#esoteric < 1119478172 0 :calamari!~calamari@dialup-4.240.114.168.Dial1.Phoenix1.Level3.net JOIN :#esoteric < 1119478499 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric : 1219 mouse.rb < 1119478499 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric : 604 english.lng < 1119478499 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric : 1823 total < 1119478687 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :oh... < 1119478697 0 :graue!unknown@unknown.invalid QUIT :Remote closed the connection < 1119478708 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :jix: there is two langpacks? < 1119478711 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :s/is/are/ < 1119478720 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :at the moment not < 1119478726 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :but i'm going to add a german one < 1119478733 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :hmm... < 1119478747 0 :graue!~graue@ip68-100-130-21.dc.dc.cox.net JOIN :#esoteric < 1119478819 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :anyway, good luck :) < 1119478903 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :hi jix < 1119478992 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :ok if i compress the sourcecode using zlib (self extracting sourcecode.. it's like a self extracting binary because in ruby there are no binaries) < 1119479007 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :1256 total < 1119479112 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :good < 1119479175 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :with a data file it could be up to 10.5kb < 1119479182 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :but i only need 1.2 kb < 1119479492 0 :BlurredWe!unknown@unknown.invalid QUIT :"Leaving" < 1119480274 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :2 langpacks + game 1924 total < 1119480306 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :with comments and no compression (game and packs) 6757 total < 1119480506 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :does someone want to test my adventure? (online) < 1119480535 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :requirement is telnet or netcat < 1119480542 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :me me me < 1119480603 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :for the most commands there are shortcuts < 1119480704 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :oh btw with x you can examine things < 1119480896 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :jix: I'd like to also :) < 1119480946 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :calamari: just one person a time < 1119480952 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :'k :) < 1119480975 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :because i'm starting the "server" manually using netcat and tail -f ^^ < 1119481060 0 :Keymaker!~Not@wire74.adsl.netsonic.fi JOIN :#esoteric < 1119481090 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :'ello < 1119481095 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :moin Keymaker < 1119481101 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :hi < 1119481114 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :there is no help < 1119481119 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :i can give you a command list calamari < 1119481141 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :that's okay... I'm just experimenting < 1119481159 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :grrr i never get e-mail < 1119481164 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :(not even spam) < 1119481167 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :jix "to the north" < 1119481186 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :calamari: hm? < 1119481195 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :vs "in the north" < 1119481203 0 :graue_!~graue@ip68-100-130-21.dc.dc.cox.net JOIN :#esoteric < 1119481220 0 :graue_!unknown@unknown.invalid QUIT :Remote closed the connection < 1119481239 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :jix: creative game idea btw, I like it :) < 1119481281 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :it seems to pause after certain things, unless I push enter again < 1119481289 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :yes < 1119481298 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :that's a bug, I presume? < 1119481305 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :no it isn't a bug < 1119481320 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :any room for a "Press Return" message, then? :) < 1119481332 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :it's my laziness < 1119481341 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :hmm uh.. not really < 1119481360 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :uhm yes there is room i just found it < 1119481412 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :do you mean there is something blocking the other end of the pipe? < 1119481425 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :no there is just something < 1119481434 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :use the x command < 1119481441 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :or examine < 1119481450 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :eg x the_thing_you_want_to_examine < 1119481494 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :uh i can't parse complex sentences like that in 0.6 kb < 1119481508 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :what's complicated about "x pipe" :) < 1119481515 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :examine the pipe < 1119481518 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :x other end of the pipe < 1119481533 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :I tried x pipe first < 1119481537 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :and there is nothing interesting about the pipe so i didn't added a message < 1119481544 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :try to examine other things < 1119481572 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :lol < 1119481593 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :take not get < 1119481660 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :do you want a hint? < 1119481675 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :nope.. unless it's because of a command I don't know about :) < 1119481687 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :ok < 1119481714 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :x may work with directions too < 1119481808 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :exit? < 1119481822 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :no it was a question < 1119481832 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :there is no exit command and telnet sends ctrl-c as characters < 1119481840 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :and not as signal < 1119481855 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :i have to exit the program < 1119481867 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :do you now want to hear the solution? < 1119481884 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :nope! < 1119481894 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :do you want to try again? < 1119481914 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :nope. I need to get off actually, company came to the door :) < 1119481929 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :do you want to try it with the german langpack ^^^ < 1119481932 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :cool game.. could use a bit of polish, but really neat idea < 1119481938 0 :calamari!unknown@unknown.invalid QUIT :"bbl" < 1119481955 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :i'm going to bed now good nite < 1119481985 0 :jix!unknown@unknown.invalid QUIT :"Banned from network" < 1119482613 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :(reply lag) good night! < 1119483007 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :good night ;) < 1119483044 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :exam has finished but some reports are remained... hmm. < 1119483989 0 :calamari!~calamari@dialup-4.240.108.167.Dial1.Phoenix1.Level3.net JOIN :#esoteric < 1119483998 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :re's < 1119484700 0 :graue!unknown@unknown.invalid QUIT :Remote closed the connection < 1119484732 0 :graue!~graue@ip68-100-130-21.dc.dc.cox.net JOIN :#esoteric < 1119484772 0 :Keymaker!unknown@unknown.invalid QUIT :"I've seen this déjà vu before.." < 1119484834 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :hi graue < 1119484893 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :graue: can I use rsync to grab the dump, or do I need to use wget? < 1119485577 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :you need to use wget < 1119485764 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :'k :) < 1119486092 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :well, it's set up.. so now you have 3 mirrors :) < 1119487155 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :url? < 1119487258 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :on the preservation page < 1119487269 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :oh, of course < 1119487337 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :dunno if all that cron stuff is needed, but I didn't know it.. so I'll use it if I ever need to set it up again < 1119487518 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :one thing about it though.. if the wiki goes down, what point is there to have that list of mirrors on the wiki page.. hehe < 1119487543 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :so http://kidsquid.com/esowiki ;) < 1119488712 0 :graue!unknown@unknown.invalid QUIT :Read error: 131 (Connection reset by peer) < 1119488742 0 :graue!~graue@ip68-100-130-21.dc.dc.cox.net JOIN :#esoteric < 1119488841 0 :graue!unknown@unknown.invalid QUIT :Remote closed the connection < 1119488883 0 :graue!~graue@ip68-100-130-21.dc.dc.cox.net JOIN :#esoteric < 1119489274 0 :graue!unknown@unknown.invalid QUIT :Remote closed the connection < 1119489306 0 :graue!~graue@ip68-100-130-21.dc.dc.cox.net JOIN :#esoteric < 1119490131 0 :graue!unknown@unknown.invalid QUIT :Remote closed the connection < 1119490465 0 :graue!~graue@ip68-100-130-21.dc.dc.cox.net JOIN :#esoteric < 1119490525 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :graue: having fun with irc? < 1119490801 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :no < 1119491915 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :bbl < 1119491916 0 :calamari!unknown@unknown.invalid QUIT :"Leaving" < 1119492505 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :nite peeps < 1119497699 0 :calamari!~calamari@dialup-4.240.150.199.Dial1.Phoenix1.Level3.net JOIN :#esoteric < 1119498039 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :hi < 1119498553 0 :graue!unknown@unknown.invalid QUIT :Read error: 60 (Operation timed out) < 1119513599 0 :clog!unknown@unknown.invalid QUIT :ended < 1119513600 0 :clog!unknown@unknown.invalid JOIN :#esoteric < 1119515314 0 :calamari!unknown@unknown.invalid QUIT :Read error: 60 (Operation timed out) < 1119521751 0 :pgimeno!pgimeno@124.Red-80-59-211.pooles.rima-tde.net JOIN :#esoteric < 1119523818 0 :andreou!~peace@195.130.98.164 JOIN :#esoteric < 1119525149 0 :andreou!unknown@unknown.invalid QUIT :"i be novel." < 1119531461 0 :jix!jix@p5489E722.dip.t-dialin.net JOIN :#esoteric < 1119531627 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :moin < 1119532284 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :morning < 1119534661 0 :jix!unknown@unknown.invalid QUIT :Read error: 104 (Connection reset by peer) < 1119534704 0 :jix!jix@p5489E722.dip.t-dialin.net JOIN :#esoteric < 1119547404 0 :HisteriX!~klizzz@212.62.54.140 JOIN :#esoteric < 1119547421 0 :HisteriX!unknown@unknown.invalid PART #esoteric :? < 1119548224 0 :graue!~graue@ip68-100-130-21.dc.dc.cox.net JOIN :#esoteric < 1119549305 0 :pgimeno!unknown@unknown.invalid QUIT :"rebooting" < 1119549476 0 :pgimeno!pgimeno@124.Red-80-59-211.pooles.rima-tde.net JOIN :#esoteric < 1119549502 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :hi pgimeno < 1119549507 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :hey < 1119549689 0 :Dedo!~Miranda@adsl-data-16.84-47-82.telecom.sk JOIN :#esoteric < 1119549833 0 :Dedo!unknown@unknown.invalid QUIT : < 1119550183 0 :CXI!unknown@unknown.invalid QUIT :Read error: 104 (Connection reset by peer) < 1119550263 0 :CXI!~Sanity@dialup-215.89.221.203.acc50-kent-syd.comindico.com.au JOIN :#esoteric < 1119551193 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :electric storm - bbl < 1119551199 0 :pgimeno!unknown@unknown.invalid QUIT :"This is the default quit message" < 1119556586 0 :Keymaker!~Not@wire74.adsl.netsonic.fi JOIN :#esoteric < 1119556980 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :AAAAAAAAAAARRRRRRRGGGGGGGGH < 1119557470 0 :calamari!~calamari@dialup-4.240.69.226.Dial1.Phoenix1.Level3.net JOIN :#esoteric < 1119557475 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :hi < 1119557476 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :hi < 1119557494 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :hello < 1119557587 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :how are things in eso land? < 1119558089 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :boring < 1119560333 0 :lament!unknown@unknown.invalid NICK :desafinado < 1119560333 0 :Keymaker!unknown@unknown.invalid QUIT :Read error: 54 (Connection reset by peer) < 1119566549 0 :jix!unknown@unknown.invalid QUIT :"Banned from network" < 1119571226 0 :calamari_!~calamari@dialup-4.240.114.53.Dial1.Phoenix1.Level3.net JOIN :#esoteric < 1119571332 0 :calamari_!unknown@unknown.invalid PRIVMSG #esoteric :re's < 1119571974 0 :harkeyahh!~chatzilla@206-81-148-32.slkc.qwest.net JOIN :#esoteric < 1119572316 0 :harkeyahh!unknown@unknown.invalid PRIVMSG #esoteric :CharServ STFU! < 1119572329 0 :harkeyahh!unknown@unknown.invalid PRIVMSG #esoteric :U r always on my case abotu something ChanServ < 1119572350 0 :harkeyahh!unknown@unknown.invalid PRIVMSG #esoteric :if you wanna serve me get me something to drink and then get down on your knees... < 1119572373 0 :calamari!unknown@unknown.invalid QUIT :Read error: 110 (Connection timed out) < 1119572712 0 :desafinado!unknown@unknown.invalid PRIVMSG #esoteric :harkeyahh: did you package arrive safely to Mumbai? < 1119572717 0 :desafinado!unknown@unknown.invalid PRIVMSG #esoteric :*your < 1119572738 0 :harkeyahh!unknown@unknown.invalid PRIVMSG #esoteric :oh, yes it did i meant to change the topic < 1119572796 0 :harkeyahh!unknown@unknown.invalid TOPIC #esoteric :Another brainfuck site (http://www.bf-hacks.org/) is open! ~ http://chriscoyne.com/cfdg/ ~ Esolang wiki: http://esolangs.org/wiki/ Thank you for your prayers my children. The package arrived safely into the arms of a 10,000 pound elephant. < 1119573438 0 :desafinado!unknown@unknown.invalid PRIVMSG #esoteric :there has been confusion regarding turing-completeness of smallfuck < 1119573475 0 :desafinado!unknown@unknown.invalid PRIVMSG #esoteric :and the amount of available memory. < 1119573503 0 :desafinado!unknown@unknown.invalid PRIVMSG #esoteric :I made up my mind. Available memory is limited. Smallfuck is not turing-complete. < 1119574658 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :desafinado: on that topic, you might be interested in this: http://catseye.webhop.net/projects/sf2tab/src/sf2tab.c < 1119574666 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :it compiles smallfuck programs into lookup tables < 1119575135 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :hey that's cool < 1119575176 0 :heatsink!~heatsink@c-24-61-94-111.hsd1.nh.comcast.net JOIN :#esoteric < 1119575682 0 :desafinado!unknown@unknown.invalid PRIVMSG #esoteric :cpressey: hahaha < 1119575789 0 :desafinado!unknown@unknown.invalid PRIVMSG #esoteric :neat < 1119580802 0 :tokigun!unknown@unknown.invalid QUIT :"Chatzilla 0.9.68.5 [Firefox 1.0.3/20050414]" < 1119581890 0 :malaprop!unknown@unknown.invalid QUIT :"bounce" < 1119582882 0 :desafinado!unknown@unknown.invalid NICK :lament < 1119587056 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :I added pages to the esowiki on Archway and Qdeql < 1119588191 0 :calamari_!unknown@unknown.invalid QUIT :Read error: 110 (Connection timed out) < 1119589338 0 :heatsink!unknown@unknown.invalid QUIT :"Leaving" < 1119591555 0 :harkeyahh!unknown@unknown.invalid QUIT :"Chatzilla 0.9.68.5 [Firefox 1.0.4/20050511]" < 1119599999 0 :clog!unknown@unknown.invalid QUIT :ended < 1119600000 0 :clog!unknown@unknown.invalid JOIN :#esoteric < 1119600899 0 :pgimeno!pgimeno@124.Red-80-59-211.pooles.rima-tde.net JOIN :#esoteric < 1119601868 0 :graue!unknown@unknown.invalid QUIT :Read error: 110 (Connection timed out) < 1119612993 0 :tokigun!~tokigun@dor204226.kaist.ac.kr JOIN :#esoteric < 1119613003 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :hello < 1119613117 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :i've submitted three beer song program to 99-bottles-of-beer.net; one of them is already uploaded. < 1119613118 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :http://www.99-bottles-of-beer.net/language-whirl-761.html < 1119615521 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :nice work, tokigun < 1119615563 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :;) < 1119615843 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :I've voted it as top-geek < 1119616413 0 :puzzlet!unknown@unknown.invalid PRIVMSG #esoteric :nice work tokigun :) < 1119617466 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :thanks ;) < 1119619093 0 :malaprop!~ph@adsl-69-208-101-159.dsl.chcgil.ameritech.net JOIN :#esoteric < 1119619698 0 :jix!jix@p5489F07B.dip.t-dialin.net JOIN :#esoteric < 1119628239 0 :jix!unknown@unknown.invalid QUIT :"Banned from network" < 1119635208 0 :calamari_!~jeffryj@lilly.csoft.net JOIN :#esoteric < 1119635213 0 :calamari_!unknown@unknown.invalid PRIVMSG #esoteric :hi < 1119638566 0 :graue!~graue@ip68-100-130-21.dc.dc.cox.net JOIN :#esoteric < 1119639168 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :hello < 1119639322 0 :comet_11!Sanity@dialup-215.89.221.203.acc50-kent-syd.comindico.com.au JOIN :#esoteric < 1119639337 0 :CXI!unknown@unknown.invalid QUIT :Read error: 104 (Connection reset by peer) < 1119639356 0 :comet_11!unknown@unknown.invalid NICK :CXI < 1119639687 0 :calamari_!unknown@unknown.invalid PRIVMSG #esoteric :hi graue < 1119640113 0 :calamari_!unknown@unknown.invalid QUIT :"bbl" < 1119644616 0 :graue!unknown@unknown.invalid QUIT :Remote closed the connection < 1119645388 0 :calamari!~calamari@dialup-4.240.150.251.Dial1.Phoenix1.Level3.net JOIN :#esoteric < 1119646150 0 :graue!~graue@ip68-100-130-21.dc.dc.cox.net JOIN :#esoteric < 1119648739 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :regraue < 1119648757 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :hello < 1119650043 0 :jix!jix@p5489F07B.dip.t-dialin.net JOIN :#esoteric < 1119650341 0 :jix!unknown@unknown.invalid QUIT :"Banned from network" < 1119650933 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :hi < 1119651307 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :hi raven < 1119651341 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :how's things? < 1119651381 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :better now that I've taken my math test :) < 1119651412 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric ::) < 1119651475 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :I'm considering writing an adventure game.. need to see if my idea is feasible though. Of course an extra 8k of data storage helps a lot :) < 1119651502 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :just 2.8k is suficcient for a large game < 1119651535 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :depends on how much time you spend compressing things < 1119651566 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :nothing in the rules says not to use the data file, so why not? hehe < 1119651575 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :I enjoy squeezing every last byte out of code. optimisation is fun < 1119651613 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :oh, don't get me wrong.. it's just that if I limit myself to 2.8, it's not going to be the same game as 2+8k < 1119651638 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :still only 2k of code.. the 8k is for data < 1119651737 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :I need to write a quick assembler, though, so that I can use a compressed source format.. 2929 bytes of standard asm source code won't get me much < 1119651786 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :last year assembler games were accepted without source code < 1119651793 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :I think that source rule is silly, though.. it's the binary that matters.. actually a lot of the rules are silly, it's all for the fun of it, I suppose < 1119651812 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :oic.. that makes things considerably easier < 1119651904 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :with 2k of code, I could probably write a semi-generic engine < 1119651922 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :once that fits your game perfectly < 1119651956 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :if you want to follow the rules as posted then a zip of your engine + your data file has to be under 2.7Kb and that's pretty impossible < 1119651980 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :the organiser has not thought about the rules, think of them as general guidelines < 1119651996 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :and there should be an OR clause between rules one and two < 1119652021 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :it was funny how he called it RAM, that makes no sense in the context < 1119652033 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :the source code limit is for games written in BASIC or interpreted languages < 1119652062 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :the executable code limit is for compiled/assembled games < 1119652163 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :yeah, it implies that a UPXd EXE (!) when decompressed must be within the 2.79Kb [sic] limit < 1119652174 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :I should e-mail him to see what the actual rules are < 1119652233 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :people have tried this year and last year to clarify them but to no avail. Good Luck! < 1119652261 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :raven: I think it'd be pretty hard for him to verify how much ram is being used < 1119652308 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :pretty much impossible without disasseming the source, on game systems such as the atari 5200 < 1119652359 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :yeah. I'm still strying to get the whole concept of a 1024-2048 byte game competition that allows entries up to almost 3K in size < 1119652481 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :not 3K < 1119652482 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :a lot more < 1119652496 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :i mean come on < 1119652497 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :i meant only for the game object < 1119652501 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :8k is for "data" < 1119652506 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :what the fuck is "data" < 1119652511 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :maybe my "data" is Python code < 1119652515 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :exactly < 1119652518 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :non-executed code < 1119652526 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :define "executed", eh < 1119652526 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :*oops, non-executed stuff < 1119652539 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :define non-executed < 1119652544 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :an interpreter doesn't execute anything, it just looks at "data" and decides what to do < 1119652547 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :right? < 1119652552 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :everything is data < 1119652556 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :exactly < 1119652558 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :everything is data. < 1119652618 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :of course for an interactive fiction game < 1119652628 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :you probably need much more "real data" than code < 1119652649 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :it might be possible to fit Scott Adams' engnine in 2k < 1119652661 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :and any scott adams' game fits easily (zipped) in 8k data < 1119652667 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :easily, you could do it in much less < 1119652680 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :(which is exactly what i was planning to do for the competition :)) < 1119652718 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :Previously I used my own custom data compression code rather than relying on any external libraries < 1119652806 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :For this I would prefer to do the same to keep the 'game' as self contained as possible (not saying that I won't though) < 1119652892 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :wisdom from the dunric file: http://groups-beta.google.com/group/rec.games.video.classic/browse_thread/thread/5110daaa04a82c2c/0267f0dcc89cbaf5?q=rec.games.video.classic+dunric&rnum=8&hl=en#0267f0dcc89cbaf5 < 1119653114 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :Here is a "clarification" of the rules (at the bottom) http://groups-beta.google.com/group/rec.arts.int-fiction/browse_frm/thread/68e352749cb768ff/cc85e00f30ff941d?q=dunric&rnum=6&hl=en#cc85e00f30ff941d < 1119653149 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :if accepted as true it allows for some major abuse of the rules < 1119653175 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :ha < 1119653181 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :he says you can use "TADS, Adrift, etc" < 1119653184 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :which also means inform < 1119653194 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :ha < 1119653221 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :for instance you could write a *huge* generic game engine without any size limitations (the interpreter) < 1119653247 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :the code (game logic) would have to fit in 2.83Kb which would allow for a huge amount of logic < 1119653264 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :and all data (strings etc) would go in the 8Kb data file < 1119653301 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :IMHO that's what dunrics clarification allows and that goes against what I feel to be the spirit of the competition < 1119653335 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :TADS, Adrift, Inform ARE "huge, generic game engines" < 1119653340 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :and what's better, you don't have to write them yourself. < 1119653418 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :but it means that you could really submit anything, you can compress the logic (code) to fit within 2.83Kb and not suffer from the EXE/UPX clause in rule one < 1119653495 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :basically the rules of the competition are kinda dumb :) < 1119653505 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :completely and utterly < 1119653507 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :he should have restricted them waay more < 1119653531 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :this needs to be sorted out, the rules need to be revised < 1119653648 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :My entry from last year was fully self contained at 2,803 bytes of BBC BASIC, it even ran on a BBC < 1119653827 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :He states that the absolute maximum source size is 2.83Kb and later adds 'give or take a few hundred bytes' and gives a new limit of 2.86Kb < 1119653861 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :no-one, to my knowledge has ever understood what dunric's rules mean < 1119653952 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :including him, I'd imagine.. where would 2.83k come from? not exactly a common file size :) < 1119654054 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :~2.831Kb = 2899 bytes. Since when are there only 1000 bytes in a kilobyte? Any programmer (aside form dunric!) should know this. < 1119654103 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :and 2.83Kb is waaaay outside the 1Kb to 2Kb remit of the contest < 1119654114 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :it doesn't matter tho, in the end :) < 1119654163 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :not really, but knowing the original reason why the competition started makes it seem silly < 1119654278 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :hmm, if I don't have an external data file, I'd better think harder about compression. Maybe perl? :) < 1119654354 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :#defining common operations as macros would allow a good degree of compression. < 1119654375 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :I'm think more along the lines of text compression < 1119654426 0 :CXI!unknown@unknown.invalid NICK :test < 1119654430 0 :test!unknown@unknown.invalid NICK :CXI < 1119654440 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :hmmm, the main problem is the trade off between the space gained by compression and the code size required for decompression < 1119654491 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :finding an optimal or beneficial balance is difficult but possible if you limit yourself to only 2.83Kb for the entire game < 1119655007 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :it is possible to decompress in very little code, depending on the compression used. For example, dictionary compression < 1119656100 0 :KarlMarx!~chatzilla@206-81-148-32.slkc.qwest.net JOIN :#esoteric < 1119656480 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :I've e-mailed him.. hopefully I'll get a response since we used to hang out online all the time < 1119656693 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :what have you asked? < 1119656733 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :I asked for clarifications, and also offered alternate rules that made sense to us < 1119656762 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :hmmm...i am doing the same (but not sent yet) < 1119656785 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :let me paste the rules I suggested to see if you agree < 1119656790 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :please < 1119656810 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :1) The size of the unzipped game file may be no larger than 2048 bytes in < 1119656811 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :size, whether source or binary in nature. The internal details or methods < 1119656811 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :used in the binary or source file are unimportant (feel free to use UPX < 1119656811 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :compression, platform tricks, etc), so long as the game file itself is no < 1119656811 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :more than 2048 bytes in size. < 1119656813 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :2) External game engines or language interpreters may be used to run the < 1119656815 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :game, so long as it can be verified that the engine or language employed was < 1119656817 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :written prior to the contest starting date. < 1119656835 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :.. That was it :) < 1119656923 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :very well pu calamari < 1119656990 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :he relied already, basically ignoring the rule suggestions < 1119656994 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :replied rather < 1119657010 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :I would have suggested that the original 2899 byte limit be allowed for this year only < 1119657023 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :Perhaps you can suggest that < 1119657053 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :why was the limit set at 2899 bytes? < 1119657064 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :no idea.. absolutely none < 1119657069 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :IMHO it's an interesting story < 1119657094 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :maybe a certain auto-adventure generator saves files of that size? < 1119657110 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :with the external data file < 1119657126 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :maybe so < 1119657130 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :seems VERY far fetched < 1119657135 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :It may not be 'entirely' true, but it fits the events surrounding the announcement of the original competition last year < 1119657167 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :Each year in the interactive-fiction community there is a competition called IF-Comp < 1119657207 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :Dunric submitted his game B-Venture to the 2004 IF-Comp < 1119657220 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :yeah, I heard he placed last? < 1119657237 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :his entry was disqualified because it broke the 'entries must not have been previously released' rule < 1119657246 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :haha < 1119657270 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :that sux.. so he probably made his own contest in spite? < 1119657270 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :he discussed this fervently (to understate reality) with the organisers and community at large < 1119657289 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :and yes, in spite he made his own competition < 1119657306 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :you know what I think would be really neat < 1119657309 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :in his competition there were no rules to disallow previously released games < 1119657312 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :a modular music studio, using Brainfuck programs < 1119657331 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :effects would be programs that read samples on stdin and produce samples on stdout < 1119657349 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :And B-Venture was 2,700(ish) bytes long, so he set a max code limit which was a little larger < 1119657363 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :heh < 1119657374 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :This was part of the reason why the first competition was ignored by the IF community < 1119657379 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :graue: go for it! < 1119657406 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :the other part of the reason is probably because the vast majority of the IF community couldn't care less about "old-school" crappy games which fit in a few K < 1119657410 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :graue: very nice idea < 1119657419 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :you could even get fancy and have wave in, wave out bookends < 1119657432 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :I am not familiar with the use of the term 'bookend' in this context < 1119657446 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :sorry, my lack of vocabulary < 1119657504 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :the idea is that you'd give a regaular wav file, it'd be decoded and sent to the next filter, which would only be dealing with a raw file, then after the last filter you'd feed the raw into the last program and it'd becomes a playable wav again < 1119657508 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :lament: it's not that miniature masterpieces in general are crap, coding small elegant programs with a apurpose is a lost art. The quality of the works of certain authors (not mentioning names here) does leave a lot to be desired < 1119657527 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :{^Raven^}: it's an art the IF community isn't terribly interested in. < 1119657543 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :they have their own art to worry about < 1119657565 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :calamari, I guess so, but I was thinking the environment executing the programs would do that sort of coding < 1119657567 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :lament: maybe not, but it is interesting, nonetheless < 1119657579 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :graue: oic, that'd make sense < 1119657602 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :are there any portable mp3 players that are programmable? < 1119657620 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :yes < 1119657622 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :well < 1119657630 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :not officially < 1119657635 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :but unofficially, yes. < 1119657643 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :the ipod is one i believe? < 1119657647 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :iriver also < 1119657688 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :ipod is definately programmable < 1119657754 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :the thing is to work out how to do it. The only non-reprogrammable ones are implemented in pure-hardware which is not common < 1119657800 0 :heatsink!~heatsink@c-24-61-94-111.hsd1.nh.comcast.net JOIN :#esoteric < 1119657803 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :calamari: I am going to point out to Dunric where the current rules can be abused < 1119657836 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :cool.. I gave him the 2899 + 8192 example, but that didn't seem to phase him < 1119657856 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :calamari: can I use/paraphrase/steal your suggested rules (with due credit) < 1119657873 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :calamari: am not sure about it as it would probably be better for it to seem completely independant < 1119657879 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :of course, and that'd be great too, because he'll be hearing the same thing again from someone new < 1119657918 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :i am tempted to post it to as RFD to raif (rec.arts.int-fiction) < 1119657934 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :you won last year, mention that ;) < 1119657953 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric ::D < 1119657976 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :That's a good idea < 1119657993 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :my wording can be improved.. I'm not the greatest writer, which kinda rules me out of serious IF, but this 2k stuff seems a bit different < 1119658006 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :I am researching other 2Kb(ish) competitions to gather a common rule set < 1119658025 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :{^Raven^}: have you written any "normal" IF? < 1119658029 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :My own writing can be pretty awful < 1119658085 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :lament: yes, quite a lot, including games, game engines and IF development tools < 1119658144 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :I used to be quite prolific in the late eighties and early ninties < 1119658148 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :wow < 1119658154 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :late eighties! < 1119658159 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :that's before inform isnt it < 1119658230 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :Before Graham Nelson's Inform became widely used. I think that the original Infocom ZCode engine predates my original game < 1119658246 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :uhhhh < 1119658247 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :haha < 1119658250 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :of course it does < 1119658260 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :second IF game ever was written in it < 1119658374 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :the only text adventure I played of any length of time was called something like "leather goddesses of phobos". I don't remember what that title was about, and I never beat the game.. it was fun, though < 1119658401 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :that game is hard < 1119658425 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :it was big, I liked that < 1119658435 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :big games are intimidating :( < 1119658464 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :I'm not sure about that since Colossal Cave was 1972ish and ZCode was 1979 < 1119658484 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :well, real life beckons.. bbl < 1119658492 0 :calamari!unknown@unknown.invalid QUIT :"<=K" < 1119658513 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :and Zork was originally written in MDL and released in 1977, but there has to be a wealth of IF in the intervening years < 1119659189 0 :calamari!~calamari@dialup-4.240.111.107.Dial1.Phoenix1.Level3.net JOIN :#esoteric < 1119659197 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :yay, escaped back to eso and < 1119659205 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :land even < 1119661121 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :ehm, .... ok < 1119661123 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :i'm undecided now < 1119661157 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :having an 8K data file is really a lot of space. where's the challenge? < 1119661186 0 :tokigun!unknown@unknown.invalid QUIT :"Chatzilla 0.9.68.5 [Firefox 1.0.3/20050414]" < 1119661305 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :cpressey: choose not to use it :) < 1119661339 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :I was going to, but it's true.. there is no challenge that way < 1119661450 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :well... i mean, there still can be a challenge, but it's mostly the same as any other IF competition - just design and implement a good game. 10K is plenty of space to do that in, if you're any good at writing small code. < 1119661468 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :cpressey: I am going to try to make the biggest and best game I can < 1119661470 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :i guess the thing is, i'm running out of ideas, before i've run out of space. heh < 1119661489 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :chris: i hear that :) < 1119661554 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :A good programmer can do a lot in less than 2,899 bytes of code < 1119661571 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :(Several complete operating systems were 2k or less) < 1119661602 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :came across this page, it's quite interesting: http://www.costik.com/nowords.html < 1119661646 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :calamari: That title is so Harlan Elison < 1119661653 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :raven: generally those are they types of operating systems where you have to look up "error 231" in a separate manual :) < 1119661678 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :raven: who is that? < 1119661710 0 :KarlMarx!unknown@unknown.invalid PART #esoteric :? < 1119661806 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :Harlan Ellison is an author of Science Fiction. < 1119661815 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :(very good SF) < 1119661888 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :The title of the Costik page refers to his short-story "I Have No Mouth And I Must Scream" < 1119661914 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :wtf < 1119661925 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :he refers to IF as "interactive fantasy" < 1119661950 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :calamari: there're much better articles on IF game design. < 1119662012 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :lament: cool.. I just came across this one.. it was really a sidenote as it seems to concentrate on other types of games more than IF.. I think he brings up some good points about what can make a game fun (or prevent it from being so) < 1119662015 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :for example this: http://www.inform-fiction.org/manual/html/ch8.html < 1119662020 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :if you have a few weeks to read it :) < 1119662047 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :The IFWiki has a lot of useful information http://www.ifwiki.org/index.php/Main_Page < 1119662096 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :raven: so you're going for the whole 10k, then? < 1119662133 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :calamari: It would be too easy for me to knock-up another game based on my original engine < 1119662192 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :calamari: I am going for the full 10k because I want to see how far I can take the concept < 1119662301 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :calamari: For me I feel that I have explored the 2k limit to my own logical ends, < 1119662341 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :calamari: The 10k limit presents a really difficult challenge to overcome with what I am planning < 1119662915 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :btw, here is what I got the 2nd time around: The adventure game source file can be anywhere from 1 to 2.8k. It's still a 1-2k contest, in that entries (source code, anyway) will usually be 1-2k in size. The extra data file allowed (consisting of 8,192 bytes) makes 2k games playable to a larger extent, and in essence makes the games entered adventure game drivers, a la Scott Adams. < 1119662947 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :whatever scott adams is.. you'd probably know :) < 1119663065 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :lament: Have we met on r*if? I am sure that I know you from elsewhere. < 1119663096 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :"usually be 1-2k in size" ??? < 1119663119 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :i would hazard to guess that if the limit is 2.8k, most entries would be, well, 2.8k in size :) < 1119663151 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :cpressey: 2.83Kb is still 2Kb (if you're rounding down), but last year several entries were under 1Kb < 1119663223 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :yes... but two of those entries seemed more like jokes than serious entries to me < 1119663336 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :the thing is, i don't know what will score higher in the judging - good (i.e. playable) game or small game. < 1119663350 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :seems to me: good game < 1119663365 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :that is what concerns me most is that there was only one reviewer and judge last year < 1119663367 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :(from last year, anyways) < 1119663420 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :calamari: I think that it will be the same this year < 1119663437 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :aha, another response: VIC-20 text adventures used to require at least 3K of RAM expansion, and sometimes 8K. Some text adventures were written that barely fit into the 3,584 bytes of RAM afforded by an unexpanded VIC, but they were barely playable. That is why a "playable" text adventure needs at least 8K of data. < 1119663548 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :ACTION shrugs < 1119663555 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :i'll just write something i like < 1119663561 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :yeah, sounds good < 1119663636 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :cpressey: I have only ever written for myself, I don't believe that there is any other honest ay work < 1119663652 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :*way to write < 1119663659 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :raven: for work < 1119663681 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :{^Raven^}: perhaps we have < 1119663692 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :although i haven't written any < 1119663758 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :the only thing i ever did for IF was some sort of language that compiled to Scott Adams' platform < 1119663766 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :and i never even released that < 1119663842 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :aha, http://www.ifwiki.org/index.php/Scott_Adams < 1119663845 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric ::) < 1119666150 0 :heatsink!unknown@unknown.invalid QUIT :"Leaving" < 1119666562 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :ACTION if off to bed (to watch Highlander) < 1119666706 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :goodnite peeps < 1119668288 0 :graue!unknown@unknown.invalid PART #esoteric :? < 1119672882 0 :watermellonz!ladpuddy@as5800-1.216-194-0-199.nyc.ny.metconnect.net JOIN :#esoteric < 1119672894 0 :watermellonz!unknown@unknown.invalid PART #esoteric :? < 1119673370 0 :calamari!unknown@unknown.invalid QUIT :Read error: 145 (Connection timed out) < 1119676193 0 :malaprop!unknown@unknown.invalid QUIT :brown.freenode.net irc.freenode.net < 1119676197 0 :lindi-!unknown@unknown.invalid QUIT :brown.freenode.net irc.freenode.net < 1119676197 0 :puzzlet!unknown@unknown.invalid QUIT :brown.freenode.net irc.freenode.net < 1119676197 0 :fizzie!unknown@unknown.invalid QUIT :brown.freenode.net irc.freenode.net < 1119676197 0 :deltab!unknown@unknown.invalid QUIT :brown.freenode.net irc.freenode.net < 1119676197 0 :ChanServ!unknown@unknown.invalid QUIT :brown.freenode.net irc.freenode.net < 1119676198 0 :cpressey!unknown@unknown.invalid QUIT :brown.freenode.net irc.freenode.net < 1119676201 0 :{^Raven^}!unknown@unknown.invalid QUIT :brown.freenode.net irc.freenode.net < 1119676202 0 :CXI!unknown@unknown.invalid QUIT :brown.freenode.net irc.freenode.net < 1119676202 0 :pgimeno!unknown@unknown.invalid QUIT :brown.freenode.net irc.freenode.net < 1119676202 0 :cmeme!unknown@unknown.invalid QUIT :brown.freenode.net irc.freenode.net < 1119676202 0 :mtve!unknown@unknown.invalid QUIT :brown.freenode.net irc.freenode.net < 1119676204 0 :ZeroOne!unknown@unknown.invalid QUIT :brown.freenode.net irc.freenode.net < 1119676349 0 :ChanServ!ChanServ@services. JOIN :#esoteric < 1119676349 0 :CXI!Sanity@dialup-215.89.221.203.acc50-kent-syd.comindico.com.au JOIN :#esoteric < 1119676349 0 :malaprop!~ph@adsl-69-208-101-159.dsl.chcgil.ameritech.net JOIN :#esoteric < 1119676349 0 :pgimeno!pgimeno@124.Red-80-59-211.pooles.rima-tde.net JOIN :#esoteric < 1119676349 0 :lindi-!~lindi@kulho150.adsl.netsonic.fi JOIN :#esoteric < 1119676349 0 :cpressey!nobody@d154-20-76-195.bchsia.telus.net JOIN :#esoteric < 1119676349 0 :puzzlet!~puzzlet@61.247.148.38 JOIN :#esoteric < 1119676349 0 :fizzie!fis@sesefras.tky.hut.fi JOIN :#esoteric < 1119676349 0 :deltab!~deltab@82-46-140-217.cable.ubr02.smal.blueyonder.co.uk JOIN :#esoteric < 1119676349 0 :{^Raven^}!~{^Raven^}@82-38-204-252.cable.ubr05.shef.blueyonder.co.uk JOIN :#esoteric < 1119676349 0 :cmeme!~cmeme@216.184.11.2 JOIN :#esoteric < 1119676349 0 :ZeroOne!~vsaalo@kekkonen.cs.hut.fi JOIN :#esoteric < 1119676349 0 :mtve!mtve@mtve.vm.jvds.com JOIN :#esoteric < 1119676349 0 :irc.freenode.net!unknown@unknown.invalid MODE #esoteric :+o ChanServ < 1119676831 0 :malaprop!unknown@unknown.invalid QUIT :brown.freenode.net irc.freenode.net < 1119676836 0 :puzzlet!unknown@unknown.invalid QUIT :brown.freenode.net irc.freenode.net < 1119676836 0 :lindi-!unknown@unknown.invalid QUIT :brown.freenode.net irc.freenode.net < 1119676836 0 :fizzie!unknown@unknown.invalid QUIT :brown.freenode.net irc.freenode.net < 1119676836 0 :deltab!unknown@unknown.invalid QUIT :brown.freenode.net irc.freenode.net < 1119676836 0 :ChanServ!unknown@unknown.invalid QUIT :brown.freenode.net irc.freenode.net < 1119676837 0 :cpressey!unknown@unknown.invalid QUIT :brown.freenode.net irc.freenode.net < 1119676838 0 :{^Raven^}!unknown@unknown.invalid QUIT :brown.freenode.net irc.freenode.net < 1119676840 0 :pgimeno!unknown@unknown.invalid QUIT :brown.freenode.net irc.freenode.net < 1119676840 0 :mtve!unknown@unknown.invalid QUIT :brown.freenode.net irc.freenode.net < 1119676840 0 :cmeme!unknown@unknown.invalid QUIT :brown.freenode.net irc.freenode.net < 1119676840 0 :ZeroOne!unknown@unknown.invalid QUIT :brown.freenode.net irc.freenode.net < 1119676840 0 :CXI!unknown@unknown.invalid QUIT :brown.freenode.net irc.freenode.net < 1119676924 0 :ChanServ!ChanServ@services. JOIN :#esoteric < 1119676924 0 :CXI!Sanity@dialup-215.89.221.203.acc50-kent-syd.comindico.com.au JOIN :#esoteric < 1119676924 0 :malaprop!~ph@adsl-69-208-101-159.dsl.chcgil.ameritech.net JOIN :#esoteric < 1119676924 0 :pgimeno!pgimeno@124.Red-80-59-211.pooles.rima-tde.net JOIN :#esoteric < 1119676924 0 :lindi-!~lindi@kulho150.adsl.netsonic.fi JOIN :#esoteric < 1119676924 0 :cpressey!nobody@d154-20-76-195.bchsia.telus.net JOIN :#esoteric < 1119676924 0 :mtve!mtve@mtve.vm.jvds.com JOIN :#esoteric < 1119676924 0 :ZeroOne!~vsaalo@kekkonen.cs.hut.fi JOIN :#esoteric < 1119676924 0 :cmeme!~cmeme@216.184.11.2 JOIN :#esoteric < 1119676924 0 :{^Raven^}!~{^Raven^}@82-38-204-252.cable.ubr05.shef.blueyonder.co.uk JOIN :#esoteric < 1119676924 0 :deltab!~deltab@82-46-140-217.cable.ubr02.smal.blueyonder.co.uk JOIN :#esoteric < 1119676924 0 :fizzie!fis@sesefras.tky.hut.fi JOIN :#esoteric < 1119676924 0 :puzzlet!~puzzlet@61.247.148.38 JOIN :#esoteric < 1119676924 0 :irc.freenode.net!unknown@unknown.invalid MODE #esoteric :+o ChanServ < 1119676990 0 :malaprop!unknown@unknown.invalid QUIT :"sleep" < 1119686399 0 :clog!unknown@unknown.invalid QUIT :ended < 1119686400 0 :clog!unknown@unknown.invalid JOIN :#esoteric < 1119695432 0 :jix!jix@p5489F07B.dip.t-dialin.net JOIN :#esoteric < 1119701352 0 :tokigun!~tokigun@219.248.202.20 JOIN :#esoteric < 1119702438 0 :J|x!jix@p5489AD3C.dip.t-dialin.net JOIN :#esoteric < 1119702472 0 :jix!unknown@unknown.invalid QUIT :Nick collision from services. < 1119702474 0 :J|x!unknown@unknown.invalid NICK :jix < 1119709106 0 :tokigun!unknown@unknown.invalid QUIT :Read error: 104 (Connection reset by peer) < 1119709264 0 :tokigun!~tokigun@219.248.202.20 JOIN :#esoteric < 1119726085 0 :calamari!~jeffryj@lilly.csoft.net JOIN :#esoteric < 1119726090 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :hi < 1119726406 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :moin calamari < 1119726918 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :hi jix, how's it going? < 1119726939 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :quite a few people are making games now, or at least planning to :) < 1119726984 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :hi < 1119726994 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :hi raven < 1119727074 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :calamari: I finally figured out the syntax of the BFBASIC BF command :) < 1119727086 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :haha.. not much syntax there to be found ;) < 1119727119 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :what did you need it for? needing that is generally a bad sign < 1119727139 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :i dunno, it's nice writing otherwise pure brainfuck with just a few @myvar's scattered in < 1119727177 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :looking at it for code optimisation mainly < 1119727182 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :oh, yeah.. didn't think of that! < 1119727238 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :instead of myvar=2 using BF @myvar[-]++ < 1119727241 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :although I'm pretty sure I came up with the @ syntax, but who knows, my memory could be going < 1119727260 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :yeah.. it makes it a lot easier to see what is going on < 1119727263 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :i like that the BF statement doesn't have any pre/post code around it < 1119727306 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :are array elements supposed to be 2 cells wide? < 1119727309 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :of course.. then it wouldn't be raw. Although, it might have post code before it < 1119727316 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :yeah, 2 elements < 1119727327 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :cells, whatever :) < 1119727341 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :one is used for data, the other for movement < 1119727376 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :ahh, i;'m not sure if it's me but BF @array(1)[-]@array(2) generates (>>>etc)[-]>[-] < 1119727391 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :instead of (>>>etc)[-]>>[-] < 1119727398 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :there are 3 cells leading the array as well < 1119727417 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :x b a (or x a b), can't remember < 1119727472 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :I think I documented it somewhat on the wiki < 1119727588 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :iirc, the way it works is: 1) movement cells start off as 0's. 2) take element index we want to find, do [>>] which gives us an empty movement cell, increment it, do [<<] to get back, decrement the index, repeat until index =0.. so now the movement cells are populated with 1's, and we can do something like [>>]< or [>>]> to get to the data cell < 1119727621 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :3) transwer the data with a simple add loop, using [>>] and [<<] instead of > <.. < 1119727624 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :do arrays have a zeroth cell? < 1119727642 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :of course there are all the fine details that go along with getting it right, but that's the basic idea of how it works < 1119727644 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :yeah < 1119727681 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :I'd check the 0 cell, 1 cell, and max cell, max-1, max+1 < 1119727689 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :err cell -> element < 1119727699 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :just to make sure everything is working as expected < 1119727715 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :it's likely that one of those is where the bug is < 1119727748 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :ACTION has been having fun researching his game < 1119727755 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :yeah, I am getting the impression that arrays are not always contigous < 1119727775 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :i will play with using BF to simplify tracking < 1119727784 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :it's possible that a movement cell is not getting cleared out and it's going off to lala land < 1119727827 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :I have my bit debugger pretty close to done.. I should do a bf version, since I like the interface < 1119727857 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :that would make this sort of thing a LOT easier to debug, than trying to do it by hand < 1119728044 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :I'd be done with the bit debigger already, but I ran into a problem the other day.. if the program was running, I couldn't stop it, because it was using the same thread as Swing. I could use multiple threads, but I lose a bit of control, and can't do certain things. But, the other night I realized that I could just use step, and a special runnign flag, so the view knows when the model is done running. < 1119728069 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :That way it's all in one thread, and it'll be cool because you'd see the highlighted instruction moving as it ran < 1119728096 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :It also makes possible the Pass button (for running iuntil a loop is done) < 1119728114 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :so anyhow, yeah.. it is almost done, just got caught up in this adventure game stuff :) < 1119728127 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :I need to get to other work tho.. so afk < 1119728223 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :have fun < 1119729334 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :ACTION is playing with a version of BFBSAIC that doesn't expand @var's into arrows < 1119729399 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :ACTION is doing dishonest programming.. or whatever it was you called it the other day :) < 1119734317 0 :calamari!unknown@unknown.invalid QUIT :"bbl" < 1119737652 0 :J|x!jix@p5489AD3C.dip.t-dialin.net JOIN :#esoteric < 1119738378 0 :jix!unknown@unknown.invalid QUIT :Read error: 110 (Connection timed out) < 1119739761 0 :Keymaker!~Not@wire74.adsl.netsonic.fi JOIN :#esoteric < 1119739772 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :'ello < 1119740380 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :are anybody here? < 1119740454 0 :ChanServ!unknown@unknown.invalid QUIT :Shutting Down < 1119740480 0 :ChanServ!ChanServ@services. JOIN :#esoteric < 1119740480 0 :irc.freenode.net!unknown@unknown.invalid MODE #esoteric :+o ChanServ < 1119740734 0 :J|x!unknown@unknown.invalid NICK :jix < 1119740745 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :Keymaker: me is here < 1119740890 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :me sees now < 1119741377 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :ACTION is vauguely around < 1119741841 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric ::) < 1119743099 0 :tokigun!unknown@unknown.invalid QUIT :"Chatzilla 0.9.68.5 [Firefox 1.0.3/20050414]" < 1119743105 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :d'oh!!!!!! < 1119743112 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :i was just writing a question for tokigun < 1119743123 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :well, anyways, maybe someone other knows.. < 1119743148 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :so, does a whirl program start from the beginning again if there is no 'terminate program' instruction? < 1119743461 0 :Keymaker!unknown@unknown.invalid QUIT :"I've seen this déjà vu before.." < 1119749861 0 :ZeroOne!unknown@unknown.invalid PRIVMSG #esoteric :I don't think so, Keymaker, but you can always try how the reference interpreter works. < 1119751801 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :i'm writing 99 bottles in lazy-k < 1119756968 0 :jix!unknown@unknown.invalid QUIT :"Banned from network" < 1119757121 0 :calamari!~jeffryj@lilly.csoft.net JOIN :#esoteric < 1119757123 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :hi < 1119757170 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :I just noticed that the latest wiki dump I downloaded was smaller than the last dump... is that logical? < 1119759318 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :bbl < 1119759319 0 :calamari!unknown@unknown.invalid QUIT :"Leaving" < 1119760674 0 :mickoko!~mickoko@202-59-108-119.dyn.iinet.net.au JOIN :#esoteric < 1119760716 0 :mickoko!unknown@unknown.invalid PART #esoteric :? < 1119768434 0 :calamari!~calamari@dialup-4.240.114.211.Dial1.Phoenix1.Level3.net JOIN :#esoteric < 1119769059 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :hi < 1119772799 0 :clog!unknown@unknown.invalid QUIT :ended < 1119772800 0 :clog!unknown@unknown.invalid JOIN :#esoteric < 1119773659 0 :BigZaphod!~BigZaphod@66.6.34.219 JOIN :#esoteric < 1119774211 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :hi zaphod < 1119774432 0 :BigZaphod!unknown@unknown.invalid PRIVMSG #esoteric :hey < 1119774806 0 :BigZaphod!unknown@unknown.invalid PRIVMSG #esoteric :This is my first time here. :) < 1119774882 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :welcome < 1119774895 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :did you find us from the wiki? :) < 1119775070 0 :BigZaphod!unknown@unknown.invalid PRIVMSG #esoteric :Yes. Actually, in a rather round-about way. I was googling one of my own languages Whirl. < 1119775075 0 :BigZaphod!unknown@unknown.invalid PRIVMSG #esoteric :Found references to here. :) < 1119775103 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :hehe < 1119779105 0 :calamari!unknown@unknown.invalid QUIT :"Leaving" < 1119779569 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :hi < 1119782749 0 :jix!jix@p5489AD3C.dip.t-dialin.net JOIN :#esoteric < 1119783625 0 :Keymaker!~a@wire74.adsl.netsonic.fi JOIN :#esoteric < 1119783664 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :hmm < 1119783704 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :bigzaphod.. whirl inventor? < 1119783803 0 :tokigun!~tokigun@219.248.202.39 JOIN :#esoteric < 1119783862 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :tokigun! < 1119783872 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :i've a question < 1119783885 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :hello < 1119783891 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :hi < 1119783910 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :hmm < 1119783922 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :eh... what is your question? < 1119783928 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :oh < 1119783933 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :sorry :) wait a bit < 1119783938 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :;) < 1119783956 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :yesterday i was asking here that do whirl programs require that terminate instruction < 1119783962 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :but i guess they don't < 1119783977 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :yes terminate instruction is not required < 1119783987 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :but i added it for complete program < 1119783992 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :yeah < 1119784000 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :in case of beer song ;) < 1119784009 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :yeah < 1119784012 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :anyways; < 1119784013 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :1100 < 1119784013 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :00 < 1119784013 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :111100 < 1119784019 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :why doesn't that program work? < 1119784023 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :it should print 0 < 1119784040 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :hmm < 1119784048 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :1100 -- op::one < 1119784051 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :00 -- math::noop < 1119784060 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :111100 -- op::padd < 1119784088 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :if you want to print 0 use op::intio instruction instead. < 1119784092 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :hmm.. there must be then something wrong the way i thought < 1119784100 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :i thought it did: < 1119784135 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :11 move to One 00 execute it, change ring < 1119784141 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :yes < 1119784143 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :00 NOP, change ring < 1119784156 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :1111 move to IntIO < 1119784159 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :hmm < 1119784161 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :00 execute it < 1119784180 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :Keymaker: you have to use 0111100 instead of 111100 < 1119784188 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :nope < 1119784201 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :ah < 1119784207 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :sorry, i read "have you used" < 1119784209 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric ::) < 1119784211 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :;) < 1119784230 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :but < 1119784243 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :doesn't the direction of ring stay when you switch it? < 1119784247 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :when 111100 is executed, it selects 6th (not -2th == 10th) instruction < 1119784259 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :hmm < 1119784273 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :0 changes the direction of ring < 1119784282 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :but i thought the first line "1100" < 1119784288 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :changes it to anticlockwise < 1119784296 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :00 changes the direction of ring twice, executes the selected instruction, and so on.. < 1119784303 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :ah < 1119784314 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :no. it changes the direction "twice". < 1119784322 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :so the direction changes every time there is 0 < 1119784323 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :ah < 1119784325 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :yes ;) < 1119784374 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :ah this clears it. i thought the direction doesn't change if the zero executes instruction :) < 1119784378 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :well, now i can go and fix this < 1119784386 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :hehe < 1119784416 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :i've returned home... good :) < 1119784422 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric ::) < 1119784433 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :now the program works < 1119784436 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :it prints 0 < 1119784438 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :nice < 1119784439 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric ::D < 1119784458 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :i'll make it print unix new-line as well < 1119784469 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :btw, i'm using your c interpreter. it's great < 1119784699 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :haha... < 1119784714 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :it doesn't have debugger, though ;) < 1119784731 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :yeah, something option showing memory states would be useful < 1119784784 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :question; < 1119784807 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :if there is a jump where the instruction pointer is moved.. what if it goes outside the program? < 1119784812 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :should the program end? < 1119784831 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :as well, does whirl support negative numbers? that jump to left and right can be done? < 1119784965 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :hmm < 1119784975 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :first whirl supports negative numbers < 1119784987 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :ok < 1119784988 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :so you can move memory pointer left or right < 1119784994 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :ok < 1119785003 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :but what about the jump outside the program? < 1119785007 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :hmm < 1119785059 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :my interpreter can handle it.. but maybe it is user-defineded. < 1119785063 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :s/eded/ed/ < 1119785102 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :hmm < 1119785111 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :the author *cough bigzaphod* should clear some things on the web site.. < 1119785117 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric ::) < 1119785119 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric ::) < 1119785141 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :wait a moment < 1119785197 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :in this case, his interpreter terminates immediately. < 1119785206 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :ok < 1119785211 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :terminates program < 1119785214 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :ok < 1119785232 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :and my interpreter terminates program when memory pointer > program upper bound, < 1119785250 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :and return to first instruction when memory pointer < program lower bound (that is origin) < 1119785268 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :ok < 1119785335 0 :tokigun!unknown@unknown.invalid NICK :tokigun^away < 1119785771 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :i can't understand english. does "Sets value to memval." mean that 'value' gets the value of 'memval'? < 1119786397 0 :puzzlet!unknown@unknown.invalid PRIVMSG #esoteric :tokigun: bigzaphod is here < 1119787310 0 :tokigun^away!unknown@unknown.invalid NICK :tokigun < 1119787313 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :back < 1119787316 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :puzzlet: oh. < 1119787911 0 :Keymaker!unknown@unknown.invalid PART #esoteric :? < 1119789023 0 :J|x!jix@p5489FFD4.dip.t-dialin.net JOIN :#esoteric < 1119789063 0 :jix!unknown@unknown.invalid QUIT :Nick collision from services. < 1119789065 0 :J|x!unknown@unknown.invalid NICK :jix < 1119789107 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :my 99bob in lazy k is done < 1119789161 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :it's about the size of the whirl 99bob .. and has the same obfuscation amount < 1119790767 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :ACTION ponders orthogonal 8-bit RISC processor design and layout of 16-bit opcodes < 1119793038 0 :hashendgame!~hashendga@d220-236-4-89.dsl.nsw.optusnet.com.au JOIN :#esoteric < 1119799236 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :ACTION finished pondering orthoganal processor design < 1119799670 0 :Kmkr!~a@wire74.adsl.netsonic.fi JOIN :#esoteric < 1119799730 0 :Kmkr!unknown@unknown.invalid PRIVMSG #esoteric :'ello < 1119799736 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :hi there < 1119799737 0 :Kmkr!unknown@unknown.invalid PRIVMSG #esoteric :couldn't use name Keymaker < 1119799748 0 :Kmkr!unknown@unknown.invalid PRIVMSG #esoteric :this thing said it was token < 1119799772 0 :Kmkr!unknown@unknown.invalid PRIVMSG #esoteric :jix: sounds really cool < 1119799778 0 :Kmkr!unknown@unknown.invalid PRIVMSG #esoteric :can't wait to see the program < 1119799804 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :kmkr: have you done /whois keymaker < 1119799809 0 :Kmkr!unknown@unknown.invalid PRIVMSG #esoteric :no < 1119799840 0 :Kmkr!unknown@unknown.invalid PRIVMSG #esoteric :hmm, seems to be some french dude < 1119799863 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :i recommend that you register Keymaker at the next opportunity < 1119799880 0 :Kmkr!unknown@unknown.invalid PRIVMSG #esoteric :he has probably registered it already < 1119799916 0 :Kmkr!unknown@unknown.invalid PRIVMSG #esoteric :as well, i didn't feel like trying to register it, since that system was strange. i couldn't use it < 1119800528 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :i'v had enough of enough brainfuck for the moment, gonna take a break < 1119800680 0 :Kmkr!unknown@unknown.invalid PRIVMSG #esoteric ::) < 1119801215 0 :hashendgame!unknown@unknown.invalid QUIT :"Leaving" < 1119801220 0 :Kmkr!unknown@unknown.invalid PRIVMSG #esoteric :hmm < 1119801236 0 :Kmkr!unknown@unknown.invalid PRIVMSG #esoteric :can one send another version for some language to that 99 bottles of beer list? < 1119801249 0 :Kmkr!unknown@unknown.invalid PRIVMSG #esoteric :if i remember correct i've seen some language have several versions < 1119801272 0 :Kmkr!unknown@unknown.invalid PRIVMSG #esoteric :perl for example < 1119805473 0 :BigZaphod!unknown@unknown.invalid PRIVMSG #esoteric :Hey tokigun. Nice to finally "meet" the world's best whirl programmer. :) < 1119806566 0 :tokigun!unknown@unknown.invalid QUIT :Read error: 110 (Connection timed out) < 1119809261 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :Kmkr: http://rafb.net/paste/results/hExqvL26.html < 1119809303 0 :Kmkr!unknown@unknown.invalid PRIVMSG #esoteric :nice :) can't understand anything < 1119809330 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :the first part is the scheme-like code.. the 2nd part is se lazy k code < 1119809356 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :and i think you can't understand anything in the whirl 99bob < 1119809560 0 :Kmkr!unknown@unknown.invalid PRIVMSG #esoteric :me? in whirl it's possible but takes time :) < 1119809605 0 :Kmkr!unknown@unknown.invalid PRIVMSG #esoteric :well, here is the boring 99bob in c i made: < 1119809606 0 :Kmkr!unknown@unknown.invalid PRIVMSG #esoteric :#include /* written by Keymaker :) */ < 1119809606 0 :Kmkr!unknown@unknown.invalid PRIVMSG #esoteric :int main(){int a[9]={0,1,2,0,2,3,0,1,2},b=99,c;while(b>0){for(c=0;c<9;c++){ < 1119809606 0 :Kmkr!unknown@unknown.invalid PRIVMSG #esoteric :if(a[c]==0){if(b==0){printf("no more");}else{printf("%i",b);}printf(" bottle"); < 1119809606 0 :Kmkr!unknown@unknown.invalid PRIVMSG #esoteric :if(b!=1){printf("s");}printf(" of beer");}if(a[c]==1){printf(" on the wall");} < 1119809606 0 :Kmkr!unknown@unknown.invalid PRIVMSG #esoteric :if(a[c]==2){if(c==2){printf(", ");}else{printf(".\n");}}if(a[c]==3){ < 1119809607 0 :Kmkr!unknown@unknown.invalid PRIVMSG #esoteric :printf("Take one down and pass it around, ");b--;}}printf("\n");}} < 1119809643 0 :Kmkr!unknown@unknown.invalid PRIVMSG #esoteric :i don't submit it to 99-bottles-of-beer, since i just noticed ther reads they don't want anymore c examples of the program < 1119809701 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :Kmkr: if you take a look at the first part (the non-compiled version) it's even easier to understand as the whirl code < 1119809759 0 :Kmkr!unknown@unknown.invalid PRIVMSG #esoteric :yes < 1119810287 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :i think it's fun writing BASIC => Esolang converters < 1119810298 0 :Kmkr!unknown@unknown.invalid PRIVMSG #esoteric :never tried :) < 1119810315 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :i didn't but i think it's fun < 1119810329 0 :Kmkr!unknown@unknown.invalid PRIVMSG #esoteric :extra fun when you write the converter in the esolang < 1119810392 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :hehe < 1119810443 0 :Kmkr!unknown@unknown.invalid PRIVMSG #esoteric :i think i'll write a new version of my beer.b < 1119810481 0 :Kmkr!unknown@unknown.invalid PRIVMSG #esoteric :there's 1003 ways to get it shorter < 1119810631 0 :Kmkr!unknown@unknown.invalid PRIVMSG #esoteric :must go. < 1119810633 0 :Kmkr!unknown@unknown.invalid PART #esoteric :? < 1119816030 0 :BigZaphod!unknown@unknown.invalid PRIVMSG #esoteric :3code 99 bottles: http://www.bigzaphod.org/3code/bigzaphod-99bottles.txt < 1119816036 0 :BigZaphod!unknown@unknown.invalid PRIVMSG #esoteric :not terribly impressive, but it was fun. < 1119822156 0 :calamari!~calamari@dialup-4.240.150.128.Dial1.Phoenix1.Level3.net JOIN :#esoteric < 1119822159 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :hi < 1119822302 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :jix: bitdebug 1.00 is ready: http://kidsquid.com/programs/bf/bf.html < 1119822327 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :let me know which bugs you find :) < 1119822533 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :hi calamari < 1119822826 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :hi raven < 1119822833 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :working on the bf port of that debugger :) < 1119822862 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :working on a BF related project myself < 1119822865 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :if there's anything about the bit one that needs fixing, let me know so I can put it in the bf version < 1119823950 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :wow, that was easier than I thought < 1119823995 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :Only thing left is allow clicking memory to change it.. was easier with bits because it could just flip.. will need a dialog this time, though :) < 1119824154 0 :BigZaphod!unknown@unknown.invalid QUIT : < 1119824155 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :and its way slow because of all the graphics.. not great for running programs.. just debugging them < 1119825118 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :raven: check it out, http://kidsquid.com/programs/bf/bf.html < 1119825155 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :will do, am hitting BFBASIC bugs right now < 1119825158 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :I should put my array code in and test it < 1119825161 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :cool < 1119825203 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :array(var)=array(var2)+var3 (or -var3) does not work < 1119825472 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :calamari: default file mask for file>open could be *.b;*.bf < 1119825503 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :calamari: input box does not seem to accept input in range 00-FF < 1119825601 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :really? it should accept any decimal < 1119825631 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :unless you mean the input tab? < 1119825643 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :the input tab < 1119825654 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :seems limited to printable characters < 1119825758 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :hmm yeah.. probably is, unless it's pasted in < 1119825775 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :even when pasted. < 1119825837 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :test code starts [.] debugger cannot get past that. skipped to [-] and it gets stuck there too even though cell is set to 0 < 1119825888 0 :jix!unknown@unknown.invalid QUIT :"Banned from network" < 1119825915 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :I don't follow you on that last bug report < 1119825933 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :if you're changing the program in the middle of a run, that could cause problems < 1119825944 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :BF debugger cannot leave a loop < 1119825994 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :that'd be weird, because I was able to run the standard hellow world type stuff, the triangle, etc < 1119826026 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :is file>open supposed to load the code into the program tab? it is not doing that here < 1119826035 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :yeah, it's supposed to < 1119826035 0 :heatsink!~heatsink@c-24-61-94-111.hsd1.nh.comcast.net JOIN :#esoteric < 1119826063 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :so much for write once run anywhere :/ < 1119826082 0 :heatsink!unknown@unknown.invalid PRIVMSG #esoteric :you didn't write it in java, DID YOU? < 1119826088 0 :heatsink!unknown@unknown.invalid PRIVMSG #esoteric :;p < 1119826092 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :hehe < 1119826106 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :ok, gonna stop using the evil OS now < 1119826137 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :oh, were you trying it in windows? < 1119826149 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :do you know how I can start your program from a unix shell (to load it on X-Windows) < 1119826152 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :I was < 1119826161 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :java -jar filename.jar < 1119826204 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :hmmm, gotta be doing it wrong, that command gives me a pile of exception errors < 1119826213 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :nice < 1119826218 0 :cmeme!unknown@unknown.invalid QUIT :Read error: 104 (Connection reset by peer) < 1119826237 0 :lindi-!unknown@unknown.invalid PRIVMSG #esoteric :nice, more programs to try.. < 1119826241 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :ACTION tries it .. works here.. I'm runnign 1.5 tho < 1119826290 0 :cmeme!~cmeme@216.184.11.2 JOIN :#esoteric < 1119826306 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :using gij 3.2.3 here < 1119826309 0 :cmeme!unknown@unknown.invalid QUIT :Remote closed the connection < 1119826351 0 :cmeme!~cmeme@216.184.11.2 JOIN :#esoteric < 1119826393 0 :lindi-!unknown@unknown.invalid PRIVMSG #esoteric :{^Raven^}: great. i'm using jamvm 1.3.0 with gnu classpath cvs head < 1119826413 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :ACTION has never been any good at getting 'real' java installed on his server and uses the default GNU version instead < 1119826536 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :ACTION just downloaded it from sun.. didn't even use those fancy installer script thingys < 1119826541 0 :lindi-!unknown@unknown.invalid PRIVMSG #esoteric :{^Raven^}: very nice, let me know if you see any bugs so i can test them with the latest version < 1119826636 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :lindi: bfdebug-100 won't even run on my gij...and it dosn't work as expected using sun java on Windows < 1119826643 0 :lindi-!unknown@unknown.invalid PRIVMSG #esoteric :seems i've reported 25 bugs during the last 37 days :) < 1119826679 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :raven: really weird that it doesn't work on windows, since I'm not really doing anything nonstandard this time < 1119826694 0 :lindi-!unknown@unknown.invalid PRIVMSG #esoteric :{^Raven^}: gij-3.3 is quite old in that respect, a lot has happened to swing after that < 1119826705 0 :lindi-!unknown@unknown.invalid PRIVMSG #esoteric :calamari: are you sure? ;) < 1119826735 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :lindi: lol.. I think it's impossible to say for sure < 1119826739 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :ACTION goes to download sun java (and hopes it doesn't break anything) < 1119826750 0 :lindi-!unknown@unknown.invalid PRIVMSG #esoteric :calamari: esoshell had some nice gems, like this one: https://savannah.gnu.org/bugs/?func=detailitem&item_id=13254 < 1119826766 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :esoshell was definitely doing some nonstandard stuff < 1119826773 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :calamari: I've got a really nice BFBASIC program in the making < 1119826780 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :I was overriding swing methods, etc < 1119826818 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :raven: cool, basic program, or bfbasic java program? < 1119826850 0 :lindi-!unknown@unknown.invalid PRIVMSG #esoteric :calamari: anyways, those swing programs are really create testcases for improving gnu classpath < 1119826855 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :basic program < 1119826953 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :i am finding more bugs in BFBASIC but nothing I have been able to solve < 1119826956 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :adventure game, or something new? spill it ;) < 1119826963 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :ok... < 1119826964 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :thanks for fixing on bfbasic < 1119826975 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :be sure to commit to the cvs repos :) < 1119826996 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :i will do if I ever manage to work out how to fix any bugs < 1119827016 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :ACTION doesn't know java < 1119827031 0 :lindi-!unknown@unknown.invalid PRIVMSG #esoteric :{^Raven^}: what OS are you using btw? < 1119827036 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :ACTION doesn't know Java either, apparently < 1119827084 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :lindi-: what for? I am using RISC OS, Linux (Whitebox RHEL3.0) and WinXP Pro interchangably atm < 1119827126 0 :lindi-!unknown@unknown.invalid PRIVMSG #esoteric :{^Raven^}: fedora core 4 comes with a large collection of java programs compiled with gcj < 1119827139 0 :lindi-!unknown@unknown.invalid PRIVMSG #esoteric :{^Raven^}: and on debian you could just apt-get install free-java-sdk < 1119827170 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :lindi-: I need to find an rpm / other installer < 1119827188 0 :lindi-!unknown@unknown.invalid PRIVMSG #esoteric :hmm, for what? < 1119827202 0 :lindi-!unknown@unknown.invalid PRIVMSG #esoteric :sun's proprietary stuff? < 1119827208 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :ACTION often writes software on RISC OS, compiles it on Unix and runs it on Windows (and any variation thereof) < 1119827246 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :I need a more recent java+SDK that will just install and work, any suggestions < 1119827247 0 :lindi-!unknown@unknown.invalid PRIVMSG #esoteric :i wish i knew brainfuck more so i could test this bfdebug better < 1119827297 0 :lindi-!unknown@unknown.invalid PRIVMSG #esoteric :{^Raven^}: i can recommend jamvm if you want to help out in testing gnu classpath < 1119827361 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :ACTION should do that < 1119827389 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :I could never contribute, though.. because I've looked at all kinds of sun code trying to figure out things < 1119827400 0 :lindi-!unknown@unknown.invalid PRIVMSG #esoteric :you can contribute by testing < 1119827449 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :calamari: My program is an emulator for an 8-bit RISC CPU < 1119827456 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :coolness < 1119827470 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :bet that's slow :P < 1119827545 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :not really slow, Hello World runs in less than a second < 1119827588 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :I want to see if a RISC CPU with an orthoganl instruction set can be emulated by brainfuck < 1119827637 0 :lindi-!unknown@unknown.invalid PRIVMSG #esoteric :calamari: Interpreter.java has _memory.add(Integer.valueOf(0)); but there's no such method valueOf(int) in Integer < 1119827654 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :lindi: that must be 1.5 < 1119827657 0 :lindi-!unknown@unknown.invalid PRIVMSG #esoteric :there's only valueOf(String s) and valueOf(String s, int radix) < 1119827661 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :err wait < 1119827677 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :ACTION checks his java book < 1119827701 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :I wanted Integer.getInteger < 1119827717 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :but valueOf is a method < 1119827722 0 :lindi-!unknown@unknown.invalid PRIVMSG #esoteric :still, i want to sort this out. where is valueOf(int) documented? < 1119827745 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :one sec, I'll check it out for ya < 1119827775 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :1.5.. checked the sun source < 1119827788 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :it's part of all that int wrapper crap < 1119827793 0 :lindi-!unknown@unknown.invalid PRIVMSG #esoteric : /clear < 1119827799 0 :lindi-!unknown@unknown.invalid PRIVMSG #esoteric :better not paste it here :) < 1119827806 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :not gonna paste anything < 1119827816 0 :lindi-!unknown@unknown.invalid PRIVMSG #esoteric :but is there any public documentation on that one? < 1119827844 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :is the javadoc from the code considered public? < 1119827869 0 :lindi-!unknown@unknown.invalid PRIVMSG #esoteric :no, not from the code < 1119827884 0 :lindi-!unknown@unknown.invalid PRIVMSG #esoteric :but if sun has published it in a book or on their web page, then yes < 1119827892 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :yeah, let me find it ;) < 1119827931 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :I have the feeling I know exactly what to search for hehe < 1119827940 0 :lindi-!unknown@unknown.invalid PRIVMSG #esoteric :ah, found it < 1119827981 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :http://java.sun.com/j2se/1.5.0/docs/api/java/lang/Integer.html < 1119827994 0 :lindi-!unknown@unknown.invalid PRIVMSG #esoteric :yeah, that's what i found < 1119828010 0 :lindi-!unknown@unknown.invalid PRIVMSG #esoteric :i'll write some quick'and'dirty version and check if it works < 1119828056 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :are you going to handle the caching? < 1119828096 0 :lindi-!unknown@unknown.invalid PRIVMSG #esoteric :not sure how it should be done, i'll ask on #classpath < 1119828351 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :hmm actually I needed new Integer(i) to replace it :) < 1119828386 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :raven: probably explains why it wasn't working in windows :) < 1119828401 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :wonder if I'm using any other 1.5 code.. wish there was an easy way to find out < 1119828464 0 :lindi-!unknown@unknown.invalid PRIVMSG #esoteric :i thought there was < 1119828477 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :some kind of tool that'll tell me? < 1119828486 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :I'll ask in #java < 1119828507 0 :Kmkr!~a@wire74.adsl.netsonic.fi JOIN :#esoteric < 1119828555 0 :Kmkr!unknown@unknown.invalid PRIVMSG #esoteric :hi < 1119828568 0 :Kmkr!unknown@unknown.invalid PRIVMSG #esoteric :sounds like an interesting project raven < 1119828568 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :kmkr: the french dude(tte) has logged off < 1119828577 0 :Kmkr!unknown@unknown.invalid PRIVMSG #esoteric :ah < 1119828580 0 :Kmkr!unknown@unknown.invalid NICK :Keymaker < 1119828583 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric ::) < 1119828604 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :Keymaker: it is. I just wanted to see if it was possible and it most definately can be done < 1119828619 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :yeah, everything can be done with brainfuck!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! < 1119828624 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :hello world works perfectly < 1119828639 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :what is that orthagonal or something instruction set? < 1119828647 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :and what the hello world looks like in that? < 1119828732 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :the simple version is (in assembler) just MOV r0,#72:OUT r0:MOV r0,#101:OUT r0:etc:RET < 1119828758 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :ah < 1119828783 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :each instruction is assembled to a 16-bit word by a seperate program, the object code is loaded and executed by the emulated CPU < 1119828870 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :it's only 36Kb of brainfuck (compiled BFBASIC) so far < 1119828883 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric ::) < 1119828896 0 :lindi-!unknown@unknown.invalid PRIVMSG #esoteric :calamari: turns out that there is already valueOf(int) but it's in a separate branch that targets 1.5 < 1119828974 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :keymaker: In computer science, an instruction set is said to be orthogonal if any instruction can use any register in any addressing mode. < 1119829000 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :ok < 1119829011 0 :lindi-!unknown@unknown.invalid PRIVMSG #esoteric :calamari: here, http://paste.debian.net/897 < 1119829191 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :interesting.. sun's is shorter, but the gnu one is easier to understand :) < 1119829343 0 :lindi-!unknown@unknown.invalid PRIVMSG #esoteric :MIN_CACHE and MAX_CACHE are -128 and 127 btw < 1119829398 0 :lindi-!unknown@unknown.invalid PRIVMSG #esoteric :calamari: < dalibor> a brainfuck debugger! < dalibor> we should ship that instead of jdb in kaffe < Sven_M> lindi-: Oh, well I can see how this is terribly useful. =) < 1119829417 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :lol < 1119830022 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :ACTION has installed sun java 1.5.0, put it in the $PATH before libgcj but libgcj is still being used instead < 1119830121 0 :BigZaphod!~BigZaphod@64-198-85-243.ip.mcleodusa.net JOIN :#esoteric < 1119830124 0 :lindi-!unknown@unknown.invalid PRIVMSG #esoteric :{^Raven^}: redhat has 'java' as a symlink to 'gij'? < 1119830160 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :yes, but it is later in the path than sun java < 1119830164 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :*run path < 1119830331 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :./java < 1119830345 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :got it working now < 1119830375 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :bfdebug is running as you described < 1119830376 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :I really like the look of 1.5 Swing < 1119830472 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :yup, it was Windows/sun java1.4.2 that was broken < 1119830498 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :because of the 1.5 method call I was using < 1119830520 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :can't we blame windows just a little? ;) < 1119830536 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :nah.. I bet it was spewing all sorts of errors to the console < 1119830548 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :but if the console isn't visible.. well :) < 1119830562 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :works fine in windows using 1.5 < 1119830570 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :(just tested via qemu) < 1119830580 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :that's good to know < 1119830601 0 :lindi-!unknown@unknown.invalid PRIVMSG #esoteric :segfaults jamvm in some mysterious way < 1119830621 0 :lindi-!unknown@unknown.invalid PRIVMSG #esoteric :but it only happens after it has looped for a long time in bf code < 1119830992 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :calamari: very nice program < 1119831063 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :calamari: what is the cell width in the debugger? are cells supposed to be able to hold -ve numbers? < 1119831097 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :what means '-ve'? < 1119831112 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :negative, and +ve is positive < 1119831123 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :ah :) < 1119831146 0 :Keymaker!unknown@unknown.invalid PRIVMSG #esoteric :i saw that same thing today somewhere else but couldn't realize what it meant.. i see now < 1119831148 0 :graue!~graue@ip68-100-130-21.dc.dc.cox.net JOIN :#esoteric < 1119831193 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :raven: thanks :) int sized cells < 1119831205 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :I should provide an 8-bit option, shouldn't I < 1119831243 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :(8, 16, int) < 1119831248 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :definately < 1119831269 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :will do.. working on it anyways (to allow *.bf, fixed the 1.5 bug) < 1119831282 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :can you paste non-char text into the input box now? < 1119831329 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :yes, but I am not sure if it's correct < 1119831352 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :it should be using unicode < 1119831371 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :(that's why ints were convienient) < 1119831385 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :how about File>LoadInput to load a file into the input tab? < 1119831538 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :do you want to save as well? < 1119831560 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :of course you do :) < 1119831574 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :it makes sense to be able to < 1119831913 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :lindi-: hey, this Sun Java is waaaaaa(etc)ay faster than libgcj < 1119832292 0 :Keymaker!unknown@unknown.invalid PART #esoteric :? < 1119832520 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :brb < 1119832521 0 :calamari!unknown@unknown.invalid QUIT :"Leaving" < 1119832634 0 :calamari!~calamari@dialup-4.240.114.80.Dial1.Phoenix1.Level3.net JOIN :#esoteric < 1119832871 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :calamari: I have hit a brick wall with the emulator, array bugs that cannot be kludged :(( < 1119832941 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :okay < 1119832951 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :ACTION wishes he knew java well enough to fix all these < 1119832963 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :I have a few more of those features to add ;) < 1119832978 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :then I'll check out the array code < 1119833014 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :thx, I really hate to keep bugging you about BFBASIC, esp since you have a life and all < 1119833084 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :haha, I have a life? < 1119833178 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :or is it an occupational hazard for all of us programmer types? < 1119834111 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :got the load/save done, now working on bit width < 1119834657 0 :tokigun!~tokigun@219.248.202.39 JOIN :#esoteric < 1119834677 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :ã…—ì œì˜ã… < 1119834679 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :oops < 1119834687 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :anyway hello ;) < 1119834708 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :hi < 1119834767 0 :BigZaphod!unknown@unknown.invalid PRIVMSG #esoteric :hey < 1119834925 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :BigZaphod: hello ;) < 1119834955 0 :BigZaphod!unknown@unknown.invalid PRIVMSG #esoteric :tokigun: good to "see" you :) < 1119834965 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :haha... < 1119834968 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric ::) < 1119834992 0 :BigZaphod!unknown@unknown.invalid PRIVMSG #esoteric :your 99 bottles is #2 on the 99 bottles of beer site. ;) good stuff. < 1119835016 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :thanks. < 1119835265 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :BigZaphod: i've submitted more 99 bob programs... :) < 1119835276 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :http://www.99-bottles-of-beer.net/language-r4-script-762.html and http://www.99-bottles-of-beer.net/language-windows-nt-batch-763.html < 1119835356 0 :BigZaphod!unknown@unknown.invalid PRIVMSG #esoteric :I saw those in the recently added list on the site. :) < 1119835403 0 :BigZaphod!unknown@unknown.invalid PRIVMSG #esoteric :had never heard of R4 before. < 1119835590 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :r4 is visualization software that provides custom scenes, network interfaces, and so forth. < 1119835618 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :(usually i used r4 visualization plugin for r4) < 1119835623 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :oops, for winamp* < 1119835702 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :i'm thinking about 99 bob program in Piet, Gammaplex, RUBE, Aheui. :) < 1119835751 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :ACTION is thinking about a spoon / whirl polyglot (just thinking tho) < 1119835788 0 :BigZaphod!unknown@unknown.invalid PRIVMSG #esoteric :tokigun: those would be fun to see... < 1119835830 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :{^Raven^}: whirl polyglot? :) < 1119835848 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :you mean whirl-c polyglot? < 1119835870 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :tokigun: i mean a whirl-spoon polyglot < 1119835877 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :ah... < 1119835900 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :i see. i didn't see "spoon". :) < 1119836001 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :i'd guess it would be impossible to do anything meaningful < 1119836792 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :write a program that generates a whirl-spoon polyglot for you < 1119837338 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :g'nite peeps < 1119837630 0 :graue!unknown@unknown.invalid PART #esoteric :? < 1119840508 0 :heatsink!unknown@unknown.invalid QUIT :"Leaving" < 1119842147 0 :puzzlet!unknown@unknown.invalid QUIT :Read error: 54 (Connection reset by peer) < 1119842417 0 :puzzlet!~puzzlet@61.247.148.38 JOIN :#esoteric < 1119844423 0 :BigZaphod!unknown@unknown.invalid QUIT : < 1119846339 0 :BigZaphod!~BigZaphod@66.6.34.219 JOIN :#esoteric < 1119849323 0 :lindi-!unknown@unknown.invalid PRIVMSG #esoteric :{^Raven^}: you compared it to gij? ;) gcj should be bit closer < 1119849835 0 :calamari!unknown@unknown.invalid QUIT :Read error: 60 (Operation timed out) < 1119850314 0 :graue!~graue@ip68-100-130-21.dc.dc.cox.net JOIN :#esoteric < 1119852123 0 :graue!unknown@unknown.invalid QUIT : < 1119852735 0 :calamari!~calamari@dialup-4.240.150.21.Dial1.Phoenix1.Level3.net JOIN :#esoteric < 1119852741 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :re's < 1119859199 0 :clog!unknown@unknown.invalid QUIT :ended < 1119859200 0 :clog!unknown@unknown.invalid JOIN :#esoteric < 1119861459 0 :entri!~Etri@CPE0004e28f94ca-CM014410113194.cpe.net.cable.rogers.com JOIN :#esoteric < 1119861584 0 :entri!unknown@unknown.invalid PRIVMSG #esoteric :yo < 1119861997 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :hi entri < 1119862389 0 :entri!unknown@unknown.invalid QUIT : < 1119862577 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :raven: got the new version done: http://kidsquid.com/programs/bf/bf.html < 1119862622 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :raven: I realized I'm setting EOF = 0, but it'd probably be nice to make than an option (0, max value, unchanged).. too tired to do it now, though < 1119862684 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :you'll notice a blue marker (and magenta when blue and red overlap).. this is the highest memory cell accessed. Useful for bf golf contests ;) < 1119862699 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :anyhow.. night < 1119862718 0 :calamari!unknown@unknown.invalid QUIT :"<=K" < 1119875438 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :calamari: I'll take a peek < 1119875449 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :morning to all the peeps < 1119878954 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :anyone around? < 1119879022 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :I need some inspiration for the name of a project I'm working on (currently called !:) < 1119879598 0 :malaprop!~ph@adsl-69-208-101-159.dsl.chcgil.ameritech.net JOIN :#esoteric < 1119880203 0 :tokigun!unknown@unknown.invalid QUIT :"Chatzilla 0.9.68.5 [Firefox 1.0.3/20050414]" < 1119880599 0 :jix!jix@p5489DCBC.dip.t-dialin.net JOIN :#esoteric < 1119880625 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :moin < 1119880983 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :sometimes what is esoteric is the usage of a language rather than the language itself... http://www.unidex.com/turing/utm.htm < 1119881314 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :pgimeno: thx, i like that < 1119881356 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :np, enjoy < 1119881726 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :There seems to be a requirement that all existant UTMs/FSMs must have hellow, 99bobb amd rot13 implemented < 1119881762 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :The holy trinity (sic) of example programs :) < 1119886527 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :it's ever so comforting to know that your text processing tools are subject to the halting problem < 1119887699 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :the 'cur' and 'last' links in the wiki history pages don't seem to be working. they don't take me to diffs, they just take me back to the article page. < 1119887845 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :which page, cpressey? it works for me < 1119887910 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :pgimeno: i was trying on the smallfuck history page < 1119887935 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :oh sorry < 1119887939 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :it does work < 1119887958 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :it just links down to the bottom ('preview') part of the diff, which looks just like the main article < 1119887966 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :oh, I see < 1119887966 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :i had to scroll up to notice the difference < 1119887991 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :yup < 1119889029 0 :CXI!unknown@unknown.invalid NICK :test < 1119889031 0 :test!unknown@unknown.invalid NICK :CXI < 1119890248 0 :ZeroOne!unknown@unknown.invalid PRIVMSG #esoteric :Keymaker: why is bf-hacks.org down? < 1119890291 0 :CXI!unknown@unknown.invalid QUIT :Read error: 104 (Connection reset by peer) < 1119890311 0 :CXI!~Sanity@dialup-215.89.221.203.acc50-kent-syd.comindico.com.au JOIN :#esoteric < 1119890494 0 :CXI!unknown@unknown.invalid QUIT :Client Quit < 1119890571 0 :CXI!~Sanity@dialup-215.89.221.203.acc50-kent-syd.comindico.com.au JOIN :#esoteric < 1119890575 0 :CXI!unknown@unknown.invalid QUIT :Read error: 104 (Connection reset by peer) < 1119890614 0 :CXI!~Sanity@dialup-215.89.221.203.acc50-kent-syd.comindico.com.au JOIN :#esoteric < 1119890633 0 :CXI!unknown@unknown.invalid QUIT :Client Quit < 1119890640 0 :CXI!~Sanity@dialup-215.89.221.203.acc50-kent-syd.comindico.com.au JOIN :#esoteric < 1119892870 0 :BigZaphod!unknown@unknown.invalid QUIT : < 1119892949 0 :calamari!~jeffryj@lilly.csoft.net JOIN :#esoteric < 1119892952 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :hi < 1119892982 0 :calamari!unknown@unknown.invalid QUIT :Remote closed the connection < 1119895285 0 :BigZaphod!~BigZaphod@198.45.23.220 JOIN :#esoteric < 1119896327 0 :calamari!~jeffryj@lilly.csoft.net JOIN :#esoteric < 1119896330 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :hi < 1119896340 0 :calamari!unknown@unknown.invalid QUIT :Remote closed the connection < 1119896806 0 :calamari!~jeffryj@lilly.csoft.net JOIN :#esoteric < 1119896809 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :blah... < 1119897277 0 :J|x!jix@p5489DCBC.dip.t-dialin.net JOIN :#esoteric < 1119897828 0 :jix!unknown@unknown.invalid QUIT :Read error: 110 (Connection timed out) < 1119898140 0 :J|x!unknown@unknown.invalid NICK :jix < 1119898146 0 :jix!unknown@unknown.invalid PART #esoteric :? < 1119898151 0 :jix!jix@p5489DCBC.dip.t-dialin.net JOIN :#esoteric < 1119898154 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :wrong key < 1119898484 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :hi jix < 1119898504 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :I put that bit debugger online, dunno if you saw my announcement on that < 1119898523 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :http://kidsquid.com/programs/bf/bf.html < 1119898559 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :I've made some improvements to the bf version that I need to backport to the bit version < 1119898570 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :bbl.. class < 1119898572 0 :calamari!unknown@unknown.invalid QUIT :"Leaving" < 1119898575 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :calamari: have had it running a test program for 5 hours and all is well < 1119902196 0 :J|x!jix@p5489DF3C.dip.t-dialin.net JOIN :#esoteric < 1119903126 0 :jix!unknown@unknown.invalid QUIT :Read error: 110 (Connection timed out) < 1119903486 0 :J|x!unknown@unknown.invalid NICK :jix < 1119906842 0 :calamari!~jeffryj@lilly.csoft.net JOIN :#esoteric < 1119906858 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :hi < 1119906933 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :calamari: I have been running your debugger through a test cycle for the last 8 hours and all is well < 1119906934 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :raven: glad to hear it.. sorry it's taking so long to run a program, though :) < 1119906962 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :maybe there should be a fast run button where it just goes for it without all the updating < 1119907007 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :I haven't had a chance to put my array code on the bench and check it out.. < 1119907013 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :maybe one option would run until the next ',' < 1119907041 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :but an occasional window refresh would be good < 1119907060 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :also, I realized my Pass button isn't right.. it stops on ], but it should actually run until the loop is complete < 1119907109 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :so there can be more options :) < 1119907111 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :Maybe File>SaveInput could be changed to File>SaveOutput as loading input and saving output seems more logical < 1119907125 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :I was looking into making a toolbar for them, but didn't want to get sidetracked < 1119907144 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :do you need to have the output of a program run? < 1119907175 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :I figured that the input is what needed to be saved, for repeated testing, etc < 1119907183 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :not really and copy/paste is more convenient < 1119907194 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :But, it's easy enough to add a Save Output option, so I will :) < 1119907194 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :ahh, i see. Yes that does sound betetr < 1119907241 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :The Java GUI stuff (source code) looks deceptivly simple < 1119907359 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :yeah.. that pretty much sums it up < 1119907372 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :lots of work ent into those lines though, believe me :) < 1119907621 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :I have been fleshing out my processor design < 1119907645 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :did oyu get past that last bfbasic bug that was stopping you last night? < 1119907657 0 :graue!~graue@ip68-100-130-21.dc.dc.cox.net JOIN :#esoteric < 1119907694 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :no, the bug is too deep in the compiler to workaround :( < 1119907706 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :k < 1119907879 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :the line is originally array(val1) = array(val1) + array(val2) < 1119907911 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :but it seems to compile to array(val1) = array(val1) < 1119908334 0 :Kmkr!~Not@wire74.adsl.netsonic.fi JOIN :#esoteric < 1119908336 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :is that what is printed by the debug output ? < 1119908340 0 :Kmkr!unknown@unknown.invalid PRIVMSG #esoteric :hello < 1119908344 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :hi kmkr < 1119908352 0 :Kmkr!unknown@unknown.invalid PRIVMSG #esoteric :hi < 1119908372 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :bbiam.. moving this pterminal to a different computer :) < 1119908376 0 :calamari!unknown@unknown.invalid QUIT :"Leaving" < 1119908404 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :hi < 1119908415 0 :calamari!~jeffryj@lilly.csoft.net JOIN :#esoteric < 1119908422 0 :Kmkr!unknown@unknown.invalid PRIVMSG #esoteric :hi.. /whois tells me that i'm Keymaker < 1119908431 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :haha < 1119908432 0 :Kmkr!unknown@unknown.invalid PRIVMSG #esoteric :i mean /whois Keymaker < 1119908437 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :you dork :P < 1119908445 0 :Kmkr!unknown@unknown.invalid PRIVMSG #esoteric ::) < 1119908466 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :calamari: I have PRINT array(val1) statements around the assignment < 1119908472 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :it'd be nice to be able to use @var's inside the debugger, wouldn't it :) < 1119908484 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :you have read my mind < 1119908508 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :I need to make a list of all this stuff otherwise I'm gonna forget < 1119908540 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :with BFBASIC compiled to debug output you can see which statement you are in < 1119908593 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :what you need is the ability to set breakpoints, so you can run a program to the breakpoint < 1119908685 0 :Kmkr!unknown@unknown.invalid PRIVMSG #esoteric :ZeroOne: when? it must've been something very temporary, i hope. it has worked for me every time i've been there today < 1119908709 0 :Kmkr!unknown@unknown.invalid PRIVMSG #esoteric :(it's my start page in opera) < 1119908730 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :compile to debug output, set breakpoint around the code in question, run silently (and quickly) to the breakpoint, and then step through the code at the point of the suspected bug < 1119908823 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :now that'd be cool < 1119908865 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :wonder how I can set a breakpoint.. perhaps just a special character in the code, like # < 1119908889 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :since that's the traditional bf debugging symbol < 1119908920 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :actually, that'd be extremely easy < 1119908936 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :for @vars, add an option to BFBASIC to output out a @var map at the top of the output < 1119908958 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :so maybe '@_T0 = 1 < 1119908973 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :'@_T1 = 2 < 1119909000 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :etc, the debugger would read these from the source on program load < 1119909006 0 :Kmkr!unknown@unknown.invalid PRIVMSG #esoteric :btw, what you're talking about? < 1119909020 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :raven: oic, symbolic debugging.. nice :) < 1119909048 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric ::) < 1119909059 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :that's even easier than what I was thinking of doing, so it's good :) < 1119909100 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :keymaker: working on bfdebug, a java swing debugger I've written recently < 1119909109 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :trying to make it more useful :) < 1119909114 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :kmkr: were talking about a really nice BF debugger in java calamari wrote < 1119909193 0 :Kmkr!unknown@unknown.invalid PRIVMSG #esoteric :ok < 1119909204 0 :Kmkr!unknown@unknown.invalid PRIVMSG #esoteric :that sounds useful < 1119909215 0 :Kmkr!unknown@unknown.invalid PRIVMSG #esoteric :sometimes i spend hours hunting some bug < 1119909231 0 :Kmkr!unknown@unknown.invalid PRIVMSG #esoteric :and mostly it's because of one instruction in wrong place < 1119909231 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :keymaker: http://kidsquid.com/programs/bf/bf.html < 1119909485 0 :graue!unknown@unknown.invalid QUIT :Remote closed the connection < 1119909515 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :ACTION has spent days tracking down fencepost errors < 1119909872 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :$varName=cellNumber (how's this for the defines)? < 1119909881 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :calamari: would it be possible to make [-] an optional special case in Interpreter.java so it does setCell(_mp, 0); < 1119909891 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :sure < 1119909911 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :that define sounds good to me < 1119909934 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :and it'll just be # for the breakpoints, placed by the user < 1119909993 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :I can't remember.. are the @var's produced by bfbasic uppercase ? < 1119910030 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :yes they are < 1119910102 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :okay, I'll make them case insensitive in the debugger then < 1119910123 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :how about breakpoints being disabled until the first BF instruction is encountered? It will save false positives if the program has a unix header. < 1119910163 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :would a different breakpoint character be preferred? < 1119910174 0 :graue!~graue@ip68-100-130-21.dc.dc.cox.net JOIN :#esoteric < 1119910188 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :no # is perfect < 1119910226 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :okay... I was just trying to avoid adding that extra state, but it can be done :) < 1119910234 0 :graue!unknown@unknown.invalid QUIT :Read error: 54 (Connection reset by peer) < 1119910268 0 :graue!~graue@ip68-100-130-21.dc.dc.cox.net JOIN :#esoteric < 1119910275 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :I'm on a quest to make brainfuck interpreter authors to add that particular usage < 1119910291 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :afk < 1119910302 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :but since we're dealing with BFBASIC debug output here it's not much of an issue < 1119910359 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :hi graue < 1119910401 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :graue: i like your anti-(mp3/ogg)-streaming php script < 1119910442 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :anti-(mp3/ogg)-streaming php script?? < 1119910542 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :it encourages users to download mp3s before listening to them instead of just streaming them from the server < 1119910566 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :i would add itunes too < 1119910581 0 :graue!unknown@unknown.invalid QUIT :Remote closed the connection < 1119910607 0 :graue!~graue@ip68-100-130-21.dc.dc.cox.net JOIN :#esoteric < 1119910641 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :User-Agent: iTunes/4.8 (Macintosh; N; PPC) < 1119910661 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :i'm looking for a way to stop storm downloads of music aswell < 1119910676 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :storm downloads? < 1119910732 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :when you have multiple connections to a server each downloading different parts of a file < 1119910767 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :ah < 1119910796 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :tell apache to disallow downloads by file position < 1119910811 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :multiply that by 40 or so mp3s and you have no bandwidth for a very long time < 1119910836 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :I need resume enabled though for people with dodgy# connections < 1119910843 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :hmm ok < 1119910892 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :in php is it possible to execute some code if the user disconnects? < 1119910927 0 :Kmkr!unknown@unknown.invalid QUIT :Read error: 110 (Connection timed out) < 1119910973 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :you could use a mysql db with a lock table.. if a user starts a download the script puts the ip into the table if the user is done with the download it removes it < 1119911012 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :that's basically the plan < 1119911024 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :and all ip:s that are older than 24h are removed (if the php script terminates without deleting the entry) < 1119911064 0 :graue!unknown@unknown.invalid QUIT :Remote closed the connection < 1119911069 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :ACTION has to go to bed < 1119911099 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :jix: good idea and good night :) < 1119911107 0 :jix!unknown@unknown.invalid QUIT :"Banned from network" < 1119912518 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :bbl < 1119912520 0 :calamari!unknown@unknown.invalid QUIT :"Leaving" < 1119912551 0 :graue!~graue@ip68-100-130-21.dc.dc.cox.net JOIN :#esoteric < 1119913561 0 :BigZaphod!unknown@unknown.invalid PRIVMSG #esoteric :hey < 1119913610 0 :BigZaphod!unknown@unknown.invalid PRIVMSG #esoteric :I just finished up another silly language for those who might be interested: http://www.bigzaphod.org/taxi/ < 1119913618 0 :graue_!~graue@ip68-100-130-21.dc.dc.cox.net JOIN :#esoteric < 1119913762 0 :graue_!unknown@unknown.invalid QUIT :Remote closed the connection < 1119913871 0 :graue!unknown@unknown.invalid QUIT :Read error: 60 (Operation timed out) < 1119914639 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :BigZaphod: That looks seriously freaky :) < 1119914721 0 :graue_!~graue@ip68-100-130-21.dc.dc.cox.net JOIN :#esoteric < 1119915478 0 :graue_!unknown@unknown.invalid QUIT :Remote closed the connection < 1119915526 0 :graue_!~graue@ip68-100-130-21.dc.dc.cox.net JOIN :#esoteric < 1119915548 0 :BigZaphod!unknown@unknown.invalid PRIVMSG #esoteric :{^Raven^}: thanks. :) < 1119915696 0 :graue_!unknown@unknown.invalid QUIT :Remote closed the connection < 1119918052 0 :BigZaphod!unknown@unknown.invalid QUIT : < 1119918164 0 :graue_!~graue@ip68-100-130-21.dc.dc.cox.net JOIN :#esoteric < 1119918553 0 :graue_!unknown@unknown.invalid QUIT :Remote closed the connection < 1119918599 0 :graue_!~graue@ip68-100-130-21.dc.dc.cox.net JOIN :#esoteric < 1119919163 0 :calamari!~calamari@dialup-4.240.150.113.Dial1.Phoenix1.Level3.net JOIN :#esoteric < 1119919239 0 :graue_!unknown@unknown.invalid QUIT :Remote closed the connection < 1119919282 0 :graue_!~graue@ip68-100-130-21.dc.dc.cox.net JOIN :#esoteric < 1119921479 0 :sergacity!~sergacity@c-24-118-18-20.hsd1.mn.comcast.net JOIN :#esoteric < 1119924518 0 :BigZaphod!~BigZaphod@dyvl-01-0198.dsl.iowatelecom.net JOIN :#esoteric < 1119925156 0 :calamari!unknown@unknown.invalid QUIT :"Leaving" < 1119927947 0 :graue_!unknown@unknown.invalid QUIT :Remote closed the connection < 1119928022 0 :graue_!~graue@ip68-100-130-21.dc.dc.cox.net JOIN :#esoteric < 1119928035 0 :graue_!unknown@unknown.invalid NICK :graue < 1119929020 0 :BigZaphod!unknown@unknown.invalid PRIVMSG #esoteric :echo is pretty easy in taxi: Go to the Post Office: west 1st left, 1st right, 1st left. Pickup a passenger going to the Post Office. Go to Tom's Trims: north. Go to the Post Office: south. Go to the Taxi Garage: north 1st right, 1st left, 1st right. < 1119929041 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :taxi? < 1119929045 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :there's an esolang called taxi? < 1119929052 0 :BigZaphod!unknown@unknown.invalid PRIVMSG #esoteric :as of today. :-) < 1119929053 0 :BigZaphod!unknown@unknown.invalid PRIVMSG #esoteric :http://www.bigzaphod.org/taxi/ < 1119929068 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :wonderful < 1119933550 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :OMG < 1119933555 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :That is the greatest thing I have ever seen XD < 1119933564 0 :BigZaphod!unknown@unknown.invalid PRIVMSG #esoteric ::D < 1119933570 0 :malaprop!unknown@unknown.invalid QUIT :"sleep" < 1119934628 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :OK, Gregor = loozer. < 1119934645 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :I've made an installer system, and now I'm making a packaging system. < 1119934661 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :For totally different audiences, but, how can I be so obsessed with installation of packages? Oy. < 1119935353 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :I am going to sleep good night < 1119935354 0 :graue!unknown@unknown.invalid QUIT : < 1119939207 0 :BigZaphod!unknown@unknown.invalid QUIT : < 1119939656 0 :calamari!~calamari@dialup-4.240.114.72.Dial1.Phoenix1.Level3.net JOIN :#esoteric < 1119939659 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :hi < 1119941606 0 :BigZaphod!~BigZaphod@66.6.34.219 JOIN :#esoteric < 1119941648 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :hi < 1119941651 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :BigZaphod: nice! < 1119941651 0 :BigZaphod!unknown@unknown.invalid PRIVMSG #esoteric :hey < 1119941660 0 :BigZaphod!unknown@unknown.invalid PRIVMSG #esoteric :tnx. :) < 1119942217 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :for my own part i have produced this today: http://catseye.webhop.net/projects/alpaca/eg/braktif/src/braktif.alp < 1119942241 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :Smallfuck/Brainfuck F-as-a-cellular-automaton < 1119942473 0 :BigZaphod!unknown@unknown.invalid PRIVMSG #esoteric :interesting.. < 1119943112 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :is life the simplest turing complete automaton ? < 1119945599 0 :clog!unknown@unknown.invalid QUIT :ended < 1119945600 0 :clog!unknown@unknown.invalid JOIN :#esoteric < 1119947743 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :calamari: i can't think of a simpler one :) < 1119947821 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :life is 3x3, right? I wonder if there can be a 2x2 < 1119947864 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :moin < 1119947894 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :am I the only one who thinks that Wireworld is simpler than Life? < 1119947913 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :not in number of states but anyway < 1119947978 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :cpressey: just curious, does the sketch of proof by Minsky use encoded counters as a single integer? < 1119948010 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :(re discussion in Talk:Befunge) < 1119948647 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :cpressey: nice work the cellular automaton; I still have to figure out how it works though < 1119948675 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :afk, bbl < 1119950412 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :night < 1119950415 0 :calamari!unknown@unknown.invalid QUIT :"Leaving" < 1119950697 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :wireworld makes a lot more sense than Life < 1119950735 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :cpressey: I can < 1119950859 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :actually i dunno < 1119950885 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :mathworld never actually explains in what sense is the rule 110 automaton "universal". < 1119952828 0 :mtve!unknown@unknown.invalid PRIVMSG #esoteric :there is also KS-lambda UTM, which has three elements (two bits) like ` is 1, K is 00 and S is 01. < 1119952893 0 :mtve!unknown@unknown.invalid PRIVMSG #esoteric :http://homepages.cwi.nl/~tromp/cl/cl.html < 1119956400 0 :jix!jix@p5489DF3C.dip.t-dialin.net JOIN :#esoteric < 1119958564 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :moin < 1119959091 0 :hashendgame!~hashendga@d220-236-4-89.dsl.nsw.optusnet.com.au JOIN :#esoteric < 1119963557 0 :malaprop!~ph@adsl-69-208-101-159.dsl.chcgil.ameritech.net JOIN :#esoteric < 1119963942 0 :jix!unknown@unknown.invalid QUIT :"This computer has gone to sleep" < 1119964177 0 :hashendgame!unknown@unknown.invalid QUIT :"Leaving" < 1119973254 0 :graue!~graue@ip68-100-130-21.dc.dc.cox.net JOIN :#esoteric < 1119973312 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :hello < 1119975642 0 :graue!unknown@unknown.invalid PART #esoteric :? < 1119975685 0 :jix!jix@p5489DF3C.dip.t-dialin.net JOIN :#esoteric < 1119978952 0 :BigZaphod!unknown@unknown.invalid QUIT : < 1119982124 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :pgimeno: yes, he uses prime factorization encoding at various points... < 1119982467 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :lament: sorry. i assumed calamari was talking about 2d cellular automata... < 1119983127 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :pgimeno: yeah, i checked - he mentions a 3-register machine and a 5-register machine... he emulates the 3-register machine in a 2-register subtract/jump machine by encoding the 3 registers into one (2^a*3^m*5^n) and using the other as scratch. he then argues that the 5-register machine can be simulated on a 1-register multiply/conditional-divide machine with all five encoded as (2^a*3^b*5^c*7^d*11^e) < 1119983586 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :of course, in befunge, you can make life easier by storing the data in one register and the program in the other... and you can use a less pathological encoding for the program (e.g. 8 bits per symbol) < 1119984090 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :lament: actually they do, on http://mathworld.wolfram.com/UniversalCellularAutomaton.html and http://mathworld.wolfram.com/Universality.html < 1119984136 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :i agree they don't do a good job, though... they neglect to mention any other meanings of universality (e.g. construction-universal) < 1119984513 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :cpressey: i don't get those pages < 1119984542 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :they say rule 110 can emulate the other automatons < 1119984560 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :that's obviously not universality in the Turing sense < 1119984681 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :"Universal systems are effectively capable of emulating any other system." ? < 1119984747 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :i don't like wolfram < 1119984803 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :haha < 1119985230 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :i suppose if you can avoid the parts of mathworld that sound like free advertising for NKS, it's not _that_ bad... < 1119985285 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :mathworld is useful < 1119985291 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :i just wish they gave me a free copy of Mathematica < 1119985366 0 :lindi-!unknown@unknown.invalid PRIVMSG #esoteric :cpressey: NKS? < 1119985387 0 :lindi-!unknown@unknown.invalid PRIVMSG #esoteric :lament: have you used maxima? < 1119985444 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :lindi-: yes < 1119985459 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :maxima is so weird. < 1119985471 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :why give me access to Lisp < 1119985473 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :i don't want your lisp < 1119985522 0 :lindi-!unknown@unknown.invalid PRIVMSG #esoteric :lament: try wxmaxima < 1119985564 0 :BigZaphod!~BigZaphod@198.45.23.220 JOIN :#esoteric < 1119985607 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :lindi-: NKS = "A New Kind of Science", wolfram's (monstrous) book < 1119985610 0 :lindi-!unknown@unknown.invalid PRIVMSG #esoteric :lament: you can do a lot with maxima without even knowing it's written in lisp < 1119985616 0 :lindi-!unknown@unknown.invalid PRIVMSG #esoteric :cpressey: uh < 1119985645 0 :lindi-!unknown@unknown.invalid PRIVMSG #esoteric :lament: that especially applies to wxmaxima, try it, you'll be surprised ;) < 1119985651 0 :calamari!~calamari@dialup-4.240.150.177.Dial1.Phoenix1.Level3.net JOIN :#esoteric < 1119985661 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :i'll look at it < 1119989118 0 :J|x!jix@p5489E7C6.dip.t-dialin.net JOIN :#esoteric < 1119989411 0 :jix!unknown@unknown.invalid QUIT :Nick collision from services. < 1119989412 0 :J|x!unknown@unknown.invalid NICK :jix < 1119990905 0 :guest_2566!~BYUMUG@67.106.148.83 JOIN :#esoteric < 1119990917 0 :guest_2566!unknown@unknown.invalid NICK :jimbo00000 < 1119991111 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :yay, help system implemented.. how I just need to write up the html for it :) < 1119991118 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :now < 1119991161 0 :jimbo00000!unknown@unknown.invalid PRIVMSG #esoteric :Hey all, does anyone still have any interest in Befunge93? < 1119991251 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :that's the original, right? < 1119991255 0 :jimbo00000!unknown@unknown.invalid PRIVMSG #esoteric :right < 1119991260 0 :jimbo00000!unknown@unknown.invalid PRIVMSG #esoteric :80x25 < 1119991437 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :I haven't really studied befunge much.. I didn't learn of it until after bf, and so I got hooked on the tarpit idea :) < 1119991513 0 :jimbo00000!unknown@unknown.invalid PRIVMSG #esoteric :well i just made this real neat befunge interpreter in flash (http://jimbomania.com/code/flunger.html), only to find most of the links and mailing lists dead < 1119991620 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :I need to figure out why flash doesn't work.. very annoying < 1119991644 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :I like flash programs.. always look very smooth < 1119991724 0 :jimbo00000!unknown@unknown.invalid PRIVMSG #esoteric :yea, totally - get that plugin running. the pc leaves behind alpha scaled trails over the code space < 1119991733 0 :jimbo00000!unknown@unknown.invalid PRIVMSG #esoteric :it looks cool:) < 1119991861 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :jimbo00000: wow the interpreter is cool < 1119991942 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :but the trail is too short in the random-song example < 1119991957 0 :jimbo00000!unknown@unknown.invalid PRIVMSG #esoteric :hey, thank you very much! you can adjust the trail length with the slider in the lower left < 1119991976 0 :jimbo00000!unknown@unknown.invalid PRIVMSG #esoteric :up to 100 spaces back - gotta click the handle again if youre restarting < 1119991992 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :yes its on 100 but the trail is only 1 char long < 1119992007 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :or 2..3 but not 100 < 1119992084 0 :jimbo00000!unknown@unknown.invalid PRIVMSG #esoteric :hmmmm that does not seem correct... this is a brand new thing so bugs may abound < 1119992099 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :can you reproduce the bug? < 1119992109 0 :jimbo00000!unknown@unknown.invalid PRIVMSG #esoteric :maybe try kicking that widget once or twice - no, im getting 100 tyrails over here < 1119992128 0 :jimbo00000!unknown@unknown.invalid PRIVMSG #esoteric :sometime what happens is flash doesnt register the end of the drag event if you release outside of the movieclip < 1119992131 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :a reload did it < 1119992135 0 :jimbo00000!unknown@unknown.invalid PRIVMSG #esoteric :sweet < 1119992193 0 :jimbo00000!unknown@unknown.invalid PRIVMSG #esoteric :i'm not 100% sure the g and p instructions work perfectly - does anyone perchance have any diagnostic programs to test it? < 1119992214 0 :jimbo00000!unknown@unknown.invalid PRIVMSG #esoteric :or maybe some idea on how to write a good one... < 1119992440 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :hmm, I get just a black screen .. is that normal? < 1119992598 0 :jimbo00000!unknown@unknown.invalid PRIVMSG #esoteric :no, what you should see is a 80x25 textfield labeled "Funge Space" < 1119992617 0 :jimbo00000!unknown@unknown.invalid PRIVMSG #esoteric :and a stack, and a gray frame that says "Welcome to Flunger" < 1119992629 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :weird... this page worked, so I assume Flash is okay http://www.jengajam.com/r/ultimate-pong < 1119992648 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :jimbo00000: hey.. why not write an interactive flash interpreter for: http://esolangs.org/wiki/YABALL < 1119992733 0 :jimbo00000!unknown@unknown.invalid PRIVMSG #esoteric :oooo kinky - i had thought of making a SNUSP mode too < 1119992747 0 :jimbo00000!unknown@unknown.invalid PRIVMSG #esoteric :shouldn't be so hard given the existing graphical framework < 1119992766 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :but SNUSP isn't written by myself < 1119992793 0 :jimbo00000!unknown@unknown.invalid PRIVMSG #esoteric :How are you, Mr H? :) < 1119992809 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :Mr H? < 1119992838 0 :jimbo00000!unknown@unknown.invalid PRIVMSG #esoteric :are you the writer of YABALL? < 1119992841 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :yes < 1119992855 0 :BigZaphod!unknown@unknown.invalid PRIVMSG #esoteric :jimbo00000: cool interpreter! < 1119992858 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :Why H and not Harder? < 1119992862 0 :jimbo00000!unknown@unknown.invalid PRIVMSG #esoteric :very cool - thanks BigZ! < 1119992872 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :jimbo00000: I'm on linux so that's probably what's wrong < 1119992884 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :maybe linux flash it out of date < 1119992912 0 :jimbo00000!unknown@unknown.invalid PRIVMSG #esoteric :calamari: i compiled it for flash player 7 < 1119992938 0 :jimbo00000!unknown@unknown.invalid PRIVMSG #esoteric :jix: i dunno. what was your inspiration for the language? < 1119992994 0 :lindi-!unknown@unknown.invalid PRIVMSG #esoteric :calamari: argh. flash is even worse than java at the moment ;) < 1119993001 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :jimbo: do you know of a website with a flash program that prints the flash version number? < 1119993028 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :oh cool, it's working now.. < 1119993097 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :jimbo00000: in Brainfuck [] can be nested.. so one needs "complex" parsing or counting the ] and [s for loops.. i wanted to avoid that < 1119993223 0 :jimbo00000!unknown@unknown.invalid PRIVMSG #esoteric :so the memory model is like Brainfuck's? a 1D array? < 1119993252 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :yes < 1119993263 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :just the code flow is different < 1119993293 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :jix: I currently know of 3 ways to deal with [], I < 1119993297 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :'m sure there are more: < 1119993335 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :1: at a ] go back and for every ] count++ for every ] count-- stop at count == 0 start with count=1 < 1119993340 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :1) stack, 2) search for matching [] 3) convert [] to jumps before execution < 1119993366 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :2: do the same thing once for all loops and store them as linked list or whatever < 1119993367 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :3 is the fastest that I know of.. no stack needed :) < 1119993378 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :my nr. 2 is your nr. 3 < 1119993438 0 :jimbo00000!unknown@unknown.invalid PRIVMSG #esoteric :I was thinking of making a button to toggle blocking on input in the interpreter - anyone think that would be practical? < 1119993449 0 :jimbo00000!unknown@unknown.invalid PRIVMSG #esoteric :what is the procedure if there no input waiting - just push 0? < 1119993482 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :push 0 or don't push at all < 1119993500 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :i think don't push at all is more flexible < 1119993501 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :jimbo: I don't think I can use the interpreter correctly yet.. the A-Z program just goes around the first row over and over :) < 1119993563 0 :jimbo00000!unknown@unknown.invalid PRIVMSG #esoteric :Hmmm yea, thats not right. You know, I haven't tested this in linux yet. < 1119993585 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :on mac os x it works.. but sometimes there is this trail bug < 1119993661 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :trails seem fine.. 50% looks pretty good < 1119993682 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :jimbo00000: are you going to release the source code? < 1119993708 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :jimbo00000: re befunge-93 example programs to test with: http://catseye.webhop.net/projects/befunge93/eg/ < 1119993782 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :I assume the v instruction means go down < 1119993784 0 :jimbo00000!unknown@unknown.invalid PRIVMSG #esoteric :jix: yea, sure. least i could do - thanks for the awesome languages! < 1119993791 0 :jimbo00000!unknown@unknown.invalid PRIVMSG #esoteric :yep, v is down < 1119993793 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :I guess that's what's not happening :) < 1119993810 0 :jimbo00000!unknown@unknown.invalid PRIVMSG #esoteric :all the source is in flash actionscript, very similar to javascript and c < 1119994121 0 :jimbo00000!unknown@unknown.invalid PRIVMSG #esoteric :cpressey: Thanks for the funges! what happened a couple of months ago, i thought your site went down for good? < 1119994237 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :jimbo00000: it moved to the current address about 2 years ago < 1119994321 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :there's also a strange error with the webserver<->subversion thing that i haven't been able to track down, so it's not been the most reliable in the past months < 1119994350 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :but now i'm restarting the webserver nightly, so it should be "OK" < 1119994569 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :jimbo00000: btw, thanks for making the interpreter... unfortunately i have no way to test it until i get near a machine that i can use flash on :( < 1119995029 0 :jimbo00000!unknown@unknown.invalid PRIVMSG #esoteric :Does anyone here ever mess with choon? < 1119995047 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :me < 1119995061 0 :jimbo00000!unknown@unknown.invalid PRIVMSG #esoteric :do anything cool with it? i just found that page today < 1119995062 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :but very little < 1119995067 0 :jimbo00000!unknown@unknown.invalid PRIVMSG #esoteric :sounds just like r2 from starwars < 1119995089 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :http://www.99-bottles-of-beer.net/language-choon-750.html < 1119995379 0 :jimbo00000!unknown@unknown.invalid PRIVMSG #esoteric :pgimeno: best beer program EVER < 1119995414 0 :jimbo00000!unknown@unknown.invalid PRIVMSG #esoteric :would it be possible to port the interpreter and the wav converter to php, for the integrated web choon experience? < 1119995436 0 :jimbo00000!unknown@unknown.invalid PRIVMSG #esoteric :i guess it would, php can write files < 1119995974 0 :mtve!unknown@unknown.invalid PRIVMSG #esoteric :jimbo00000: excuse me, what should i do after entering execution mode? < 1119996005 0 :mtve!unknown@unknown.invalid PRIVMSG #esoteric :oh, i got it, i got it. < 1119996149 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :g'nite < 1119996193 0 :graue!~graue@ip68-100-130-21.dc.dc.cox.net JOIN :#esoteric < 1119996352 0 :jix!unknown@unknown.invalid QUIT :"Banned from network" < 1119996405 0 :mtve!unknown@unknown.invalid PRIVMSG #esoteric :jimbo00000: it appears 'p' won't hold values with ascii value less than 32, isn't it? < 1119996474 0 :mtve!unknown@unknown.invalid PRIVMSG #esoteric :it replaces them with symbol "?" (ascii 63). < 1119996511 0 :jimbo00000!unknown@unknown.invalid PRIVMSG #esoteric :mtve: that sounds correct, yes, and the upper limit is ASCII 126 < 1119996529 0 :jimbo00000!unknown@unknown.invalid PRIVMSG #esoteric :is this correct behavior? i think i saw that javascript funge interpreter do it < 1119996577 0 :mtve!unknown@unknown.invalid PRIVMSG #esoteric :i doubt it. at least few known programs expect values to be kept intact. < 1119996641 0 :jimbo00000!unknown@unknown.invalid PRIVMSG #esoteric :hmmm so i should just dump the value there, even if it is unprintable? < 1119996656 0 :jimbo00000!unknown@unknown.invalid PRIVMSG #esoteric :yea that makes sense for computation < 1119996687 0 :jimbo00000!unknown@unknown.invalid PRIVMSG #esoteric :I'll have to find some hackaround for that, as flash will most likely balk at the unprintables < 1119996844 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :jimbo00000: thanks < 1119996883 0 :jimbo00000!unknown@unknown.invalid PRIVMSG #esoteric :has anyone ever tried to mate choon with funge? < 1119996884 0 :mtve!unknown@unknown.invalid PRIVMSG #esoteric :yep. it wasn't explicitly told in the spec, but it would be good. and yes, interpreter is very nice. < 1119996913 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :ACTION rolls eyes < 1119996961 0 :jimbo00000!unknown@unknown.invalid PRIVMSG #esoteric :I just had a wild idea - concurrent pcs in a 2d space executing choon, making chords possible < 1119997015 0 :jimbo00000!unknown@unknown.invalid PRIVMSG #esoteric :maybe add a tempo change command < 1119997090 0 :calamari!unknown@unknown.invalid QUIT :Read error: 60 (Operation timed out) < 1119997232 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :actually choon is not the kind of language I feel comfortable with < 1119997333 0 :jimbo00000!unknown@unknown.invalid PRIVMSG #esoteric :I am most attracted to the musical aspect of choon, more so than its syntax < 1119997686 0 :graue!unknown@unknown.invalid QUIT : < 1119997836 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :I've been looking for an UTM program with two symbols but have been totally unsuccessful. A book by Roger Penrose has a description. Does anyone know of a TM program implementing an UTM? < 1119998061 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :pgimeno: yes, there are a few in the Minsky book. (it's actually a really nice book, i wish i'd found it a lot earlier...) < 1119998063 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :(I have the book, The Emperor's New Mind, but have lent it to someone I might not see again) < 1119998073 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :oh, cool < 1119998082 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :what's the name of the book? < 1119998091 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :Computation: Finite and Infinite Machines < 1119998110 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :the name sounds pretty attractive < 1119998120 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :i can scan or type in one of the UTM state diagrams if you can't find it < 1119998126 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :Minsky's design is... 46 or so states long, right? < 1119998152 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric ::) he was a tarpit fan too.... he has a 4 state x 7 symbol UTM < 1119998156 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :(IIRC, for what I have seen googling) < 1119998193 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :sorry, that's 4 symbols, 7 states < 1119998201 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :yeah, the Wikipedia article (or was it the Wolfram one?) has the records < 1119998213 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :there's a 2-state one in 18 symbols IIRC < 1119998244 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :or probably 19 < 1119998285 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :I've been googling for a while and seen all that < 1119998303 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :but I've found no description of a TM program < 1119998338 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :hrm, so you want one that is 2 symbols, explicitly? < 1119998356 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :yeah, for the extended Befunge-93 proof :) < 1119998443 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :heh < 1119998449 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :my idea is to use the two counters as two bit stacks as in part 1 of the counter article < 1119998452 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :there's one that never erases a symbol once written... < 1119998474 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :one what? utm? < 1119998480 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :yeah < 1119998489 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :blank and 1, and blank -> 1 but 1 never -> blank < 1119998495 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :reminds me a lot of smith :) < 1119998504 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :kind of, yeah < 1119998535 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :anyway, for the b93 proof... if i were to try it i'd probably do the multiply/conditional-divide model, since Befunge has those instructions < 1119998546 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :and that's only 1 register < 1119998554 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :so you can use the other for holding the program < 1119998561 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :which should make things MUCH easier, i'd think < 1119998564 0 :calamari!~calamari@dialup-4.240.69.140.Dial1.Phoenix1.Level3.net JOIN :#esoteric < 1119998568 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :hi < 1119998578 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :hi calamari < 1119998583 0 :jimbo00000!unknown@unknown.invalid PRIVMSG #esoteric :Gentlemen, it has been a pleasure to be in such esteemed company. Have an excellent evening. < 1119998585 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :hi chris < 1119998588 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :yeah, but I don't want to use exponential encoding because I'd like to try it with a real machine < 1119998591 0 :jimbo00000!unknown@unknown.invalid QUIT :"Today is a good day to chat." < 1119998599 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :ah, i see. < 1119998627 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :hrmmm..... < 1119998680 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :you could implement bigints *as* a prime factorization internally - that would make it feasible (i think) - but it would make implementing add/subtract, um, "interesting"... but on the other hand, you don't ever have to *use* add or subtract... < 1119998722 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :anyway, all the 2-symbol UTMs seem to be conversions from tag systems (which are neat in themselves.) < 1119998786 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :my idea is to use the Befunge 80x25 playfield to implement the handling of stacks and the FSM (Turing program), and the two counters as two bit stacks that implement the tape < 1119998810 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :right < 1119998817 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :the state will be maintained by the program counter, probably < 1119998834 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :you know, you could almost use 2-symbol brainfuck (brainfuck f/smallfuck) < 1119998885 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :it's easier to reason about than most of these "proof that such a machine must exist (no explicit construction given though)" things :) < 1119998926 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :heh, you're right < 1119998939 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :I'm a bit dumb sometimes < 1119999050 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :I suppose that writing a boolfuck/smallfuck/bf F interpreter that uses the two counters as the cells would complete the proof < 1119999068 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :hey i like that bignums-as-primes idea < 1119999316 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :is it just me or is the wiki down? < 1119999780 0 :BigZaphod!unknown@unknown.invalid PRIVMSG #esoteric :not working for me either < 1119999843 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :thanks < 1119999877 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :I've just found the EsoLang FAQ :) < 1120000380 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :does anyone have a backup mediawiki installation? I can redirect esolangs.org to point to it < 1120000615 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :wooby and malaprop were the ones who offered to set up a mirror < 1120000631 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :I'm downloading mediawiki just for fun < 1120000645 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :I suspect the wiki will come back shortly.. but this is a good test :) < 1120000656 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric ::) < 1120000686 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :so you can manipulate the esolangs.org domain? I thought it was wooby who controlled it < 1120000707 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :wooby is in Iraq and he placed it in my care while he is gone < 1120000723 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :wow < 1120000732 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :yeah, sux huh? < 1120000755 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :I sure wouldn't want to be over there :) < 1120000756 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :kind of astonishing news < 1120000844 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :I just hope he returns in perfect shape < 1120000864 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :as do I.. suprised he didn't tell anyone else < 1120000937 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :maybe he thought it was offtopic here or something < 1120001365 0 :BigZaphod!unknown@unknown.invalid QUIT : < 1120002291 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :hi < 1120002407 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :hi raven < 1120002415 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :got the @ stuff working in the debugger < 1120002418 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :also # < 1120002433 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :haven't changed bfbasic yet, though.. so it's not much use :) < 1120002446 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :hey cool, that debug run is still going from the other day :) < 1120002447 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :I should release it anyways < 1120002450 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :haha < 1120002461 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :am running bf2c.b on itself ;) < 1120002503 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :what will that give you? a c program that converts bf to c? < 1120002519 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :yeah < 1120002521 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :I could write that in much less than a day ;) < 1120002546 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :It's just a test run that I've not bothered to terminate... < 1120002556 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :cool to hear it's still going < 1120002641 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :I have the C version of my emulator 75% finished, I'm writing it as a reference against the future BF version < 1120002793 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :raven: how long till you go to bed? wondering if I want to mess with bfdebug more or release it now < 1120002866 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :calamari: a few hours < 1120002882 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :it turns out that only mysql 4.1+ can import dumps.. My shell provider is running mysql 4.0 :( < 1120002901 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :where is a copy of the db? < 1120002914 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :http://kidsquid.com/esowiki < 1120002959 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :afk, going to see if I can get them to install 4.1 < 1120002999 0 :Kmkr!~Not@wire74.adsl.netsonic.fi JOIN :#esoteric < 1120003002 0 :Kmkr!unknown@unknown.invalid PRIVMSG #esoteric :woah < 1120003017 0 :Kmkr!unknown@unknown.invalid PRIVMSG #esoteric :jimbo00000: really cool befunge interpreter! < 1120003170 0 :Kmkr!unknown@unknown.invalid PRIVMSG #esoteric :wooby's in iraq? i hope everything goes well. < 1120003219 0 :Kmkr!unknown@unknown.invalid PRIVMSG #esoteric :for some reason i thought graue controlled the wiki.. < 1120003238 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :he does < 1120003251 0 :Kmkr!unknown@unknown.invalid PRIVMSG #esoteric :hmm, then what wooby does? < 1120003256 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :esolangs.org < 1120003267 0 :Kmkr!unknown@unknown.invalid PRIVMSG #esoteric :ah. me see now < 1120003800 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :i can convert it to an earlier version of SQL but not without losing metadata so no luck here as I don't want to corrupt that < 1120003829 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :ACTION is running 3.x.x on his server < 1120003866 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :hahaha < 1120003883 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :how is the conversion done? < 1120003948 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :I heard I could modify mysql table headers, but I have no clue how to < 1120003998 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :easy(ish), first remove the instances of ` in SQL commands < 1120004012 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :and then remove all the CHARSET stuff < 1120004059 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :you need to remove the charset stuff from the INSERT statements too < 1120004069 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :for 4.1 to 4.0 I need to do this? < 1120004189 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :for some of it yes, but I recommend against it, you will destroy too much information < 1120004225 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :do you know any friendly sysadmins who could host it for a while? < 1120004280 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :nope.. well I know some.. but they wouldn't know how to set it up :) < 1120004342 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :hmmm, it should be pretty simple, create database + account, install mediawiki, import database < 1120004364 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :my MySQL/PHP can be tough for a newbie to setup < 1120004367 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :*but < 1120004477 0 :Kmkr!unknown@unknown.invalid PRIVMSG #esoteric :bigzaphod: really cool language :D < 1120004860 0 :Kmkr!unknown@unknown.invalid PRIVMSG #esoteric :well, bbl. < 1120004863 0 :Kmkr!unknown@unknown.invalid QUIT :"I've seen this déjà vu before.." < 1120005074 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :calamari: a competent person should be able to set it up remotely given ssh / webmin access < 1120005117 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :calamari: + ftp of course < 1120005230 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :raven: afk a minute.. jarring/releasing 1.20 < 1120005718 0 :heatsink!~heatsink@c-24-61-94-111.hsd1.nh.comcast.net JOIN :#esoteric < 1120006021 0 :graue!~graue@ip68-100-130-21.dc.dc.cox.net JOIN :#esoteric < 1120006049 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :raven: http://kidsquid.com/programs/bf/bf.html < 1120006055 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :hi graue :) < 1120006060 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :having fun with the wiki? < 1120006187 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :no < 1120006189 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :why? < 1120006194 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :why would I be having fun with it? < 1120006208 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :oh, because it's down < 1120006210 0 :graue!unknown@unknown.invalid PRIVMSG #esoteric :that sucks < 1120006274 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :I've been trying to set up mediawiki on my webspace, but have 4.0 < 1120006286 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :err mysql 4.0 < 1120006380 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :graue: I'd like to request daily dumps when it comes back, because of all the activity.. a week loses a lot < 1120006563 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :calamari: Wow! < 1120006578 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :looks the same, huh? :) < 1120006606 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :Now if "Now @varname goes to the cell defined by varname (note: it can be derailed with < and >)" does what I think it does that's really cool < 1120006645 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :yeah.. it doesn't just jump to the cell, because that's impossible in normal bf < 1120006663 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :@a>@b will bump you one past actual @b < 1120006722 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :does this mean that we could theoretically compile a BFBASIC program without parsing it through arrows() and it should still work as long as the varmap is present? < 1120006755 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :possibly < 1120006773 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :that's the idea, at least :) < 1120006803 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :I have thought about that feature, even produced the required version of BFBASIC (last week) < 1120006875 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :haha < 1120006885 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :This will allow the integrity of the parser proper to be tested since all the @var stuff would be theoretically perfect! < 1120006894 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :have you tried $ yet? there's a hidden bonus feature :) < 1120006948 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :Definately, I have added a cvarmap to a short program which is running atm < 1120006969 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :cool < 1120007016 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :Would the bonus be a window refresh every thousand or so cycles? I have definitly noticed that < 1120007113 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :nope.. it's the varnames on the memory list < 1120007124 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric ::) < 1120007159 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :I haven't added that quick run stuff yet < 1120007194 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :That's the first thing I spotted :) < 1120007239 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :*the varnames on the memory list < 1120007248 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :oops, I forgot to change the version # in the code < 1120007418 0 :BigZaphod!~BigZaphod@dyvl-01-0198.dsl.iowatelecom.net JOIN :#esoteric < 1120007462 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :okay, uploaded the version fixed 1.20, also fixed a small help bug while I was at it < 1120007513 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :(if you closed help and came back, it wouldn't be back to the contents) < 1120007831 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :I am running this on an extra debug version of a BFBASIC program with all the symbols defined < 1120007881 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :i can see exactly which statement is currently being executed and what all the CVARS are :) < 1120007885 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :cool < 1120007891 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :is it working? < 1120007978 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :I'd test the array code, but the wiki is down :/ < 1120008021 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :the support guy at my isp will try to get 4.1, so that's cool < 1120008030 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :err shell, not isp < 1120008072 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :yeah, the first PRINT came out garbled but I'm using a non-standard BFBASIC atm < 1120008078 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :oic < 1120008082 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :otherwise all seems perfect < 1120008177 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :calamari: garbled text seems to be my fault < 1120008562 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :raven: I think what what I did with the @vars is called a wimpmode :) < 1120008702 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :definately not, your debugger is going to be really useful for any brainfuck developer < 1120008916 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :calamari: http://jonripley.com/~jon/action.png < 1120009076 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :cool < 1120010039 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :bbl.. phone < 1120010043 0 :calamari!unknown@unknown.invalid QUIT :"Leaving" < 1120010643 0 :graue_!~graue@ip68-100-130-21.dc.dc.cox.net JOIN :#esoteric < 1120010656 0 :graue_!unknown@unknown.invalid PRIVMSG #esoteric :why are there two of me? < 1120010687 0 :graue_!unknown@unknown.invalid PRIVMSG #esoteric :oh, that was stupid < 1120010687 0 :graue_!unknown@unknown.invalid PART #esoteric :? < 1120010761 0 :calamari!~calamari@dialup-4.240.114.161.Dial1.Phoenix1.Level3.net JOIN :#esoteric < 1120011198 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :calamari: feature idea for BF debugger... < 1120011289 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :calamari: the ability to vertically extend the memory view to show locations 16..31, 32..47, 48..63, etc < 1120011396 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :it would dramatically cut so < 1120011420 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :*down on the amount of left<>right scrolling and make the debugger more transparant/useful < 1120012229 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :raven: do you mean there would be 48 memory locations going across? < 1120012246 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :oh.. vertically :) < 1120012444 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :that would really slow things down the way I'm currently drawing memory < 1120012458 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :so I should fix the way I'm drawing memory :) < 1120014406 0 :graue!unknown@unknown.invalid PART #esoteric :? < 1120014732 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :ACTION is asleep < 1120015568 0 :CXI!unknown@unknown.invalid QUIT :Read error: 104 (Connection reset by peer) < 1120015580 0 :comet_11!Sanity@dialup-215.89.221.203.acc50-kent-syd.comindico.com.au JOIN :#esoteric < 1120015606 0 :comet_11!unknown@unknown.invalid NICK :CXI < 1120016119 0 :heatsink!unknown@unknown.invalid QUIT :"Leaving" < 1120016260 0 :malaprop!unknown@unknown.invalid QUIT :"quit" < 1120022112 0 :BigZaphod!unknown@unknown.invalid QUIT : < 1120022956 0 :calamari!unknown@unknown.invalid QUIT :"Leaving" < 1120027248 0 :calamari!~calamari@dialup-4.240.114.99.Dial1.Phoenix1.Level3.net JOIN :#esoteric < 1120029034 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :raven: my x(y)=z routine as on the wiki seems to work fine for x(4)=2 and x(0)=2. It uses 3 + 2 * (total # of indices) bytes of memory < 1120030152 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :I've added an explanation of x(y)=z to the wiki page < 1120030652 0 :BigZaphod!~BigZaphod@66.6.34.219 JOIN :#esoteric < 1120030839 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :hi zaphod < 1120030847 0 :BigZaphod!unknown@unknown.invalid PRIVMSG #esoteric :hey < 1120031999 0 :clog!unknown@unknown.invalid QUIT :ended < 1120032000 0 :clog!unknown@unknown.invalid JOIN :#esoteric < 1120034771 0 :tokigun!~tokigun@219.248.202.39 JOIN :#esoteric < 1120034790 0 :tokigun!unknown@unknown.invalid PRIVMSG #esoteric :hello < 1120035173 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :hi tokigun < 1120035937 0 :calamari!unknown@unknown.invalid QUIT :"Leaving" < 1120037132 0 :{^Raven^}!unknown@unknown.invalid QUIT :brown.freenode.net irc.freenode.net < 1120037138 0 :mtve!unknown@unknown.invalid QUIT :brown.freenode.net irc.freenode.net < 1120037138 0 :pgimeno!unknown@unknown.invalid QUIT :brown.freenode.net irc.freenode.net < 1120037138 0 :ZeroOne!unknown@unknown.invalid QUIT :brown.freenode.net irc.freenode.net < 1120037170 0 :tokigun!unknown@unknown.invalid QUIT :brown.freenode.net irc.freenode.net < 1120037172 0 :cmeme!unknown@unknown.invalid QUIT :brown.freenode.net irc.freenode.net < 1120037172 0 :lindi-!unknown@unknown.invalid QUIT :brown.freenode.net irc.freenode.net < 1120037194 0 :tokigun!~tokigun@219.248.202.39 JOIN :#esoteric < 1120037194 0 :cmeme!~cmeme@216.184.11.2 JOIN :#esoteric < 1120037194 0 :lindi-!~lindi@kulho150.adsl.netsonic.fi JOIN :#esoteric < 1120037269 0 :ChanServ!unknown@unknown.invalid QUIT :brown.freenode.net irc.freenode.net < 1120037269 0 :fizzie!unknown@unknown.invalid QUIT :brown.freenode.net irc.freenode.net < 1120037269 0 :deltab!unknown@unknown.invalid QUIT :brown.freenode.net irc.freenode.net < 1120037269 0 :puzzlet!unknown@unknown.invalid QUIT :brown.freenode.net irc.freenode.net < 1120037271 0 :cpressey!unknown@unknown.invalid QUIT :brown.freenode.net irc.freenode.net < 1120037274 0 :CXI!unknown@unknown.invalid QUIT :brown.freenode.net irc.freenode.net < 1120037298 0 :puzzlet!~puzzlet@61.247.148.38 JOIN :#esoteric < 1120037298 0 :cpressey!nobody@d154-20-76-195.bchsia.telus.net JOIN :#esoteric < 1120037374 0 :deltab!~deltab@82-46-140-217.cable.ubr02.smal.blueyonder.co.uk JOIN :#esoteric < 1120037374 0 :fizzie!fis@sesefras.tky.hut.fi JOIN :#esoteric < 1120037403 0 :CXI!Sanity@dialup-215.89.221.203.acc50-kent-syd.comindico.com.au JOIN :#esoteric < 1120037480 0 :cpressey!unknown@unknown.invalid QUIT :brown.freenode.net irc.freenode.net < 1120037482 0 :puzzlet!unknown@unknown.invalid QUIT :brown.freenode.net irc.freenode.net < 1120037484 0 :cpressey!nobody@d154-20-76-195.bchsia.telus.net JOIN :#esoteric < 1120037490 0 :puzzlet!~puzzlet@61.247.148.38 JOIN :#esoteric < 1120038211 0 :{^Raven^}!~{^Raven^}@82-38-204-252.cable.ubr05.shef.blueyonder.co.uk JOIN :#esoteric < 1120038256 0 :pgimeno!pgimeno@124.Red-80-59-211.pooles.rima-tde.net JOIN :#esoteric < 1120038423 0 :ZeroOne_!~vsaalo@kekkonen.cs.hut.fi JOIN :#esoteric < 1120044562 0 :mtve!mtve@mtve.vm.jvds.com JOIN :#esoteric < 1120044814 0 :ChanServ!ChanServ@services. JOIN :#esoteric < 1120044814 0 :irc.freenode.net!unknown@unknown.invalid MODE #esoteric :+o ChanServ < 1120046458 0 :ChanServ!unknown@unknown.invalid QUIT :brown.freenode.net irc.freenode.net < 1120046458 0 :mtve!unknown@unknown.invalid QUIT :brown.freenode.net irc.freenode.net < 1120046458 0 :CXI!unknown@unknown.invalid QUIT :brown.freenode.net irc.freenode.net < 1120046459 0 :fizzie!unknown@unknown.invalid QUIT :brown.freenode.net irc.freenode.net < 1120046459 0 :deltab!unknown@unknown.invalid QUIT :brown.freenode.net irc.freenode.net < 1120046459 0 :pgimeno!unknown@unknown.invalid QUIT :brown.freenode.net irc.freenode.net < 1120046461 0 :cmeme!unknown@unknown.invalid QUIT :brown.freenode.net irc.freenode.net < 1120046461 0 :lindi-!unknown@unknown.invalid QUIT :brown.freenode.net irc.freenode.net < 1120046461 0 :tokigun!unknown@unknown.invalid QUIT :brown.freenode.net irc.freenode.net < 1120046462 0 :ZeroOne_!unknown@unknown.invalid QUIT :brown.freenode.net irc.freenode.net < 1120046462 0 :puzzlet!unknown@unknown.invalid QUIT :brown.freenode.net irc.freenode.net < 1120046463 0 :BigZaphod!unknown@unknown.invalid QUIT :brown.freenode.net irc.freenode.net < 1120046470 0 :{^Raven^}!unknown@unknown.invalid QUIT :brown.freenode.net irc.freenode.net < 1120046543 0 :ChanServ!ChanServ@services. JOIN :#esoteric < 1120046543 0 :BigZaphod!~BigZaphod@66.6.34.219 JOIN :#esoteric < 1120046543 0 :tokigun!~tokigun@219.248.202.39 JOIN :#esoteric < 1120046543 0 :cmeme!~cmeme@216.184.11.2 JOIN :#esoteric < 1120046543 0 :lindi-!~lindi@kulho150.adsl.netsonic.fi JOIN :#esoteric < 1120046543 0 :deltab!~deltab@82-46-140-217.cable.ubr02.smal.blueyonder.co.uk JOIN :#esoteric < 1120046543 0 :fizzie!fis@sesefras.tky.hut.fi JOIN :#esoteric < 1120046543 0 :CXI!Sanity@dialup-215.89.221.203.acc50-kent-syd.comindico.com.au JOIN :#esoteric < 1120046543 0 :puzzlet!~puzzlet@61.247.148.38 JOIN :#esoteric < 1120046543 0 :{^Raven^}!~{^Raven^}@82-38-204-252.cable.ubr05.shef.blueyonder.co.uk JOIN :#esoteric < 1120046543 0 :pgimeno!pgimeno@124.Red-80-59-211.pooles.rima-tde.net JOIN :#esoteric < 1120046543 0 :ZeroOne_!~vsaalo@kekkonen.cs.hut.fi JOIN :#esoteric < 1120046543 0 :mtve!mtve@mtve.vm.jvds.com JOIN :#esoteric < 1120046543 0 :irc.freenode.net!unknown@unknown.invalid MODE #esoteric :+o ChanServ < 1120046568 0 :CXI!unknown@unknown.invalid QUIT :brown.freenode.net irc.freenode.net < 1120046572 0 :CXI!Sanity@dialup-215.89.221.203.acc50-kent-syd.comindico.com.au JOIN :#esoteric < 1120050043 0 :malaprop!~ph@adsl-69-208-101-159.dsl.chcgil.ameritech.net JOIN :#esoteric < 1120050948 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :wb everybody < 1120053028 0 :tokigun!unknown@unknown.invalid QUIT :"Chatzilla 0.9.68.5 [Firefox 1.0.3/20050414]" < 1120053590 0 :jix!jix@p5489E7C6.dip.t-dialin.net JOIN :#esoteric < 1120053671 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :moin < 1120055615 0 :yrz\werk!~yaro@host225-178.pool8250.interbusiness.it JOIN :#esoteric < 1120055619 0 :yrz\werk!unknown@unknown.invalid PRIVMSG #esoteric :eh... < 1120055623 0 :yrz\werk!unknown@unknown.invalid PRIVMSG #esoteric :today < 1120055632 0 :yrz\werk!unknown@unknown.invalid PRIVMSG #esoteric :i wrote an interpreter < 1120055641 0 :yrz\werk!unknown@unknown.invalid PRIVMSG #esoteric :for a hypercubical version of bf < 1120055718 0 :yrz\werk!unknown@unknown.invalid PRIVMSG #esoteric :(perfectly backward compatible) < 1120055775 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :nice < 1120055784 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :is it backward compatible in all directions? < 1120055829 0 :yrz\werk!unknown@unknown.invalid PRIVMSG #esoteric :of course ;) < 1120055855 0 :yrz\werk!unknown@unknown.invalid PRIVMSG #esoteric :is somewhere where i can post specification for the *new* language? < 1120055860 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :yeah < 1120055869 0 :yrz\werk!unknown@unknown.invalid PRIVMSG #esoteric :tell my please :) < 1120055873 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :http://www.esolangs.org/wiki/Main_Page < 1120055888 0 :yrz\werk!unknown@unknown.invalid PRIVMSG #esoteric :uff, was enough read the topic. < 1120055892 0 :yrz\werk!unknown@unknown.invalid PRIVMSG #esoteric :that's not funny. < 1120055895 0 :yrz\werk!unknown@unknown.invalid PRIVMSG #esoteric :ok... < 1120055905 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :well, not actually there; go to the Languages list, add it and create a page for it < 1120056260 0 :yrz\werk!unknown@unknown.invalid PRIVMSG #esoteric :pgimeno: are you english native speaker? < 1120056286 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :nope < 1120056312 0 :yrz\werk!unknown@unknown.invalid PRIVMSG #esoteric :uff... anyway... do you take a look on my explication when i finish to edit? < 1120056444 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :I'm afraid it will have to wait, as I'm a bit busy at work and eager to go home. Anyway, rest assured that someone (me or whoever finds it) will correct it if it's not clear enough. That's what a wiki is for, collaborative edits :) < 1120056475 0 :yrz\werk!unknown@unknown.invalid PRIVMSG #esoteric :done. < 1120056741 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :link? < 1120056786 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :nm, found it < 1120056936 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :please take a look at other wiki articles to get a feeling of how the articles look like < 1120057445 0 :yrz\werk!unknown@unknown.invalid PRIVMSG #esoteric :i see... < 1120057468 0 :yrz\werk!unknown@unknown.invalid PRIVMSG #esoteric :that'll take time... < 1120058020 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :you can let others do the work if you like < 1120058049 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :anyway it would be nice if the link to the interpreter is in the page < 1120058991 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :today in school i tried to write a BF interpreter in ti-89 basic.. but the screen is too small i lost control over my own code... :( < 1120059449 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :i'm going to write esolang interpreters for the ti-89/92+ (using ti-gcc because basic is slow).. < 1120059472 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :esolang programming at school.. yeah < 1120062669 0 :yrz\werk!unknown@unknown.invalid PRIVMSG #esoteric :can't i upload a tar.gz on http://esolangs.org/wiki/ ? < 1120062790 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :No, you have to beg someone with CVS access to put it in the files section for you. < 1120063445 0 :yrz\werk!unknown@unknown.invalid PRIVMSG #esoteric :malaprop: do you have such access? < 1120063657 0 :malaprop!unknown@unknown.invalid PRIVMSG #esoteric :No. I have no idea who has access beyond graue. < 1120063769 0 :yrz\werk!unknown@unknown.invalid PRIVMSG #esoteric :uff... < 1120063782 0 :yrz\werk!unknown@unknown.invalid PRIVMSG #esoteric :i would upload my hcbf interpreter. < 1120065723 0 :BigZaphod!unknown@unknown.invalid QUIT : < 1120065911 0 :yrz\werk!unknown@unknown.invalid QUIT :Read error: 110 (Connection timed out) < 1120066946 0 :CXI!unknown@unknown.invalid QUIT :Connection timed out < 1120067867 0 :BigZaphod!~BigZaphod@198.45.23.220 JOIN :#esoteric < 1120067872 0 :CXI!~Sanity@dialup-210.88.221.203.acc50-kent-syd.comindico.com.au JOIN :#esoteric < 1120068683 0 :yrz\werk!~yaro@host27-183.pool8250.interbusiness.it JOIN :#esoteric < 1120068715 0 :comet_11!~Sanity@dialup-210.88.221.203.acc50-kent-syd.comindico.com.au JOIN :#esoteric < 1120068753 0 :CXI!unknown@unknown.invalid QUIT :Nick collision from services. < 1120068755 0 :comet_11!unknown@unknown.invalid NICK :CXI < 1120068770 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :yrz\werk: I'm back home and have CVS access < 1120068780 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :(SVN rather, but anyway) < 1120068826 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :what's the license of the interpreter? < 1120072208 0 :cmeme!unknown@unknown.invalid QUIT :Connection reset by peer < 1120072253 0 :cmeme!~cmeme@216.184.11.2 JOIN :#esoteric < 1120072825 0 :cpressey!unknown@unknown.invalid QUIT :Remote closed the connection < 1120072827 0 :cpressey!nobody@d154-20-76-195.bchsia.telus.net JOIN :#esoteric < 1120073423 0 :calamari!~jeffryj@lilly.csoft.net JOIN :#esoteric < 1120073432 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :hi < 1120073980 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :hi calamari < 1120074217 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :hi raven < 1120074260 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :found a few more bugs in the program < 1120074273 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :adding the *.bf messed up my automatic .b adding < 1120074311 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :there was something else too, but it was minor :) < 1120074390 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :one thing I realized when working on x(y)=z, is it would be REALLY nice to either be able to edit while running, or have a copy that can be edited < 1120074418 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :I kept wanting to add comments or newlines or whatever, but I couldn't < 1120074460 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :not sure of a good way to handle it yet though.. there are keyevents I can catch, but I need to see if copy/paste still works < 1120074494 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :anyhow.. < 1120074513 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :at least we know that the theoretical version of x(y)=z works as expected < 1120074528 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :the question is whether the implementation is correct < 1120074567 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :iirc, it was just doing x(y)=z in a for loop that was crashing < 1120074589 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :so I don't even need to check x=y(z) yet < 1120074605 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :bbl .. lunchtime < 1120075068 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :i have been editing code in between runs, copy and paste works fine, a minor issue is that when the program is loaded the first character of the program is highlighted < 1120075118 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :meaning if you load some code and say immediately paste in the cvar map you trash the first character < 1120075221 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :I have noticed a few BFBASIC optimisations that could be done later on and some redundant code that could be removed < 1120075518 0 :J|x!jix@p5489AD60.dip.t-dialin.net JOIN :#esoteric < 1120075570 0 :jix!unknown@unknown.invalid QUIT :Nick collision from services. < 1120075573 0 :J|x!unknown@unknown.invalid NICK :jix < 1120077102 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :hi jix < 1120077158 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :raven: still working on your adventure game? < 1120077190 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :not much since it was released < 1120077232 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :have only been looking at using the BF statement for optimisation < 1120077420 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :raven: oh, I thought you were going to write a 10k game for the 2005 contest < 1120077481 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :calamari: oh...that one. yes i am still working on the compo game < 1120077510 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :I need to do more research, but haven't had time between other projects < 1120077562 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :I have 75% research complete, main thing is the puzzles < 1120077606 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :yeah.. mine won't have puzzles in that sense.. it might be disqualified as not text adventure-enough.. dunno :) < 1120077646 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :puzzle-less IF is still IF, there's quite a lot out there too < 1120077861 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :i'm done with my first try < 1120077865 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :but it isn't good enough < 1120077883 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :its 1.6 or 1.8k (with 2 langpacks (german and english)) < 1120077906 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :and it isn't written in a classic language < 1120078272 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :bbl.. work < 1120078274 0 :calamari!unknown@unknown.invalid QUIT :"Leaving" < 1120078529 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :calamari: I have found a bug in the FOR code < 1120078950 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :i have a new idea for an esolang < 1120079010 0 :yrz\werk!unknown@unknown.invalid QUIT :Client Quit < 1120079042 0 :yrz\werk!~yaro@host195-178.pool8252.interbusiness.it JOIN :#esoteric < 1120079191 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :hmm no < 1120079267 0 :yrz\werk!unknown@unknown.invalid QUIT :Client Quit < 1120079342 0 :yrz\werk!~yaro@host195-178.pool8252.interbusiness.it JOIN :#esoteric < 1120079506 0 :CXI!unknown@unknown.invalid QUIT :Read error: 104 (Connection reset by peer) < 1120079524 0 :CXI!~Sanity@dialup-210.88.221.203.acc50-kent-syd.comindico.com.au JOIN :#esoteric < 1120079573 0 :CXI!unknown@unknown.invalid QUIT :Read error: 104 (Connection reset by peer) < 1120079593 0 :CXI!~Sanity@dialup-210.88.221.203.acc50-kent-syd.comindico.com.au JOIN :#esoteric < 1120080389 0 :BigZaphod!unknown@unknown.invalid PRIVMSG #esoteric :trying to implement bf in taxi. brain hurts.. < 1120080412 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :taxi? < 1120080427 0 :BigZaphod!unknown@unknown.invalid PRIVMSG #esoteric :http://www.bigzaphod.org/taxi/ < 1120080453 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :ah < 1120081879 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :calamari: (when you get back...) I have improved and fixed a bug in the FOR code < 1120081943 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :ACTION ponders... Does debugging a program written in a programming language you don't know count as esoteric programming? < 1120082338 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :It does if it's perl! < 1120082355 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :But then again, programming in perl is esoteric programming *shrugs* < 1120082366 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :nah, it's Java < 1120082391 0 :jimbo00000!~BYUMUG@67.106.148.83 JOIN :#esoteric < 1120082415 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :Hullo < 1120082441 0 :jimbo00000!unknown@unknown.invalid PRIVMSG #esoteric :Hey everybody, is there any choon source on the net ouside of the examples on that one page? any at all? < 1120082608 0 :GregorR!unknown@unknown.invalid PRIVMSG #esoteric :I don't know of any, but that's just me. < 1120082733 0 :jimbo00000!unknown@unknown.invalid PRIVMSG #esoteric :not that any of this stuff is real mainstream, but google turns up nada < 1120082818 0 :jimbo00000!unknown@unknown.invalid PRIVMSG #esoteric :ok how about a Befunge93 question: how might one go about testing if a value on the stack is less than a number? < 1120082841 0 :jimbo00000!unknown@unknown.invalid PRIVMSG #esoteric :d'oh nm, i just saw it < 1120082845 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :jimno00000: have you tried alltheweb, msn, lycos, altavista et al.? < 1120082861 0 :jimbo00000!unknown@unknown.invalid PRIVMSG #esoteric :Raven: I have not, ill do it now. < 1120082887 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :i don't think there's any choon stuff. < 1120082951 0 :jimbo00000!unknown@unknown.invalid PRIVMSG #esoteric :turns up a lot of hits on peoples names, tough to filter out < 1120083725 0 :graue!~graue@ip68-100-130-21.dc.dc.cox.net JOIN :#esoteric < 1120084545 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :cpressey: about usefulness for computation < 1120084561 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :cpressey: i think it has to do with ability to implement algorithms < 1120084596 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :cpressey: i can write a smallfuck program to add two numbers < 1120084617 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :cpressey: naturally it will only add numbers up to a certain size < 1120084626 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :but to increase that size, i wouldn't need to change my program < 1120084634 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :just the alloted memory < 1120084752 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :can't do that with lookup tables :) < 1120084856 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :so i'm making a distinction between "code" and "data" ,for which i will presumably get shot < 1120084877 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :although in smallfuck the distinction happens to be clear < 1120084977 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :but then of course, even with this amount of handwaving, it's clear that SMETANA isn't useful, either < 1120084982 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :... < 1120085006 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :or at least that being able to compile smallfuck to it doesn't prove anything < 1120085324 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :grrrr. < 1120085339 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :also consider Wireworld < 1120085353 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :i think it's pretty clear that wireworld is useful < 1120085382 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :but to implement a turing machine, you need infinite space to put the tape in. < 1120085397 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :However, it's very easy to describe how to create that tape < 1120085408 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :(it's just repetitions of a simple pattern stretching out to infinity) < 1120085412 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :same with Smallfuck and SMETANA < 1120087211 0 :jix!unknown@unknown.invalid QUIT :"Banned from network" < 1120088014 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :i can write a lookup table for adding two numbers < 1120088016 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :it's easy < 1120088018 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :1, 1, 2 < 1120088020 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :1, 2, 3 < 1120088021 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :etc < 1120088093 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :for wireworld, program space == data space, and it's unbounded. < 1120088128 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :but Smallfuck programs (and tapes) and SMETANA programs are bounded. < 1120088163 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :if you have a program that isn't bounded, you seriously bend the rules for what makes an algorithm or not < 1120088175 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :e.g. if my lookup table is unbounded, then it really can add any two integers < 1120088614 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :for wireworld, an "unbounded" program would require infinite specification of the initial state... < 1120088631 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :unlike Life where you can create stuff < 1120088712 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :no, this definitely has to do with algorithms somehow. < 1120088744 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :but i'm not certain what your point is < 1120088755 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :i'm not etiher < 1120088757 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :ok < 1120088768 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :just thinking aloud. < 1120088809 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :whether a language allows arbitrary storage is really not very interesting. < 1120088871 0 :cpressey!unknown@unknown.invalid PRIVMSG #esoteric :it's fairly interesting to me < 1120089159 0 :BigZaphod!unknown@unknown.invalid QUIT : < 1120092994 0 :BigZaphod!~BigZaphod@66.6.34.219 JOIN :#esoteric < 1120094213 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :any CVS type peeps here? < 1120094904 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :hum, interesting discussion < 1120094916 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :(the above) < 1120094927 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :sorry to be late < 1120094945 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :I've been thinking about a sensible definition of "useful for computation" < 1120094994 0 :yrz\werk!unknown@unknown.invalid QUIT :Client Quit < 1120095086 0 :malaprop!unknown@unknown.invalid QUIT :Read error: 131 (Connection reset by peer) < 1120095158 0 :malaprop!~ph@adsl-69-208-101-159.dsl.chcgil.ameritech.net JOIN :#esoteric < 1120095598 0 :pgimeno!unknown@unknown.invalid QUIT :Read error: 60 (Operation timed out) < 1120096327 0 :jimbomania!~jim@ool-43511512.dyn.optonline.net JOIN :#esoteric < 1120096357 0 :jimbomania!unknown@unknown.invalid PRIVMSG #esoteric :nice wings raven < 1120096378 0 :jimbomania!unknown@unknown.invalid PRIVMSG #esoteric :anyone write choon? im trying to figure out a way to get a pattern of ascending thirds within a loop < 1120096469 0 :jimbo0000!~jim@ool-43511512.dyn.optonline.net JOIN :#esoteric < 1120096477 0 :jimbomania!unknown@unknown.invalid QUIT :Client Quit < 1120096658 0 :pgimeno!pgimeno@124.Red-80-59-211.pooles.rima-tde.net JOIN :#esoteric < 1120096712 0 :jimbo0000!unknown@unknown.invalid PRIVMSG #esoteric :whats up pgimeno? < 1120096717 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :what part of my discussion has been read? < 1120096719 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :hi jimbo0000 < 1120096732 0 :jimbo0000!unknown@unknown.invalid PRIVMSG #esoteric :you're the local choonsmith, right? < 1120096740 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :not much < 1120096770 0 :jimbo0000!unknown@unknown.invalid PRIVMSG #esoteric :well i was trying to write a looping construct to print ascending minor thirds < 1120096775 0 :jimbo0000!unknown@unknown.invalid PRIVMSG #esoteric :so x+=3 basically < 1120096803 0 :jimbo0000!unknown@unknown.invalid PRIVMSG #esoteric :i tried stepping up the notes to get a few iterations of loop - %AB++++++B.||: :|| < 1120096850 0 :jimbo0000!unknown@unknown.invalid PRIVMSG #esoteric :inside ive tried =1+ < 1120096932 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :I've never used the = instruction < 1120096948 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :my only Choon program was 99bob and all I needed was the correct looping < 1120096960 0 :jimbo0000!unknown@unknown.invalid PRIVMSG #esoteric :i thought i might be easily able to just use =-1 to get the last note played, and each time transpose up by that amount < 1120096992 0 :jimbo0000!unknown@unknown.invalid PRIVMSG #esoteric :i can manually plot out notes, but thats no fun < 1120097002 0 :jimbo0000!unknown@unknown.invalid PRIVMSG #esoteric :hell, even that is non-trivial < 1120097014 0 :jimbo0000!unknown@unknown.invalid PRIVMSG #esoteric :to get multiple octave range < 1120097073 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :I'm sorry, I need to rest, I can't make much sense of that right now in this state < 1120097088 0 :jimbo0000!unknown@unknown.invalid PRIVMSG #esoteric :thanks anyway, gnight < 1120097103 0 :pgimeno!unknown@unknown.invalid PRIVMSG #esoteric :nite all < 1120097414 0 :graue_!~graue@ip68-100-130-21.dc.dc.cox.net JOIN :#esoteric < 1120097424 0 :graue!unknown@unknown.invalid QUIT :Read error: 145 (Connection timed out) < 1120097573 0 :graue_!unknown@unknown.invalid NICK :graue < 1120097857 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :nite peeps < 1120103320 0 :jimbo0000!unknown@unknown.invalid QUIT : < 1120105175 0 :graue!unknown@unknown.invalid QUIT : < 1120107289 0 :pgimeno!unknown@unknown.invalid QUIT :Read error: 131 (Connection reset by peer) < 1120107300 0 :pgimeno!pgimeno@124.Red-80-59-211.pooles.rima-tde.net JOIN :#esoteric < 1120112527 0 :calamari!~calamari@dialup-4.240.150.52.Dial1.Phoenix1.Level3.net JOIN :#esoteric < 1120112531 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :hi < 1120118399 0 :clog!unknown@unknown.invalid QUIT :ended < 1120118400 0 :clog!unknown@unknown.invalid JOIN :#esoteric < 1120118872 0 :jix!jix@p5489AD60.dip.t-dialin.net JOIN :#esoteric < 1120118889 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :moin < 1120119688 0 :jix!unknown@unknown.invalid QUIT :"Banned from network" < 1120120134 0 :yrz\werk!~yaro@host252-181.pool8250.interbusiness.it JOIN :#esoteric < 1120123699 0 :calamari!unknown@unknown.invalid QUIT :"Leaving" < 1120131183 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :mornin peeps < 1120133467 0 :puzzlet!unknown@unknown.invalid QUIT :Client Quit < 1120135037 0 :puzzlet!~puzzlet@61.247.148.38 JOIN :#esoteric < 1120136342 0 :jix!jix@p5489AD60.dip.t-dialin.net JOIN :#esoteric < 1120137676 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :moin < 1120137989 0 :puzzlet_!~puzzlet@61.247.148.38 JOIN :#esoteric < 1120137989 0 :puzzlet!unknown@unknown.invalid QUIT :Read error: 104 (Connection reset by peer) < 1120144486 0 :jimbo00000!unknown@unknown.invalid QUIT :"Today is a good day to chat." < 1120152290 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :ACTION twiddles the volume control < 1120152324 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :ACTION pushes command-f1 < 1120152896 0 :BigZaphod!unknown@unknown.invalid QUIT : < 1120153833 0 :jumpi!~jumpi@200.157.192.146 JOIN :#esoteric < 1120154166 0 :pgimeno!unknown@unknown.invalid QUIT :Read error: 104 (Connection reset by peer) < 1120154880 0 :pgimeno!pgimeno@124.Red-80-59-211.pooles.rima-tde.net JOIN :#esoteric < 1120154990 0 :BigZaphod!~BigZaphod@198.45.23.220 JOIN :#esoteric < 1120155479 0 :jumpi!unknown@unknown.invalid PRIVMSG #esoteric :wc < 1120156193 0 :jumpi!unknown@unknown.invalid QUIT :"[BX] Time wasted: 5 millenia 5 centuries 1 decades 8 years 0 months" < 1120157020 0 :cmeme!unknown@unknown.invalid QUIT :Remote closed the connection < 1120157068 0 :cmeme!~cmeme@216.184.11.2 JOIN :#esoteric < 1120157086 0 :cmeme!unknown@unknown.invalid QUIT :Remote closed the connection < 1120157133 0 :cmeme!~cmeme@216.184.11.2 JOIN :#esoteric < 1120159066 0 :jimbo0000!~BYUMUG@67.106.148.83 JOIN :#esoteric < 1120159095 0 :jimbo0000!unknown@unknown.invalid PRIVMSG #esoteric :Hey everyone, a lovely day to you all < 1120159594 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :hi jimbo0000 < 1120159704 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :it's quiet today < 1120159719 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :oddly so < 1120159837 0 :jimbo0000!unknown@unknown.invalid PRIVMSG #esoteric :does anyone in this room own a psp? < 1120160221 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :ACTION doesn't < 1120160280 0 :jimbo0000!unknown@unknown.invalid PRIVMSG #esoteric :the homebrew scene is in the process of exploding - i am very excited < 1120160321 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :i did programming for the game-boy advance < 1120160479 0 :jimbo0000!unknown@unknown.invalid PRIVMSG #esoteric :how did you like it? how mature did those libraries eventually get, especially w respect to graphics? < 1120160544 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :oh it was.. c without stdlib and direct accessing memory-mapped registers < 1120160556 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :there was a stdlib.. and c++ worked too < 1120160563 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :and there were some graphic libs < 1120160567 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :but i never used them < 1120160593 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :an arm7tdmi 16mhz cpu isn't that fast and the less function calls the more speed < 1120160646 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :and memcpy is slow.. so i used DMA (there was one thing that was faster than dma using the load/store 4 registers at once asm instruction) < 1120160680 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :it was std gcc + std binutils + newlib < 1120160693 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :but with a different link scripts and crt0.s < 1120160713 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :and some emulators have gdb support + elf loader build in < 1120160730 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :LDM/STM (as many registers as possible) in a partially unrolled loop would probably be fastest memcpy < 1120160755 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :(using writeback to remove the need for ADD ctr,ctr,#x < 1120160760 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :DMA can be faster < 1120160772 0 :jimbo0000!unknown@unknown.invalid PRIVMSG #esoteric :what did you use to get executables onto the device? cable? < 1120160790 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :jimbo0000: flashcard and/or multi-boot cable < 1120160821 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :first i had to use a windows machine for development & flashing < 1120160826 0 :CXI!unknown@unknown.invalid QUIT :Read error: 104 (Connection reset by peer) < 1120160843 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :than i could use mac os x for development (linux build instructions) < 1120160844 0 :CXI!~Sanity@dialup-210.88.221.203.acc50-kent-syd.comindico.com.au JOIN :#esoteric < 1120160880 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :and later i could use mac os x for flashing (f2a open source flasher + a osx driver for some usb micro controller) < 1120161030 0 :jimbo0000!unknown@unknown.invalid PRIVMSG #esoteric :i had a real good time homebrewing on the dreamcast, too bad it was a dead system < 1120161048 0 :jimbo0000!unknown@unknown.invalid PRIVMSG #esoteric :but the psp - man its gonna be huge < 1120161090 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :i would prefer building my own computer (including own cpu (of course (esoteric? ^^))) and programming it < 1120161136 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :jimbo0000: dreamcast homebrew is still going strong < 1120161184 0 :jimbo0000!unknown@unknown.invalid PRIVMSG #esoteric :Raven: i havent been checking that often, it seemed more exciting in what i thought of as its heyday around 2 years ago < 1120161218 0 :jimbo0000!unknown@unknown.invalid PRIVMSG #esoteric :jix: do you think you could build a computer out of wooden gates, a river and a series of small water channels? < 1120161230 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :uh.. no < 1120161236 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :i couldn't < 1120161251 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :but.. i could design one.. but not build it < 1120161280 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :i thought about water-gates a few years ago < 1120161294 0 :jimbo0000!unknown@unknown.invalid PRIVMSG #esoteric :really < 1120161302 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :but i think wood isn't the right material for it < 1120161320 0 :jimbo0000!unknown@unknown.invalid PRIVMSG #esoteric :i think i saw a slashdot post on it - yeah, but it would have that really old-world natural look and feel :) < 1120161366 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :jimbo0000: with wooden marbles and wood.. that would be more "realistic" than wood + water < 1120161502 0 :jimbo0000!unknown@unknown.invalid PRIVMSG #esoteric :it would probably perform a lot better - i always thought of the water&wood thing as something to do after I tired of the whole world and became a recluse deep in the wilderness < 1120161562 0 :J|x!jix@p5489FF23.dip.t-dialin.net JOIN :#esoteric < 1120161588 0 :jix!unknown@unknown.invalid QUIT :Nick collision from services. < 1120161596 0 :J|x!unknown@unknown.invalid NICK :jix < 1120161604 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :what was my last msg? < 1120161611 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :? < 1120161658 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric : jimbo0000: with wooden marbles and wood.. that would be more "realistic" than wood + water < 1120161668 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :ok < 1120161681 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :any replies? < 1120161690 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric : it would probably perform a lot better - i always thought of the water&wood thing as something to do after I tired of the whole world and became a recluse deep in the wilderness < 1120161697 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :that's all < 1120161706 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :ok thx < 1120161751 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :ACTION has to learn french < 1120161860 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :ACTION hates learning french < 1120161954 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :ACTION gave up learning french after leaving school < 1120161976 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :ACTION is going to give up learning french as soon as possible (in one year) < 1120162524 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :learned 117 french words today < 1120162558 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :trained every word about 6 times < 1120162580 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :good luck with it < 1120162583 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :ok grammar now < 1120162591 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :french test tomorrow.. < 1120162603 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :and i hadn't time to learn earlier... < 1120162639 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :ACTION has said. "I have been eaten by my dinner..." at least once < 1120162663 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :lol < 1120162702 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :we hadn't passive constructs yet < 1120162761 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :but french is a lot easier than german.. so i'm lucky german is my native language and i don't have to learn it :] < 1120162794 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :german is not my native language < 1120162799 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :and i still don't have to learn it :D < 1120162812 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :lament: yes but you can't speek german i can :p < 1120162833 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :pffft < 1120162839 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :who would you speak german with? < 1120162865 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :lament: my friends... there are whole irc networks full of german users < 1120162878 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :scary < 1120162886 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :don't your friends know english? :) < 1120162896 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :lament: my german friends < 1120162924 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :and some of them arn't good at english.. < 1120162945 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :and some of them are really bad < 1120162967 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :sad < 1120163053 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :oh and i can read the original documents about Konrad Zuses plan-kalkül < 1120163079 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :damn you! < 1120163081 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :the worlds first structured programming language with functions, variables... < 1120163107 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :and i can write plan-kalkül with my keyboard < 1120163195 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :but i don't understand the plan-kalkül < 1120163300 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :that's sad < 1120163343 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :he starts to talk about plangebäude and plangruppen-bezeichnungen without telling me what the hell plangebäude are? < 1120163370 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :plangebäude == plan-buildings < 1120163390 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :plangruppen-bezeichnungen == plan group discriptions < 1120163507 0 :CXI!unknown@unknown.invalid QUIT :Read error: 104 (Connection reset by peer) < 1120163521 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :hmm ok maybe i should just read on < 1120164248 0 :CXI!~Sanity@dialup-210.88.221.203.acc50-kent-syd.comindico.com.au JOIN :#esoteric < 1120164280 0 :CXI!unknown@unknown.invalid QUIT :Read error: 104 (Connection reset by peer) < 1120164373 0 :CXI!~Sanity@dialup-210.88.221.203.acc50-kent-syd.comindico.com.au JOIN :#esoteric < 1120164442 0 :ZeroOne_!unknown@unknown.invalid NICK :ZeroOne < 1120164533 0 :CXI!unknown@unknown.invalid NICK :CXI_hatesxchat < 1120164762 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :jimbo0000: maybe i write a wood-water-gate simmualtor < 1120164885 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :i know how to build: a And gate.. a And gate with one inverted input... a Not(repowering) gate (using an And inverted one input gate and a Power line) a Buffer(repowering) gate (using an And gate and a Power line) a Xor gate (Using 2 And inv. input and a Or gate) and a Or gate < 1120165053 0 :jimbo0000!unknown@unknown.invalid PRIVMSG #esoteric :a simulator... what kind of sim? graphical? physical? < 1120165067 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :jix: every logic gate can be constructed from NAND gates if you want to get primitive < 1120165088 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :{^Raven^}: but i want to save wood < 1120165122 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :and Or,And and And with one inverted input are the simplest gates i know (for building them with wood and for water) < 1120165220 0 :jimbo0000!unknown@unknown.invalid PRIVMSG #esoteric :save wood, good for the environment. is there a way to save water too? < 1120165245 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :yes < 1120165257 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :you only need as much water as you need to fill the whole "circuit" < 1120165279 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :and if you save wood and space you save water too < 1120165319 0 :jimbo0000!unknown@unknown.invalid PRIVMSG #esoteric :so how did you mean a 'simulator'? < 1120165352 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :you can see the water flowing in the wooden pipes and the wooden gates moving etc... < 1120165541 0 :jimbo0000!unknown@unknown.invalid PRIVMSG #esoteric :mmm sounds like it might look nice in 3d < 1120165554 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :ok added a 2-bit mux (wood saving) < 1120165616 0 :jimbo0000!unknown@unknown.invalid PRIVMSG #esoteric :how many degrees of freedom do all these gates have? and whats the topography of the ground and water channels? < 1120165785 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :hm? < 1120165807 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :degrees of freedom? < 1120165819 0 :jimbo0000!unknown@unknown.invalid PRIVMSG #esoteric :well, what kind of moving parts are the gates comprised of, are they just solid pieces that rotate? < 1120165819 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :designd a woodsaving RS-Latch < 1120165842 0 :jimbo0000!unknown@unknown.invalid PRIVMSG #esoteric :and as for the water, i guess it needs some kind of gradient to flow, maybe a slight hill? < 1120165851 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :they are pipes and shelves with holes that can move < 1120165900 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :jimbo0000: i will include druck(don't know the english word) calculations < 1120165942 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :pressure? < 1120165989 0 :jimbo0000!unknown@unknown.invalid PRIVMSG #esoteric :yea, babelfish says pressure < 1120166013 0 :jimbo0000!unknown@unknown.invalid PRIVMSG #esoteric :so these pipes will be closed, with pressure driving the mechanism? < 1120166019 0 :BigZaphod!unknown@unknown.invalid PRIVMSG #esoteric :fun event: build those wood and water gates in real life on carts with hoses and stuff. then you could do a live-action esolang thing where you code by pushing the carts around and making connections. < 1120166019 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :yes < 1120166096 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :maybe start an amish computing group ;) < 1120166104 0 :BigZaphod!unknown@unknown.invalid PRIVMSG #esoteric :{^Raven^}: lol < 1120166122 0 :BigZaphod!unknown@unknown.invalid PRIVMSG #esoteric :it'd be a great event at an esolangcon. bring swimwear. :) < 1120166159 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :especially is the patricipants were used to represent bits ;) < 1120166186 0 :BigZaphod!unknown@unknown.invalid PRIVMSG #esoteric :stdout could be a large firehose and the screen could be the audience. < 1120166211 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :but i think the marble approuch is easier to build < 1120166221 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :of course that would me a long persistance display < 1120166592 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :/away < 1120166905 0 :lament!unknown@unknown.invalid PRIVMSG #esoteric :BigZaphod: awesome < 1120167099 0 :CXI_hatesxchat!unknown@unknown.invalid QUIT :Read error: 104 (Connection reset by peer) < 1120167154 0 :comet_11!~Sanity@dialup-210.88.221.203.acc50-kent-syd.comindico.com.au JOIN :#esoteric < 1120167742 0 :comet_11!unknown@unknown.invalid NICK :CXII < 1120168432 0 :CXII!unknown@unknown.invalid NICK :CXI < 1120168743 0 :jix!unknown@unknown.invalid PRIVMSG #esoteric :/back < 1120169482 0 :jix!unknown@unknown.invalid QUIT :Remote closed the connection < 1120170827 0 :calamari!~jeffryj@lilly.csoft.net JOIN :#esoteric < 1120170833 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :hi < 1120171195 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :hi calamari ;) < 1120171277 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :hi raven < 1120171290 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :I haven't had a chance to look at bfbasic.. working even now < 1120171319 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :ACTION goes 'eep'! < 1120171358 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :yeah.. I do research work at the university, and a paper deadline is approaching quickly < 1120171420 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :there is one upcoming conference in Scotland, but I dunno if I'll have my name on that paper < 1120171457 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :sounds potentially very cool, can I ask the subject you are researching? < 1120171598 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :sure.. we are working on a package installation tool called sotrk. Right now it runs on a research network called PlanetLab, but we are extending it to work on Vservers, bsdjails, etc < 1120171633 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :Stork shares packages between clients on the machine, reducing disk space usage and possibly memory usage as well < 1120171670 0 :BigZaphod!unknown@unknown.invalid PRIVMSG #esoteric :Planet Lab.. I tried to get in on that network once, but since I'm not currentl affiliated with any university.. *sigh* < 1120171672 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :It also has a keyfile system to allow anyone to contribute packages < 1120171710 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :I'm not a huge planet lab fan, but hey, I've learned a lot working on this thing :) < 1120171740 0 :BigZaphod!unknown@unknown.invalid PRIVMSG #esoteric :calamari: well, never used it, but it looked neat. I was working on a p2p app and that seemed liek a great way to test it. although development has stalled as of late. < 1120171811 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :zaphod: the problem with planetlab is that it is continuously overloaded.. but yeah, it's cool in certain ways. I think it's neat how you can appear to have root on a machine when you really dont < 1120171849 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :I think companies can sign up for planetlab, but it costs $ < 1120171888 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :oops, sotrk -> stork ;) < 1120171904 0 :calamari!unknown@unknown.invalid PRIVMSG #esoteric :hehe, anyways back to work for me < 1120171916 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :have fun calamari < 1120171916 0 :BigZaphod!unknown@unknown.invalid PRIVMSG #esoteric :calamari: have a good one < 1120173515 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :BigZaphod: how long did taxi take to create? That is one twisted language. < 1120173531 0 :BigZaphod!unknown@unknown.invalid PRIVMSG #esoteric :About a week. < 1120173561 0 :BigZaphod!unknown@unknown.invalid PRIVMSG #esoteric :I've found a few bugs here and there over the last couple days, though. Uploaded a new version (if you're playing with it). < 1120173730 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :The source code makes for interesting reading, i especially like the error messages < 1120173730 0 :calamari!unknown@unknown.invalid QUIT :"bbl" < 1120173780 0 :BigZaphod!unknown@unknown.invalid PRIVMSG #esoteric ::) < 1120173791 0 :BigZaphod!unknown@unknown.invalid PRIVMSG #esoteric :I'm working on a bf interpreter written in taxi.. < 1120173799 0 :BigZaphod!unknown@unknown.invalid PRIVMSG #esoteric :lots of pain.. < 1120174389 0 :BigZaphod!unknown@unknown.invalid PRIVMSG #esoteric :{^Raven^}: have you tried to do anything with it? < 1120174428 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :have pondered 99 bottles of beer, but as a thought experiment it was not good < 1120174467 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :ACTION still gets lost in GTA:VC < 1120174471 0 :BigZaphod!unknown@unknown.invalid PRIVMSG #esoteric :I think 99 wouldn't be too bad once you dug in and got used to it. < 1120174502 0 :BigZaphod!unknown@unknown.invalid PRIVMSG #esoteric :lol.. yeah, I've developed a rather heightened sense of left and right now. < 1120174560 0 :BigZaphod!unknown@unknown.invalid PRIVMSG #esoteric :I have 283 lines of taxi source which manages to read a single line from stdin and break it down into the bf tokens and tests for each symbol correctly.. now I just have to, ya know, make the symbols do stuff. < 1120174571 0 :BigZaphod!unknown@unknown.invalid PRIVMSG #esoteric :the looping frightens me, though. < 1120174577 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :diagonal directions, hills and valleys would be a suggestion for Taxi++ < 1120174608 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :a BF terp sounds scary, but atm you're probably the only person capable < 1120174676 0 :BigZaphod!unknown@unknown.invalid PRIVMSG #esoteric :probably atm, yeah. with whirl it is funny because I can hardly do anything with it even though I made it. tokigun is by far the biggest whirl expert I know of. < 1120174831 0 :BigZaphod!unknown@unknown.invalid PRIVMSG #esoteric :this bf interpreter is quite slow.. does no computation yet but it still manages to take several seconds to process a 50 or 60 character input string. that's on my 1.66ghz powerbook. scary. < 1120174898 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :your taxi interpreter could pre-parse and compile programs into something faster to interpret < 1120174985 0 :BigZaphod!unknown@unknown.invalid PRIVMSG #esoteric :no doubt. it half does at the moment. it parses all the commands up front and builds a list with the command code, but the data is kept as strings and everything is looked up while it is running. < 1120175025 0 :BigZaphod!unknown@unknown.invalid PRIVMSG #esoteric :plus it does all the math for determining left and right at run time as well, which in theory it wouldn't need to. < 1120175060 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :you could tokenise the strings to single byte values < 1120175102 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :and precompute destinations before execution < 1120175126 0 :BigZaphod!unknown@unknown.invalid PRIVMSG #esoteric :yeah that would probably help a lot. < 1120175166 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :even with brainfuck such things can make a huge difference to execution speed < 1120175221 0 :BigZaphod!unknown@unknown.invalid PRIVMSG #esoteric :of course if the language was slightly more sane to begin with, that'd help too. ;) < 1120175304 0 :BigZaphod!unknown@unknown.invalid PRIVMSG #esoteric :one of these days I want to try to make a compiler for one of my languages using http://llvm.cs.uiuc.edu/ or something. never done that before. < 1120175478 0 :BigZaphod!unknown@unknown.invalid PRIVMSG #esoteric :( assuming I'm even understanding LLVM correctly :) ) < 1120175526 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :that looks like a very interesting tool chain < 1120175717 0 :BigZaphod!unknown@unknown.invalid PRIVMSG #esoteric :I read someplace it is quite easy to use for compiling simple languages or something. figured it'd make a perfect tool for a fun esolang someday. < 1120175756 0 :BigZaphod!unknown@unknown.invalid PRIVMSG #esoteric :somewhere I ran across a sample that implemented a forth variant compiler using LLVM. < 1120175765 0 :BigZaphod!unknown@unknown.invalid PRIVMSG #esoteric :looked pretty cool. < 1120175806 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :ACTION will learn some more about llvm < 1120175848 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :ACTION needs to create an esolang < 1120175866 0 :yrz\werk!unknown@unknown.invalid PRIVMSG #esoteric :hi all < 1120175873 0 :BigZaphod!unknown@unknown.invalid PRIVMSG #esoteric :hi yrz\werk. < 1120175875 0 :yrz\werk!unknown@unknown.invalid PRIVMSG #esoteric :someone checked out hcbf? < 1120175879 0 :{^Raven^}!unknown@unknown.invalid PRIVMSG #esoteric :hullo < 1120175897 0 :yrz\werk!unknown@unknown.invalid PRIVMSG #esoteric :i didn't post the interpreter yet < 1120175911 0 :BigZaphod!unknown@unknown.invalid PRIVMSG #esoteric :hypercubes hurt my brain as I always try to visualize them. < 1120175913 0 :yrz\werk!unknown@unknown.invalid PRIVMSG #esoteric :but i don't know *WHERE* to host the tar.gz < 1120175930 0 :yrz\werk!unknown@unknown.invalid PRIVMSG #esoteric :BigZaphod: no way to visualize. < 1120175950 0 :BigZaphod!unknown@unknown.invalid PRIVMSG #esoteric :yrz\werk: my brain refuses to listen to me when I say such things. < 1120175954 0 :yrz\werk!unknown@unknown.invalid PRIVMSG #esoteric :just *abstract* < 1120175977 0 :yrz\werk!unknown@unknown.invalid PRIVMSG #esoteric :BigZaphod: will help you if i change it to be 5-n ? < 1120175989 0 :yrz\werk!unknown@unknown.invalid PRIVMSG #esoteric :oops < 1120175992 0 :yrz\werk!unknown@unknown.invalid PRIVMSG #esoteric :5d