2005-06-01: 02:09:10 -!- wooby has joined. 02:11:20 hello, wooby 02:13:11 hi 02:14:16 what's crackin? 02:16:40 writing an interpreter (slowly) for a new esolang 02:37:34 that's awesome 02:37:46 an esolang of your own design? 02:52:37 yes 02:52:57 it is based on the principle of insertion sort 02:55:10 that's interesting 03:16:03 *p++ parses as *(p++), right? 03:24:59 -!- kipple has quit (Read error: 60 (Operation timed out)). 04:20:32 -!- malaprop has quit ("quit"). 05:25:30 Wow, logicex-2 is a bitch. 05:25:35 I'm never going to beat this >_> 05:26:42 Until jix does, then I will be forced to defeat his :) 05:31:35 heh, i just realized these two operators i had proposed are exactly the same: 05:31:36 ^ Strings String Provides whichever comes later out of op1 and op2, 05:31:36 or "" if they are equal 05:31:36 $ Strings String Returns "" if both strings are "", the string that 05:31:36 comes later out of op1 and op2 if neither string is 05:31:37 "", or the string that is not "", if one of them is 05:31:38 "" 05:31:47 obviously, i had not had my coffee when i made those up 05:33:35 have you considered making an interactive FYB, wherein players could control their warriors at runtime somehow? 05:33:43 using , and . of course 05:41:16 Why no, no I have not :-P 05:50:25 it wouldn't work very well 05:50:45 i can't imagine a situation where a person at the keyboard could decide what to do better than the program 06:30:16 -!- wooby has quit. 06:35:40 You would need to have a really, really good grasp on what the program was doing. 06:35:47 Which is incredibly difficult to get. 06:35:51 (Part of the point, really) 06:39:14 and if you were that smart, though, you would just make your program figure it out, right? 06:49:48 Exactly ;) 06:53:44 i hope you will enjoy my new esoteric programming language 06:53:56 the interpreter is not working right, i will have to fix it tomorrow, good night 07:59:59 -!- clog has quit (ended). 08:00:00 -!- clog has joined. 11:19:25 -!- sp3tt has joined. 11:21:04 ";; warning: alcohol destroys brain cells! (not as much as brainfuck)" rofl 11:22:39 hi sp3tt, yeah that was a good advice :) 11:23:11 -!- sp3tt has quit (Client Quit). 12:25:08 -!- kipple has joined. 13:05:00 -!- jix has joined. 13:09:28 kipple: your 99bob is still in the first place closely followed by Shakespeare 13:09:54 moin! 13:13:40 moin jix 13:14:15 hi 13:14:45 pgimeno: yes, wonder how long it's gonna last 13:18:15 it's a hard competition, both are equally fascinating :) 13:19:21 bbl 13:22:21 * jix has an idea... .. is it turing complete ?.... *thinks* 13:26:21 HAH# 13:39:54 i have an idea for an ultimate language 13:40:29 programs will look like levels of a platform game .. and even work a bit like them ^^ 13:41:21 hmm. 13:41:32 is there a nethack esolang, btw? 13:46:21 my language will use a graphical editor.. text representation is.. to complex (maybe i write a text exporter and importer.. but graphical editor comes first) 13:46:53 yay! the world needs more non-ascii based esolangs! 13:47:20 name: bit-dropper 13:49:05 anyone here knows 'the hellacopters' ? 13:49:12 (band) 13:49:15 you mean the band? 13:49:38 yes 13:49:43 I've heard about it. Aren't they finnish or something? 13:49:49 swedish afaik 13:49:54 they rule 13:50:05 only heard about them, not heard them... 13:51:33 the flaming sideburns rule too.. they are finnish 14:03:04 -!- J|x has joined. 14:03:34 -!- jix has quit (Nick collision from services.). 14:03:40 -!- J|x has changed nick to jix. 14:03:53 what was my last msg ? 14:04:28 flaming sideburns 14:08:34 -!- malaprop has joined. 14:29:44 ah 14:30:53 moin malaprop 14:33:14 -!- sp3tt has joined. 14:35:35 moin sp3tt 14:39:24 Hi. 14:40:41 jix: good news for your graphical language: http://www.99-bottles-of-beer.net/language-labview-729.html :) 14:40:51 (99bob supports images now) 14:41:09 wow 14:41:12 and, Hi sp3tt (what kind of nick is that anyway???) 14:41:27 does it support image+text (text for pasting it into the interpreter) 14:41:31 LOL... 14:42:27 jix: no idea. I don't even know what you mean... ;) 14:42:33 because i'm not going to store the data as images 14:42:54 but it would be too hard to write programms in the native (binary) format 14:43:25 The IKEA language? 14:43:42 no 14:43:44 bit-dropper 14:43:48 haha. no I don't think that one will be made 14:45:21 It would own. 14:45:37 Do you have a link for bit-dropper? 14:45:53 no i just thought a bit about it 14:46:28 the programs look like platform-game levels.. and work a bit like them.. hmm a mix of: falldown,lemmings and super mario 14:48:12 the levels look like super mario.. the object movement is a bit like falldown.. but the strategy is a bit like lemmings 14:49:28 away 14:54:25 back 14:58:09 in bit-dropper bits can slide,fall,roll,jump,bounce,fly... 14:58:44 i hope it's turing complete.. but anyway it's crazy 15:00:00 ok i'm still connected... (it's quiet here) 15:00:58 back 15:01:25 away 15:03:34 does anybody know if there is a command line utility like the linux timer available for windows? 15:06:21 do you mean the "time" command? 15:06:28 yeah 15:06:34 time not timer :P 15:06:49 yes: use cygwin :P 15:06:58 no thanks 15:07:11 any bash will do; I think there's a non-cygwin bash 15:07:25 but 'time' is a bash command 15:07:30 mingw+msys 15:07:36 arg.. i'm away.... 15:07:39 then yeay 15:07:44 oh, later then 15:08:02 yeay -> yeah (I mean: msys has a bash) 15:08:26 Bash for windows? 15:08:34 sure 15:08:48 anyway, I installed perl on my windows box in order to run my sous-chef version of 99bob in a reasonable amount of time, and it needed only 5 minutes :) 15:08:50 Now Windows can bash instead of being bashed! Resistance is futile! 15:09:25 kipple: "only" as compared with what? I don't remember the other timings 15:09:56 well, I never ran it with 99 verses, but I ran it with fewer, and estimated it to take about 45 minutes 15:10:17 not bad then 15:10:51 sp3tt: cygwin is around for several years actually; msys is more modern but is still a bit old 15:11:17 well, the windows box is 1.4GHz Duron compared to 187MHz K6, so it wasn't really a surprise :) 15:11:57 pretty linear :) 15:12:14 I like cygwin for one reason: it's basically a distribution 15:12:23 anyway, the time it takes to run a chef program with sous-chefs grows exponentially with the number of sous-chef calls... 15:12:47 exponentially? wasn't it quadratically? 15:12:59 hmm. yes 15:13:08 maybe... 15:13:35 I think I could find an exponantial function that is a good estimate for it as well. (I don't have enough data really to be precise) 15:13:55 just wondering based on what you told 15:14:29 I have no idea on how the interpreter is written anyway 15:14:40 it's the spec, not the interpreter 15:15:18 basically you have to pass ALL data in the program as parameters (by value!) to each function call 15:16:45 hum, how much data are we talking about? 15:17:15 depends on the program. in this case, the lyrics to 99bob 15:17:40 that's not too much, so I guess the interpreter could be more efficient 15:21:18 I'd guess so 15:22:13 We-ell, the interpreter could pass the contents by-reference and do some copy-on-write -like thing. 15:23:10 (Disclaimer: I don't really know anything about Chef.) 15:24:54 me neither, apart from having fun with the Fibonacci Numbers with Caramel Sauce 15:25:55 btw, copy-on-write is just another example of a lazy strategy :P 15:26:28 * pgimeno promises he'll be quiet next time 15:33:19 oh man 15:33:34 the world needs a language based on recursive regular expressions 15:34:02 it could be called Two Problems :D 15:38:23 Or brain-fubar. 15:38:42 Why "two problems"? 15:39:13 it's a quote from Jamie Zawinski 15:39:38 "Some people, when confronted with a problem, think 'I know, I'll use regular expressions.' Now they have two problems." 15:41:04 heheh, it'd be a functional language 15:41:07 oh, so evil >:) 15:41:16 Heh, I was just about to point out it'd be FP. 15:41:41 that's so awesomely evil 15:43:00 the primary conditional could be a list of regexps, works like a switch (without fallthrough) 15:43:17 who said anything about a conditional? :) 15:43:44 bah, I suppose it's necessary 15:43:47 *wonders* 15:44:05 Is not so much a conditional as matching. Like how in ML you'll have to write f for the empty list as well as for the full one. 15:44:43 ooh 15:44:47 maybe just use the regex match operation 15:45:12 and keep sets of match:sub triplets 15:45:17 er, pairs 15:47:50 not sure whether I need variables *messes around* 15:53:45 er, by variables I mean functions 15:53:56 yeah, guess I do 15:57:56 CXI "Some people, when confronted with a problem, think 'I know, I'll use regular expressions.' Now they have two problems." < where is this quote from? 15:58:20 comp.lang.emacs 15:58:26 fairly famous 15:58:52 Excellent, excellent quote :) 16:02:28 GregorR: I just found this which may be of interest to you: http://fishbowl.pastiche.org/2003/08/18/beware_regular_expressions 16:03:32 I'll look at it later, time to go to school. 16:05:21 sure 16:08:57 blagh, I keep forgetting all the perl I know :D 16:09:33 ah, crap, I can't store my function table as a hash because of pattern matching 16:10:02 or maybe I could store it as a hash of hashes... yes! >:) 16:11:21 CXI: Are you implementing Two Problems now? 16:11:25 yeah 16:11:30 neat 16:12:08 actually pretty easy to write in perl, I'm just working out how to do the functional bit properly 16:18:06 I haven't done data structures in perl for ages, wow 16:39:54 -!- j|x has joined. 16:39:59 back 17:24:08 -!- jix has quit ("This computer has gone to sleep"). 17:46:31 oh... 17:51:28 -!- j|x has quit ("Leaving"). 17:54:23 hmm 17:54:32 I just realised I may be doing this in an unnecessarily complex way 17:54:50 right now I'm doing function:/pattern/:/match/replace/ 17:54:59 but pattern and match are fundamentally the same thing 17:59:43 yes 18:00:41 * CXI kicks himself for being silly 18:00:50 most of the development time here is forgetting how to use perl 18:13:49 yay 18:13:50 hello world works 18:17:02 erk, I've hit another "my brain stopped working" roadblock 18:17:02 -!- jix has joined. 18:19:15 Example of the language? 18:19:43 actually, the problem is working out how the language should go 18:22:57 actually, hmm, I think I've got it 18:23:02 just have to work out how to write it down 18:23:16 what language ? 18:23:25 Two Problems :D 18:23:35 a functional language based entirely on regular expressions 18:23:58 using which regex engine ? 18:24:17 pgimeno: hey, no problem :) 18:24:17 perl's, at the moment 18:24:36 does perl support recursive regexpes ? 18:24:39 the articles aren't safe in wikipedia 18:25:09 jix: not really... but yes with a little craziness 18:25:17 the perl regex engine lets you use a function in the replacement of a regex 18:25:17 use: http://www.geocities.jp/kosako3/oniguruma/ 18:25:31 that's not recursive pattern matching 18:26:09 with oniguruma it's possible to test a string like (()((()())())) for correct ( ) placement 18:35:44 aha! 18:37:22 ZeroOne: wow, that's a 50 hour lag :) 18:37:40 yeah, I was gonna say I thought I saw the comment that started that a couple days ago 18:38:47 pgimeno: just some military service in between there ;) 18:39:18 ZeroOne: hehe, no prob, just probably the biggest lag I've seen on IRC 18:40:29 pgimeno: ok :) I've got this shell running irssi and it notifies me about new messages when I come back. 18:40:58 graue has been working on porting your articles 18:41:27 good, good 18:42:17 (see http://esoteric.voxelperfect.net/wiki/Special:Recentchanges ) 18:46:54 nice 18:50:38 ugh 18:50:44 turns out perl probably wasn't the best choice for this 19:06:46 haha, this is so ugly, but I think it works 19:08:27 !! hehe 19:09:07 main:/(.*)/(head $1)/ 19:09:08 head:/^(.).*$/$1/ 19:09:12 best syntax ever 19:10:44 nice 19:11:08 C:\Projects\TwoProblems>2probs test.2p hello 19:11:08 h 19:11:17 heh, and only about 5 regex calls to do that, too :P 19:11:42 though I think recursion may not entirely work... :D 19:12:09 actually, scratch that, I know recursion doesn't work 19:12:27 you should make () do print and plain be code. optimize for the common case, eh? 19:13:07 CXI: doesn't that form a context-free grammar and not a regular grammar? 19:14:34 Hm, it's not quite a CFG. Close, tho. 19:14:45 -!- Keymaker has joined. 19:15:03 except if you can use main/^.(.*)$/(main $1)/ or something similar 19:15:10 er, main: 19:15:32 which you should be able to do according to the spec of the language, but for some stupid reason I accidentally didn't implement right 19:17:14 oh dear, I definitely need to go to bed :P 19:17:14 CXI: You should have the ability to have multiple rules of the same name that match different things. main:/^foo.*/saw foo $1/ \n main:/^bar.*/saw bar $1/ 19:17:18 Then you'be got conditionals. 19:17:29 yeah, theoretically that's what should happen 19:18:58 I'll fix it up later when I'm not so tired 19:19:37 where are the specs ? 19:19:47 jix: Scroll up. :) 19:23:14 hmhmmm... 19:23:16 anyway, definitely need sleep 19:23:22 catch you guys later 19:23:25 later! 19:23:39 $_ 20:01:16 -!- Keymaker has quit ("Freedom!"). 20:18:20 -!- kipple has quit (brown.freenode.net irc.freenode.net). 20:18:20 -!- cpressey has quit (brown.freenode.net irc.freenode.net). 20:24:02 GregorR: the specs for FYB need an extension: ;: added on runtime and unmatching ;:,{} and [] 20:24:12 -!- kipple has joined. 20:24:12 -!- cpressey has joined. 20:32:20 GregorR: 1 20:32:23 oops 20:32:25 GregorR: ! 20:37:14 -!- sp3tt has quit ("Chatzilla 0.9.68a [Firefox 1.0.4/20050511]"). 20:54:41 -!- jix has changed nick to jix|crackattack. 21:46:19 the interpreter for my insertion sort language is nearly complete 22:16:16 -!- jix|crackattack has changed nick to jijx. 22:16:23 graue: complete ? 22:16:27 nearly 22:16:42 i am still working on the regular expression matcher, an essential feature 22:21:31 * jijx can't wait 22:21:36 -!- jijx has changed nick to jix. 22:24:30 is it written in perl? 22:27:04 night 22:27:37 -!- jix has quit ("Banned from network"). 22:28:50 it is written in C 23:09:53 http://illegal.coffeestops.net:3703/sort.zip - enjoy 23:23:25 is it already finished? wow 23:24:00 heh. that's one quick development process! 23:29:18 -!- calamari has joined. 23:29:20 hi 23:29:29 hi 23:29:59 hi calamari 23:31:06 made some nice improvements to EsoShell (bash-style command history, program return values/$?, better defined API and JavaDoc comments, but won't be able to upload it until the 8th 23:31:35 I waited too long to have my phone service switched and so I'll be without an internet connection until then.. oops! 23:32:09 Unless I copy it all on a floppy and come back here to upload.. could do that :) 23:32:27 I want to implement globs, forgot about those 23:32:37 are you in an internet café? 23:32:44 nope, I'm at school 23:32:47 ah 23:32:49 when you say API, does that mean that there will be an easy way for third party apps to be made? 23:33:42 kipple: yes, for sure.. I'm offering familiar exit(), out.__ and in.. as well as main(String[] args) 23:33:52 btw, do you have the link again? forgot to bookmark... 23:34:03 Writing an EsoShell app is very similar to writing a Java console app 23:34:32 http://lilly.csoft.net/~jeffryj/EsoShell or http://kidsquid.com/EsoShell 23:34:38 hmm. is there any reason you need a special API? couldn't you just execute a normal console app? 23:34:44 in an applet? 23:35:00 yes. console apps are classes like everything else, no? 23:35:14 System.exit() wouldn't work, I know that 23:35:25 you're probably right 23:35:29 System.out would print to the Java console, rather than the applet window 23:35:38 can't you redirect that? 23:35:51 possibly.. I'll do that if possible 23:35:57 maybe not. it was just a thought 23:36:01 might cause some kind of security exception though 23:36:32 graue: octothorpe = # ? 23:36:33 but, good idea if it works I'll do it :) 23:36:58 Google says octothorpe is a #. 23:37:15 thanks fizzie 23:37:22 anyhow.. I'm pushing back multiple threads/taskbar for now 23:37:56 can't you use a custom made System object to override normal System.exit()? 23:38:19 kipple: aren't the methods final? 23:38:28 hmm. perhaps 23:39:02 cool 23:39:07 they don't seem to be 23:39:33 I'll try that too, then :) 23:39:39 anyway, initializing an app might be as easy as this: ConsoleApp c = new ConsoleApp(); c.main(args); 23:39:59 but there are probably issues I'm not thinking of here... 23:40:05 I'm already runnign the applications just fine 23:40:29 But, If I can provide amore familar interface than I am, that's great 23:42:13 hhmm, System.exit is final.. might not work well if I decide to do the multithreaded thing in the future 23:42:20 err final -> static 23:43:59 hello 23:44:17 i've been working on the sort thing since yesterday 23:44:31 also, () and [] in regular expressions don't work yet 23:45:19 I'm taking a look 23:45:40 but there aren't many examples... 23:45:51 wel,, I'm gonna go grab some food.. I'll be baack when I can 23:45:51 -!- calamari has quit ("Leaving"). 23:45:57 i haven't figured out how to write a nontrivial program yet 23:47:12 hmm, regular expressions in general seem to be buggy 23:47:15 I'd like to see examples of how the description applies to the language 23:47:44 it matches the name of the current expression, which it shouldn't, and the ! modifier doesn't work at the end of the search string 23:48:01 I have some difficulty understanding some aspects of the language 23:48:03 here's an alternate hello world that demonstrates regular expressions: 23:48:03 world := "" 23:48:03 hello := "hello, " "w...." "" ? ~ 23:48:43 substituting ".!d" for "w...." also works 23:50:19 is the initial order important? 23:51:15 no 23:51:24 the expressions are always maintained in sorted order 23:51:39 ok 23:51:53 absence of operator is concatenation, right? 23:52:04 no, ~ is concatenation 23:52:20 a literal number or string just pushes itself onto the stack 23:52:29 oh ok 23:52:36 I missed the stack part 2005-06-02: 00:04:38 I'm too tired right now to try to figure out how to do anything with sort 00:04:52 I'm off to bed, good night 00:07:37 good night 00:17:47 updated http://illegal.coffeestops.net:3703/sort.zip, fixed one regex bug 00:23:20 this now works: 00:23:20 world := "" 00:23:20 hello := "hello, " ".!" "" ? ~ 00:55:11 heh, i just realized you can trick the matcher into matching a literal ! 00:55:42 "r@!", if you can make sure there won't be an r at the beginning, will match only "!" 01:50:56 jix: True. Quick rundown: 01:51:22 A) If you put a [, { or : somewhere where there HASN'T been one, it will work just like any other. If you put one where there HAS been one, it will still be spent. 01:51:35 (That is, a : placed where there has been one will still be spent) 01:52:05 B) If a jump is to be made, but there is no matching symbol, the jump is ignored. 01:52:26 IE: in [[], if it hit that first [ and decided to jump, it wouldn't, and in []] if it hit that second ] and decided to jump, it wouldn't. 02:20:53 -!- malaprop_ has joined. 02:29:25 hey Greg, ph, what do you guys think of my sorted language innovation? 02:34:56 -!- malaprop has quit (Read error: 110 (Connection timed out)). 02:37:21 Sorry, haven't taken a look at it yet. Also, my name is Gregor ;) 02:38:15 -!- kipple has quit (Read error: 110 (Connection timed out)). 02:43:50 eliminating all syllables but the first is a typical way of abbreviating someone's name 02:44:31 Yes, I'm well aware of that, but I personally don't like blunt names, such as one-syllable names starting and ending with the same letter ;p 02:46:24 so you are offended by the 99bob program in ORK, which uses someone named Bob as a mathematician? 02:50:15 or are you only offended when blunt names are used to address you? 02:51:26 anyway, check out the sort lang 02:51:37 i fixed all regex bugs of which i am aware 03:39:48 -!- graue_ has joined. 04:14:41 i posted some thoughts on sort at http://esoteric.voxelperfect.net/research/ 04:14:48 as well as an updated package 04:14:51 -!- graue_ has quit ("Leaving"). 04:27:22 I'm not offended by blunt names. 04:27:39 And if somebody wants to be called by a blunt name, I'll call them that. 04:27:41 I just prefer not to myself. 04:27:43 hey Gregor 04:27:57 as long as you're here, why not give Sort a look? 04:28:37 Sure, por que no. 04:28:46 (Please ignore my terrible Spanish :-P) 04:28:52 i don't even know what that means 04:29:18 In my happy universe where I know any Spanish, it means "Why not?" 04:33:49 cool 04:36:03 So, stack elements are a sort of "variant," that can be either a number or a string? 04:36:55 if by "variant," you mean they get automatically converted to whichever form an operator requires when the operator is used, then yes 04:37:45 Oh, OK. 04:44:23 *brain melting* 04:45:21 heh, pretty esoteric, eh? 04:45:54 Very. 04:46:00 I'm trying to wrap me brain around it. 04:46:20 I don't quite understand what triggers the program to end ... 04:46:38 when there is only one expression left 04:46:46 all expressions but one must have deleted themselves 04:46:48 OHhhhhhhhhhhhhhhhhhhhhhhhhhhhhh 04:47:36 And when you create an expression with :=, what does that expression evaluate to when it gets to it? 04:48:13 That is ... 04:48:18 Not when you "create" an expression ... 04:48:23 But when one expression translates into another. 04:48:23 -!- malaprop_ has quit ("quit"). 04:48:33 translates into another? 04:49:11 an expression that is evaluated must result in exactly one value on the stack 04:49:25 that value if it is a number is converted to a string, then it becomes the new name of the expression 04:49:30 an expression that is renamed to "" is deleted 04:49:39 the number 0 converts to the string "" 04:50:09 It becomes the new NAME of the expression ... 04:50:24 (How to phrase this ... ) 04:50:59 And when it comes across that expression again (now with the new name), what does it evaluate to? 04:51:25 whatever the result of the expression is 04:51:45 the expression is unchanged, although the results of a regex searching the expression name list may be 04:51:55 So, for simple string literals, just itself, though other------- 04:51:59 I was just mentally computing that. 04:52:07 OK, thank you. 04:52:46 I think the doc could be helped a bit by explicitly defining all of the nomenclature at the top. 04:53:05 like "push", "pull", "regex", "expression"? 04:53:34 uh oh, the interpreter has another bug 04:54:18 I guess [name] := [expression] is pretty much what I was looking for, and is there. 04:54:27 So ... *cough* ... ignore me. 04:54:33 okay 04:54:47 lalala 04:55:04 hey lament 04:56:21 feel like trying a new esolang today? 04:56:30 no 04:56:51 maybe tomorrow, then 05:20:42 -!- CXI has quit (Read error: 145 (Connection timed out)). 06:25:09 i uploaded a new package fixing clobbering 06:25:30 meaning that if an expression evaluates to the name of another existing expression, it overwrites that one 06:25:37 so you can now write hello, world like this: 06:25:41 hello := "hello, world" 06:25:45 world := "hello, world" 06:26:19 this also may make it easier to write more sophisticated programs, but it's hard to say 06:55:56 -!- graue has quit ("Are you a Schweinpenis? If so, type "I am not a Schweinpenis.""). 07:59:59 -!- clog has quit (ended). 08:00:00 -!- clog has joined. 08:32:56 -!- puzzlet has joined. 08:33:36 -!- puzzlet has quit (Client Quit). 08:33:39 -!- puzzlet has joined. 10:35:16 -!- kipple has joined. 11:08:56 hm, it looks to me as if graue's language has a mechanism for converting the programas to SMETANA 11:09:14 I'm not sure though 13:16:09 -!- malaprop has joined. 13:24:46 -!- pgimeno has quit (Read error: 110 (Connection timed out)). 13:33:04 -!- pgimeno has joined. 13:38:18 -!- jix has joined. 14:21:01 -!- CXI has joined. 15:20:56 -!- graue has joined. 15:28:28 hi graue 15:28:35 hello 15:29:00 i think Sort resembles Whenever a bit 15:29:21 I was wondering if it is possible to transform a SMETANA program into a Sort program 15:29:44 the ending conditions are different 15:29:54 in Sort, if it falls off the end it just goes back to the beginning 15:30:28 yes hmm... 15:30:44 you know what'd be a neat idea? 15:31:03 no, what? 15:31:22 a program to take a list of inputs and outputs, and use some kind of state-space search over all possible programs to find a program that matches the inputs and outputs 15:31:53 yeah, that would be cool 15:32:21 you could use it to duplicate a closed-source reverb effect 15:32:26 it'd be easier in BF because of its' tiny instruction set 15:32:30 give it a PCM wave before and after the effect was applied 15:32:43 CXI: How goes the regexp esolang? 15:32:52 i wrote a program once that generated BF programs at random 15:33:00 you'd type and they would do funny things 15:33:03 it was cool 15:33:03 been busy since yesterday, unfortunately 15:33:28 i have a concern about the regexp esolang 15:33:39 What's that? 15:33:41 if it uses perl for the regexp matching, doesn't that tie the language inextricably to perl? 15:34:25 I don't think so... though I suppose there are slight regex variations between engines 15:34:44 CXI: are you familiar with genetic programming? 15:34:55 maybe if that "perl compatible" regexp library really is, it would work 15:35:05 perl's regular expressions are not anything like a standard though 15:35:15 kipple: I'm quite a fan of it, but not terribly familiar 15:35:36 because it is used for what you described 15:35:47 that's more or less how the first Hello world program was written in Malbolge 15:36:16 haha 15:36:26 malbolge is a fearsome beast 15:36:30 yes, that's right :) 15:36:43 malbolge is the name of hell 15:36:58 and so appropriately named 15:37:21 I'm trying to write a 'cat' program in it 15:37:49 but that's a tough task 15:38:20 my program is already complete if the memory can be preloaded into the virtual machine; I'm now working in the initialization 15:39:08 i.e. the code that sets up the memory to be as desired, but it will be several K's long 15:39:43 it's a bit stalled right now until I finish the changes in my homepage though 15:40:25 I'm pretty sure I won't see a quine in Malbolge 15:40:32 good lord 15:40:38 Dis is a bit more tractable 15:40:58 poor Dis never really gets talked about at all 15:41:09 yeah, I wanted to change that 15:41:38 there are just a few progs ever written in Dis 15:42:01 it *might* be possible to write a (real) 99bob in dis 15:43:14 the main advantage of Dis is that instructions stay in their place, i.e. they do not change after being executed (as opposed to Malbolge) 15:43:34 I thought that was an endearing feature, personally 15:43:42 we need an article on Dis in the esolang encyclopedia 15:43:53 i've never really looked at it, so it would be nice to have an overview 15:44:07 if you can wait about one week more I can write it 15:44:15 fair enough 15:44:16 I'd like to do 15:47:17 in "useable" Malbolge, the program flow is expressed as data (jump addresses), because instructions must be at fixed positions 15:48:06 Lou Scheffer wrote an excellent article (which hooked me into Malbolge coding) 15:48:28 graue: use oniguruma for regexps 15:48:46 tell CXI that 15:48:50 he's the one making the regexp language 15:48:52 sry 15:48:58 unless you mean for Sort 15:49:13 for anything where regexps are used 15:49:14 Sort intentionally uses its own underpowered regexp implementation 15:49:27 CXI: use oniguruma for regexps 15:49:29 :P 15:49:51 you mentioned it before, but to be honest I've already written most of it in perl now anyway 15:49:55 jix, have you checked out sort? 15:50:00 no 15:50:07 why not do so? 15:50:25 it is at http://esolangs.org/research/ 15:53:14 haha 15:53:19 I want to make a uno programming language 15:53:55 flow control: reverse, skip 15:54:07 IO: draw two/draw four 15:55:00 heh, do it then 15:57:12 uno? like in the card game? 15:57:46 yeah 15:58:03 hehe. nice idea. (long time since I've played that) 16:37:11 hey kipple, you tried out Sort yet? 16:43:04 jix: So, about FYB ... 16:43:12 I realized a problem with my old programs. 16:43:23 Many of them had something like this: :@....; 16:43:44 The problem is, when that thread does the second loop, it defects again, hence editing the enemy! 16:44:05 So, *cough*, yeah, totally fubar'd code there 8-D 17:43:20 i just noticed that a FYB war ends after the 1st or 2nd bomb.. so my idea was: every player has 10 lives 17:54:42 -!- GregorR-L has joined. 17:55:09 The reason that it ends after the first is so that threads are a blessing and a curse. 17:55:22 They're nice because you can do more, but bad because they make you more susceptible. 17:55:30 I think having more lives would skew that balance. 17:56:54 Or at least, I can't think of a "lives" system that would not skew that balance, I don't know if you have something up your sleeves ;) 18:12:36 is there a language that uses analog memory 18:18:33 Would that not be similar to simply having floating-point memory elements? 18:24:33 no 18:24:44 memory positions are floating too... 18:24:55 +point 18:25:00 Oh, I think I sort of see what you're saying. 18:33:57 Here's a great language! 18:34:04 The only command is "add to output que" 18:34:15 Any character entered is assumed to be a parameter for this command. 18:34:20 I call this language "cat" 18:35:55 heh, already been invented 18:36:02 Damn! 18:36:14 that was discussed on lang@esoteric a few years back 18:36:15 :P 18:36:20 lol 18:36:26 the main attraction of cat is that every program is a quine 18:36:36 Heheh, that's nice. 18:37:12 Hm, the defintion for "programming language" that I have in my head requires conditionals. 18:37:25 if you add a second command to read from the output queue, you can get by like that, with no formal way of storing data 18:37:36 (you do need other commands to process the data, of course) 18:37:56 Choon works that way, its only data storage is its own past output 18:38:24 malaprop: Is HQ9+ a programming language? 18:38:43 definately not! 18:38:48 w00t 18:38:58 is Sort a programming language? 18:39:27 GregorR-L: I don't know HQ9+ 18:39:41 ...or sort. 18:39:51 HQ9+ is a parody of a programming languge :) 18:39:58 malaprop: The H command outputs "Hello World!", the Q command outputs the content of the program, the 9 command outputs 99-bottles-of-beer, the + command increments the accumulator. 18:39:59 HQ9+ is a language with four commands, H = print hello world, Q = print program's source code, 9 = print lyrics to 99 bottles of beer, + = increment the accumulator 18:40:09 Hahah, I win by several seconds :-P 18:40:11 Sort is at http://esolangs.org/research/ 18:40:17 it was not a contest 18:40:24 I'm kidding ;) 18:42:14 I would not call HQ9+ a programming language, no. But I still like it. 18:42:24 Heheh 18:43:09 Hm, I'd like to see an esolang where it's impossible to write a quine in the lang. 18:43:46 Make it incapable of outputting arbitrary characters. 18:43:47 malbolge? (I dare anyone to disprove it!) 18:43:48 Only numbers. 18:44:24 i dare anyone to write a quine in Sort! 18:44:35 Hmmmmmmmmmmmmmmmmmmmmmmmmmmmmmm 18:45:31 (man, what's the deal here? Everyone was like, "Hey, graue, we're really excited about your esoteric language," but now that I have a working interpreter no one seems to care) 18:46:32 I still haven't wrapped my head around it enough to write anything useful :P 18:49:58 \22 didn't get translated into a " for me ... 18:50:27 Oh wait .. 18:50:30 Maybe I'm wrong ... 18:51:29 a := "a := \22" "a" "" ? ~ 18:51:29 quit := "" 18:51:42 Seems like that should output: 18:51:55 a := "a := " or something 18:52:00 Still working on it :P 18:52:40 Still working on it :P 18:52:47 Whoops, up-entered in the wrong window. 18:58:22 an expression can't find itself with a regex 18:58:27 it only searches all the other expression names 18:58:31 Ohhhhhhhhhhhhhh 18:58:49 I guess that makes sense, otherwise it would recurse forever :P 18:59:10 no it wouldn't, i just disabled that feature to make it esoteric :) 19:00:38 you realize, don't you, that it only searches expression names, not the expressions themselves? 19:03:37 I thought it searched the names and replaced with the expressions, but I'm realizing that that's wrong. 19:04:29 for the record, I do consider HQ9+ a programming language, just not Turing-complete 19:04:52 graue: the lack of examples makes the idea difficult to aprehend 19:05:08 to me at least 19:07:27 hm, my Spanish->English dict says "aprehender" = "seize" 19:08:36 Apprehend might be another word :P 19:09:26 -!- sp3tt has joined. 19:09:28 oops, right, sorry 19:10:10 Though seize is right too I suppose. 19:10:12 Just a strange context. 19:10:57 pgimeno, i've included all the examples i've been able to come up with 19:10:58 maybe grab would make more sense 19:11:11 it seems possible to make more sophisticated programs, but i haven't figured out how to do so yet 19:11:20 have you seen hello3.sort? it illustrates some features usefully 19:11:34 nope, I just downloaded the zip 19:12:03 get the new tar.gz from http://esolang.org/research/ 19:12:08 I'm trying to figure out how to have a decrementer ... have something like a99 := "a98", but then a98 becomes a97, etc. 19:12:10 it also fixes some bugs in the interpreter 19:12:25 well, you need at least two expressions to pull that off 19:12:40 an expression can rename only itself, but it can access only the names of others 19:13:08 graue: i care about sort.. but i need time to get an idea how to do things 19:13:14 Yeah, I figured I would need more than one, but still haven't figured out how :P 19:13:21 jix, cool 19:13:50 graue: oh, by the way, http://www.esolangs.org/wiki/ redirects to voxelperfect 19:13:57 i hate this.. every day i add a new dns server to my list and the 2nd day it's down 19:14:29 pgimeno: yeah i am aware, i'm not sure if there is a way to fix that 19:14:42 (other than making it do the reverse) 19:14:53 there's an ugly way, using index.html and a refresh with a relative path 19:15:27 the HTTP spec doesn't allow refreshes with relative paths 19:15:33 yuck 19:15:39 however, i could examine the Host: header in the request 19:15:48 i was hoping for a way to do it without editing MediaWiki :) 19:15:55 in php? 19:16:05 you'd just need an index.php 19:16:23 i already do, it's from mediawiki 19:16:37 oh, dang 19:17:37 btw, when are you going to set up the database and images backup? 19:18:43 soonly 19:18:45 is there demand now? 19:19:39 well, I'm already backing up svn and waiting to start backing up the rest 19:19:51 Perhaps I'm confused, but it seems that the regex "a(.)" works bu "a(.!)" does not ... 19:20:09 ! and @ aren't allowed within groups 19:20:15 Crapsy. 19:20:17 Hmmmmm 19:21:02 i think it'll search for a literal ! if you do that, actually 19:21:13 so there is a way to search for a literal ! or @, do [!] or [@] 19:25:31 Is it possible to write a quine in Chef? XD 19:26:04 I would think so... 19:26:09 but HARD 19:27:04 btw sp3tt, is that Chef-interpreter you made available on the web somewhere? 19:27:10 Not yet... 19:27:22 It has some regexp trouble when it comes to multiple bowl.s 19:44:17 These troubles seem to have disappeared overnight :O 19:44:29 I'll write some comments and upload it... 19:44:40 great :) 19:52:22 -!- Keymaker has joined. 19:52:25 grrhh.. 19:52:32 this channel is TOO active!!!!!! :p 19:52:53 logs are filled with interesting stuff about interesting new or old languages 19:53:03 i don't have time to read them nor think about them!!!!!!!!!!! 19:53:14 just read and think about Sort 19:53:20 the others can wait 19:53:47 is that some new or old? 19:56:37 new 19:56:43 i made it up two days ago 19:56:50 got the interpreter working yesterday 19:57:03 still have yet to figure out how to write anything more sophisticated than hello, world in it 19:57:13 ok 19:57:24 how it works? :) 19:59:14 it's a series of named expressions 19:59:29 at runtime, first the expressions are sorted lexically according to their names 19:59:50 then the expressions are evaluated in turn going down, and wrapping around when reaching the bottom 19:59:51 GAH. Two problems is named correctly. 20:00:11 the catch is that each expression renames itself to the value it evaluates to 20:00:20 what means 'lexically'? 20:00:22 the other catch is that this renaming is the only form of data storage 20:00:35 hmm sounds really tricky 20:00:36 the final catch is that an expression can only rename itself and can only examine other expressions' names 20:00:45 lexically means, it's sorted according to the results of strcmp() 20:00:57 that probably is not what "lexically" really means, i apologize 20:01:13 oh yeah, there's actually one more catch 20:01:30 (well, haven't used strcmp()..) 20:01:35 the program ends when only one expression is remaining, and prints out the name of that expression (that's its only form of output) 20:01:48 sounds really hard 20:01:50 an expression can delete itself by renaming itself to "", or can clobber another expression by renaming itself to that expression's name 20:02:15 the sorting is based on bytes being less than or greater, starting with the first byte 20:02:25 i.e., if you consider only capital letters, it's alphabetical 20:02:31 terminate := ".!" "" ? <- that terminates any program 20:02:48 not necessarily! 20:02:59 another expression could run in the meantime and rename itself to "terminate" 20:03:07 oh, right 20:03:13 uh 20:03:23 too hard language for me, probably 20:03:35 well, maybe you can try it 20:03:41 it's definitely too hard for me, its inventor 20:03:46 i can :) 20:03:53 but i can't get anything done probably 20:03:55 by the way, i fixed the problem on the wiki 20:04:08 nice 20:04:10 when you submit edits, it now redirects you using the proper hostname, so you can edit comfortably from http://esolangs.org 20:04:33 Wow! I just noticed that David Morgan-Mar, the creator of Chef, Piet, Whenever etc. is the author of the Irregular Webcomic! 20:05:06 ? 20:05:08 i had never heard about Irregular Webcomic until i read the wikipedia article about Mr. Morgan-Mar 20:05:12 what's that? 20:05:14 http://www.irregularwebcomic.net/ 20:05:14 but i guess it's cool that he did something famous 20:05:42 I've been reading that comic for a while without knowing :D 20:07:10 has sort any site` 20:07:11 ? 20:07:31 not at the moment 20:07:40 where are the example? 20:07:44 or interpreters 20:07:46 i hope to rename it once i learn more about its characteristics 20:07:52 http://esolangs.org/research/ 20:07:53 :) 20:08:00 ah 20:09:30 I was thinking of a very painful esolang... Using mathematics. 20:09:55 It is partly based on beatnik, but instead of scrabble words, mathematical functions... 20:10:09 graue: I think it may fail to be turing-complete 20:10:42 A modulo operation determines which opcode a given value represents. 20:10:45 maybe it's practically, but not formally, turing-complete 20:10:45 -!- GregorR-L has quit (Read error: 113 (No route to host)). 20:10:49 http://esolangs.org/wiki/Turing-complete 20:11:40 are you sure that something can e.g. do a finite loop before stopping? 20:11:57 no, i am not 20:11:58 So, if the opcode for "Read from STDIN" is 3, one would have to come up with a mathematical function to return 3 at that point on the X axis XD 20:12:10 however, i do not know of a reason why that is not possible, either 20:12:48 the idea about the language that uses md5 as input sounds great 20:13:11 (although then there are more than one possible inputs) 20:13:43 a language with only one possible input would be pretty boring 20:14:02 ;) 20:14:03 i mean more than one input for one md5 20:14:05 :) 20:14:16 well, if there's an stopper like terminate := ".!" "" ? then the only way to do a loop is to insert strings before reaching it 20:14:56 sp3tt: i had the same idea! 20:15:09 hmm, so why do you have to use an expression like that? 20:15:44 this language all crazy... 20:16:15 graue: in order to terminate 20:16:20 but i have also an idea for an lazy evaluating bf like list based language.. 20:16:27 you don't need clobbering, though 20:16:39 You need an opcode to change between functions though. 20:16:42 you can make every expression but one rename itself to "" if a certain condition is met 20:16:51 Imagine how representations of programs would look! 20:17:00 this should be possible between ^ and ? 20:17:07 the language is "lossy" in the sense that no new expressions can be created; all you can aspire to is swapping 20:17:09 sp3tt no your function can have an unlimited set of variables 20:17:09 I'll try to code an interpreter for something like that this weeken. 20:17:13 Weekend* 20:17:13 and you can change them 20:17:17 Naming suggestions? 20:17:27 i want to implement it... 20:17:29 pgimeno, you can make fake variables, by adding onto the ends of names of existing expression 20:17:33 s 20:18:17 the difficulty arises only because an expression cannot look at its own name 20:18:33 in any case it's a quite unamageable beast :) 20:18:33 so you have to do something like, a renames itself to a99, which makes b rename itself to b98, which makes a rename itself to a97 20:18:59 unmanageable 20:19:19 hm, i think there is a change that would make it more manageable 20:20:04 kipple: http://rename.noll8.nu/sp3tt/chef.py 20:20:05 if a regex has (a)! at one point, and it matches aaa, perhaps aaa could be captured instead of a 20:20:26 Has some bugs, no error reporting and it does not support stir. 20:20:31 that would make it possible for a single regex to look for "99", "4", and "", for instance 20:20:45 But it is version 0.0.1 after all :) 20:20:49 also, character classes would help a lot 20:21:01 Tell me what you think... 20:21:26 i don't think that makes anything possible that isn't now, though 20:21:29 it would just make it more manageable 20:24:43 thanks sp3tt. I've written a short chef article in the wiki. Should I link to it, or do you want to wait until a more complete version? 20:25:38 i'm going to call my language lazy-brain 20:25:45 sp3tt: so, stir and sous-chefs is all it is lacking now? 20:29:06 must go for a while.. 20:29:07 -!- Keymaker has quit ("Freedom!"). 20:29:47 Sous-chefs work. 20:29:56 Link me to the article. 20:30:00 noce! 20:30:12 Loops are a bit buggy though... 20:30:19 nice! I mean... 20:30:20 Two Problems XD 20:30:22 anyway: http://esolangs.org/wiki/Chef 20:30:23 :) 20:31:05 * kipple must install python now... 20:31:10 Thanks. Have to go now. Be back tomorrow. Esoteric for life! 20:31:12 -!- sp3tt has quit ("Chatzilla 0.9.68a [Firefox 1.0.4/20050511]"). 20:33:56 lazy-brain will rule 20:34:35 it's inspired by bf and haskell 20:35:54 -!- puzzlet has set topic: Another brainfuck site (http://www.bf-hacks.org/) is open! ~ http://chriscoyne.com/cfdg/ ~ Esolang Preservation project info: http://tinyurl.com/d3fk5 ~ Esolang wiki: http://esolangs.org/wiki/Main_Page. 20:38:35 I think elpp can be removed from the topic 20:41:18 -!- puzzlet has quit ("Leaving"). 20:45:08 hmm i need to change some things in my concept 20:46:32 -!- pgimeno has set topic: Another brainfuck site (http://www.bf-hacks.org/) is open! ~ http://chriscoyne.com/cfdg/ ~ Esolang wiki: http://esolangs.org/wiki/Main_Page. 20:47:27 -!- graue has set topic: Another brainfuck site (http://www.bf-hacks.org/) is open! ~ http://chriscoyne.com/cfdg/ ~ Esolang wiki: http://esolangs.org/wiki/. 20:47:31 even shorter 21:01:10 what's all this then? 21:01:17 smetana is NOT turing complete! 21:01:28 looks like i'm going to have to start editing this wiki thing :) 21:02:08 cpressey: lament proved otherwise 21:03:45 i can give you a proof that SMETANA programs are equivalent to FSA's, though. 21:03:51 it's actually pretty trivial 21:04:00 a SMETANA program has a finit # of states 21:04:04 yeah 21:05:03 but there's no size limit for a SMETANA program 21:05:35 there's no size limit for an FSA either 21:05:48 given a "big enough FSA" you can compute anything 21:05:57 that doesn't mean FSAs = Turing Machines 21:06:33 that's what "practical Turing completeness" referred to :) 21:07:04 I think it's just a problem on the choice of words 21:09:36 There is a size limit for an FSA: it must not have an infinite number of states. 21:12:18 Hm. Does the alphabet for a FSA need to be finite? Perhaps not. 21:15:08 speaking of FSAs, Malbolge may fail to be complete enough for performing complex tasks; it has a limit of 3^10 memory positions which may be insufficient even for the requisites of writing a countdown from e.g. 65535 to 0 (let alone a true 99bob) 21:15:11 ok, no "finite size limit" :) 21:15:27 yes, the alphabet has to be finite IIRC 21:15:51 pgimeno: but is that just an artefact of implementation? 21:16:26 I'm not sure if an infinite alphabet would make much of a difference. Perhaps it would. 21:16:47 well, it's a VM with 10 trits per register 21:17:02 the 10 trits is part of the language because rotations, one of the two operators that can be used, are 10 trits 21:18:53 every memory position holds a 10-trit machine word, and the instruction and data pointer and the accumulator are also a machine word long each 21:19:24 -!- Keymaker has joined. 21:19:46 the machine words might be extended to, say, 24 trits and maybe that makes it useable 21:19:53 yeah, it might be like befunge-93 then. 21:20:10 or... no, even befunge has a stack, making it a PDA 21:20:35 what does PDA stand for? 21:20:45 (assuming it's not Personal Data Assistant) 21:20:56 Pushdown Automata 21:21:08 ah thanks 21:23:27 I wrote my language Bitxtreme as a parody on Malbolge's capabilities 21:25:15 to express with some sense of humor my doubts about it being powerful enough as to perform simple tasks 21:25:47 (with a bit of irony) 21:29:37 8) 21:31:36 I'm sorry you took it seriously, Keymaker 21:32:06 :) 21:32:21 I didn't intend to trick anyone 21:32:27 ok 21:32:41 you don't need to tell everyone i'm stupid :P 21:33:05 heh, I also didn't intend to mean that :) 21:33:16 Keymaker: don't worry. It's not a secret ;) 21:33:27 hah 21:33:36 :) 21:34:11 hmmm 21:34:20 can anyone remember the name of that esoteric language that 21:34:24 has mouse support 21:34:28 and 2d graphics 21:34:31 anyway, nice to see all the updates in the wiki today. 21:34:36 like the output is to 2d screen 21:34:49 (as pixels and shapes like triangles and circles) 21:35:20 there was even pong made in it 21:37:52 that just rings a distant bell 21:38:44 if i remember any correct it started with 'o' 21:38:49 well, doesn't help much 21:40:58 no, it starts with 'g'! 21:41:02 Gammaplex! 21:41:07 http://www.student.kuleuven.ac.be/~m0216922/gammaplex/Manual.html 21:43:02 lol, the language has a big set of instructions :D 21:43:35 I'm afraid my bell was something else 21:43:59 ok 21:47:19 that one is in danger of disappearing, btw 21:47:24 the page is by one student 21:47:34 by a student, I mean 21:53:14 i don't like it 21:53:38 an overcomplicated befunge dialect 21:53:41 -!- graue has quit (Read error: 60 (Operation timed out)). 21:53:45 yeah 21:54:39 after befunge 94 and wierd and piet, it seems there's no new ground left for 2d languages :) 21:54:50 oh and the game of life of course 21:55:01 :) 21:55:10 well, better get to 3d then.. 21:55:35 I think a saw a 4d language somewhere... 21:55:42 yeah 21:55:45 -!- graue has joined. 21:55:48 you're not the only one then i guess 21:55:58 i remember seeing something like that as well 21:57:06 it was probably befunge 21:57:41 a funge you mean? 21:58:03 i thought that befunge-like languages were called funges 21:58:12 probably befunge 21:58:12 no, I don't think it was a funge 21:58:32 okay, funge. 21:58:43 :) 21:58:49 or befunge 21:59:03 quadfunge? 21:59:24 http://www.cliff.biffle.org/esoterica/4dl.html 21:59:42 yeah, that's it 21:59:51 yeah 22:00:45 later funges are bizarrely complex 22:00:59 dunno if they allowed for more than 2d but seems likely 22:01:09 :) 22:01:38 it's amazing how much work cpressey put in later funges 22:01:46 heh 22:01:47 and i doubt anybody ever actually used them :) 22:02:03 yes 22:02:03 just look at http://catseye.mine.nu:8080/projects/funge98/doc/funge98.html 22:02:18 hah 22:02:52 seems like an attempt to make it a non-esoteric language 22:03:55 Funge-98 was mostly designed by committee (isn't it obvious? :) so I can't take entire credit :) 22:04:51 it's a language family, not a single language, technically, so of course it's a royal mess. 22:05:03 :D 22:05:06 yeah, but... why?! :) 22:05:08 it kind of maxed out at Nefunge (n-dimensional) and Chronofunge (time-travelling) 22:05:19 :) 22:05:23 lament: heh 22:05:32 that is the WRONG question to ask in this community :) 22:05:37 cpressey: did people ever write any programs fon any of those? 22:05:42 how would time travelling work in language? 22:05:59 lament: they were never specified fully or implemented, so i imagine, no 22:06:02 * lament thinks of continuations 22:06:07 Keymaker: painfully 22:06:12 yeah 22:06:13 yeah, continuations kind of 22:06:15 i can see that 22:06:19 store the state of the program at every step 22:06:27 then when you travel back in time, restore it 22:06:38 so, continuations without returning anything? 22:06:42 seems horribly useful :) 22:06:59 it's the time travelling to the future that we never quite modelled :) 22:07:09 :) 22:07:52 hmm 22:07:55 shouldn't be too hard! 22:08:29 well, probably not unless the language has input 22:08:38 while (year < 2100); 22:09:10 well, any instruction implicitly travels to the future 22:09:22 at an alarmingly fast rate of one second per second 22:09:31 hehe 22:10:08 ok. how about letting the interpreter optimize it by altering the system clock instead? ;) 22:10:13 hey! i got an idea: program language that has one bit as it's memory, but it can be accessed at different times 22:10:42 hmmmmm 22:10:45 neat! (as long as you can move back and forward in time) 22:10:52 and since future is uncertain, the future bit, along with all the ones before it would be randomized 22:10:58 so the future couldn't be predicted 22:11:14 hmm 22:11:24 in Choon you can access the past 22:11:49 it has one 'register' and you can access its value at any past point 22:12:17 so, does this mean somebody used time travelling and stole my idea? 22:12:32 no 22:12:38 as you said, time travelling to the future isn't possible 22:12:38 ah good :) 22:12:43 well, it wasn't a one-bit register, and choon had other things as well 22:12:54 yeah, so i think i can still use it 22:12:56 good 22:12:58 hahaha 22:13:47 besides nobody knows about choon 22:13:56 yeah 22:13:57 it's on the wiki, everyone will know soon 22:13:59 and it wasn't the key feature of choon 22:14:05 oh, so that's how wiki works 22:14:35 but seriously, since i hadn't idea about that and it isn't totally same idea, so i can't see a problem if i use this idea 22:14:46 indeed, there is no problem whatsoever 22:14:46 as well, many esolangs share same features 22:14:58 but this will be probably much different than any choon 22:15:08 now i'll try to think with brain 22:15:30 the key feature of choon is sound output 22:15:34 nobody cares about its other features 22:16:30 ok.. lazy-brain specs are complete (in my head) 22:17:04 lazy brain??? 22:17:09 now write them down before you forget 22:17:11 how what 22:17:36 lazy-brain is brainfuck with functions,lists and lazy evaluation 22:17:52 how!?? 22:18:30 well, one could code those extras with normal brainfuck :p 22:19:05 you could code a c compiler in smallfuck+io extension 22:19:24 yes 22:19:30 that would be neat indeed 22:19:32 :) 22:19:41 and notice i was only joking, 22:19:43 that would be grotesque 22:19:49 i'm waiting to see your work now 22:19:52 sounds fun 22:19:56 it would be neat to write anything in smallfuck 22:19:59 (without cheating) 22:20:07 cheating? 22:20:13 compiling brainfuck code to smallfuck 22:20:16 yeah 22:20:18 no 22:20:21 that's not allowed! 22:20:53 i'll write something it when i have time 22:21:50 jix: so what about this lazybrain thing! 22:22:07 lament: wait.. i post an example 22:22:16 cool 22:22:24 it doesn't shows all features.. just lists and functions 22:23:15 ok 22:24:54 Today I'm going to release a new version of FYB with a better spec (Thanks jix for telling me what things needed to be added) and more verbose output when verbose is enabled. 22:25:16 http://rafb.net/paste/results/cY9zp019.html 22:25:31 should print ABCDEFGHIJKLMNOPQRSTUVWXYZ 22:27:05 wait no.. updated specs in my head 22:27:07 well, I'm going to sleep, so you guys don't flood up the log while I'm away, ok? ;) 22:27:13 ateoh 22:27:13 aoeu 22:27:13 ho 22:27:14 qrcjkgx 22:27:15 jqkrcgx 22:27:17 .ptnhoe 22:27:20 gcfaoeu 22:27:22 heheh 22:27:22 qfxkglcf 22:27:23 lament: while he's away! 22:27:30 oh, oops 22:27:34 ;) 22:27:43 i'm too impatient :( 22:27:48 g'nite all 22:28:07 gn8 22:29:02 g'nite 22:29:07 bye 22:29:08 nite 22:30:17 http://rafb.net/paste/results/pzwMJM37.html 22:32:08 its: upto a b = (a:if a==b EMPTY else upto a+1 b) 22:50:56 hmm i need to rethink some things for lazy brain 22:51:04 g'nite 22:51:08 ok 22:52:04 -!- jix has quit ("Banned from network"). 22:52:53 hmmm 22:53:24 i think i'll watch some movie 22:53:36 'nite 22:53:42 -!- Keymaker has quit ("Freedom!"). 2005-06-03: 02:04:37 -!- graue_ has joined. 02:06:27 GregorR: is FukYourBrane really a programming language, rather than a game? 02:07:03 it's definitely of interest to the Esoteric World, but i'm thinking maybe it shouldn't go on the language list in the wiki 02:13:10 -!- kipple has quit (Read error: 60 (Operation timed out)). 03:40:08 the wiki doesn't have any programming languages whose names start with X 03:40:15 someone make up a language with a name that starts with an X 04:12:19 heh 04:20:42 graue_: I guess the question is, is RedCode a programming language? 04:22:16 -!- malaprop has quit ("sleep"). 04:31:51 RedCode may be but CoreWars isn't 04:33:35 FYB/FukYorBrane is associated with your game, not with the language, and you use the page to describe the game, not the language 04:33:43 hence, i'd call it a game, and not a language 04:33:59 -!- graue has left (?). 04:34:04 -!- graue_ has changed nick to graue. 04:34:48 I see. So where should I link to it? I'd rather not have it just be a hanging page ... 04:35:10 add it to [[Category:Brainfuck derivatives]] 04:35:50 perhaps link it from Brainfuck as a "more interesting variant", too 04:37:15 * GregorR is unsure how to get to the Category: Brainfuck derivatives page ... 04:39:11 add "[[Category:Brainfuck derivatives]]" at the end of the FYB article 04:39:47 Aha 04:39:48 There 'tis. 05:35:31 -!- graue has quit ("Leaving"). 06:28:07 -!- GregorR-L has joined. 06:30:09 FYB A0.6 released 06:30:23 Cool new verbose system implemented. 06:30:36 Produces megs of output for a run, but is very helpful. 07:45:02 -!- graue has joined. 07:45:26 i uploaded a wiki sql backup to http://www.oceanbase.org/graue/junk/sqlbackup.zip 07:45:34 so pgimeno, you can download that and stop worrying 07:45:46 it doesn't have the images, but there was only one image anyway, and it sucked, so no great loss 07:45:48 -!- graue has left (?). 07:59:59 -!- clog has quit (ended). 08:00:00 -!- clog has joined. 09:17:01 -!- sp3tt has joined. 09:19:17 -!- GregorR-L has quit (Read error: 110 (Connection timed out)). 09:20:59 -!- sp3tt has quit (Client Quit). 10:08:04 -!- kipple has joined. 12:22:39 -!- sp3tt has joined. 12:33:04 -!- sp3tt has quit (Read error: 104 (Connection reset by peer)). 12:37:51 -!- malaprop has joined. 13:37:17 -!- jix has joined. 13:40:24 moin 14:07:40 Hoi 14:11:07 hi 14:12:36 Gregor: are the periods at the end of each line optional in ORK? 14:12:42 Yes 14:12:47 ok. 14:13:01 It ignores the punctuation, but it's good for clarity *shrugs* 14:13:20 I'm writing a polyglot, so it's nice to know these things :) 14:13:29 *whew* 14:13:34 Good luck with that *head explodes* 14:13:57 so far I have brainfuck, befunge and ORK and it was rather trivial 14:14:57 I can put the befunge and brainfuck code straight into the file, and ORK just ignores it! 14:15:03 I guess since you would only need to formally comment in ORK, it ought not be too hard *shrugs* 14:15:11 Oh, right X-D 14:15:27 I didn't make an } else { printf("THIS BAD CODE!!!"); } 14:15:33 what do you mean with "formally comment"? 14:15:46 Well, by the spec you have to use a # to comment. 14:15:53 But really you don't ;) 14:16:03 hehe. same with kipple :) 14:16:22 cipple support both types of comments 14:16:51 what is the other type? (not #) 14:17:39 10>o This is ignored because here is no command "Hello">o 14:17:58 ah, yes. same here 14:18:21 i tried to get as close to your interpreter as possible 14:18:43 -!- sp3tt has joined. 14:35:01 -!- J|x has joined. 14:38:28 Yay! I've got the polyglot working with befunge, brainfuck, kipple and ORK :) 14:44:52 -!- jix has quit (Read error: 110 (Connection timed out)). 14:44:59 -!- J|x has changed nick to jix. 14:46:05 What does it do? 14:46:14 just Hello world... 14:46:19 rather boring 14:46:39 but I intend to add several more languages 14:50:52 Polyglot? 14:51:28 program that is valid in more than one language 14:51:33 Ah. 14:51:41 Link/Example? 14:51:55 http://en.wikipedia.org/wiki/Polyglot_(computing) 14:58:50 And your code? 14:59:27 still a work in progress... 15:00:49 -!- jix has changed nick to jix|essen. 15:01:30 From the eight language polyglot page: "25 Jan 2001Richard StallmanThe proper name is GNU/Polyglot, damn you!" 15:02:17 added chef 15:02:50 :O 15:03:13 I am working on a language with some basic self modification... 15:04:30 bbl 15:32:45 -!- jix|essen has changed nick to jix. 15:37:53 -!- Keymaker has joined. 15:38:08 hey! i wanna write a polyglot too! 15:38:17 * Keymaker starts writing 15:38:54 Keymaker: Just write 'print "hello world";' and you've got python, perl, and PHP done. : 15:39:57 :) 15:40:34 Now if you really want to have fun, write a polygot quine. 15:40:56 hmm 15:41:00 that sounds really interesting 15:41:14 malaprop: ruby too 15:41:18 i'll try! 15:41:25 bbl 15:41:28 -!- Keymaker has quit ("Freedom!"). 15:41:45 jix: Damn am I good. 15:45:35 but for php you need 15:47:02 one of my polyglots: http://rafb.net/paste/results/d6Bq0K77.html 15:47:12 4 languages 16:17:17 http://rename.noll8.nu/sp3tt/mathspec.txt Comments? 16:20:21 are you going to use the 8 bf commands ? 16:27:59 RMS doesn't get the respect he deserves. 16:28:49 Did RMS create an esolang that doesn't have a wiki page? 16:28:55 XD 16:29:01 Yeah, it's called "emacs" 16:29:14 I guess it's not a language, but it's pretty damn esoteric. 16:29:35 I was just referring to the quip about "GNU/Polyglot" 16:30:11 I'll stop calling "Linux" GNU/Linux the day I decide to release a program I care about under a weak license like BSD instead of GPL. 16:30:29 (Not that those are directly related) 16:32:53 sp3tt: do you have some code examples? 16:33:07 Sure. 16:33:24 http://rename.noll8.nu/sp3tt/hw.math 16:34:26 Basically uses a stack to print Hello world, when it can be done without one. Also demonstrates how to use userdefined vars in functions. 16:59:05 -!- Keymaker has joined. 16:59:18 this'll be fun. 16:59:25 -!- Keymaker has left (?). 17:02:25 http://rafb.net/paste/results/MmZgkY86.html 17:02:58 my 5 lang poly that prints: Just another hacker,\n 17:03:33 :O I am surprised it is even possible. 17:04:34 in c i'm using #define:s and /**/ to comment the other code out 17:04:49 in bf i jump ([-][ code ]) over the code containing ,s 17:05:03 in ruby i end the code with __END__ 17:05:11 (with is defined as c macro ;) ) 17:05:15 which 17:06:02 line 13,14 is a comment for bash to line 21 and for perl to 24 17:06:20 line 23 is a comment for bash to line 26 17:06:33 now i'm going to add whitespace ;) 17:09:46 nah 17:09:51 i'm not going to do that 17:11:41 kipple 17:22:06 er 17:22:13 [-][code] isn't really safe 17:22:46 oh, wait 17:22:53 you were talking about something specific, not in general 17:22:54 * CXI shuts up 17:26:29 Kipple is included 17:26:38 6 langs.. i rule ;) 17:27:36 uh.. it's working with Cipple but not with the java interpreter 17:28:14 Cipple is very syntax tolerant =<<- is ignored because neither the first nor the second < have valid arguments 17:45:35 3 != 3 according to python... 17:50:01 3 != 3 #=> False 17:51:05 sp3tt: that evaluates to False for me 17:52:03 Exactly. 17:52:20 Which is correct. 17:54:32 Not according to python if you don't use int() correctly first <.< 17:55:22 How is (3!=3)==False wrong? 17:56:30 enough polygloting for today.. 17:56:41 time to write down lazybrain specs 17:58:28 -!- OliBir has joined. 17:59:13 moin OliBir 18:01:46 HI 18:03:02 -!- OliBir has left (?). 18:03:16 0o 18:05:47 -!- NotGregorR has joined. 18:05:54 ... 18:05:57 HI 18:06:00 -!- NotGregorR has left (?). 18:10:42 0o... 19:21:34 anybody familiar with C-INTERCAL here? Chris? 19:21:54 I get an error when trying to compile the included examples 19:21:57 ICL999I NO SKELETON IN MY CLOSET, WOE IS ME! 19:21:57 ON THE WAY TO 1 19:21:57 CORRECT SOURCE AND RESUBNIT 19:38:11 -!- jix has quit ("Banned from network"). 20:12:17 kipple: I don't know about C-INTERCAL but that error sounds as if it depends on a file from the distribution that can't be found 20:18:34 it does? 20:19:02 it's the same error that comes if I try to compile a file which doesn't exist. 20:19:37 the "no skeleton" part suggest it but you never know 20:50:17 -!- sp3tt has quit ("Chatzilla 0.9.68a [Firefox 1.0.4/20050511]"). 21:41:38 -!- Keymaker has joined. 21:48:41 -!- jix has joined. 21:49:11 * jix is back 21:51:58 :) 21:52:10 i'm gonna be few days away starting from tomorrow 21:52:39 a 140km bike trip (and the other 140km back) 21:52:45 totally 280 km 21:53:00 the longest trip i have ever done is ~10km 21:53:07 :} 22:05:42 c is annoying! 22:05:53 it took me about 20 mins to realize a logical error.. 22:07:05 -!- graue has joined. 22:07:52 yeah, C is pretty damn annoying 22:15:04 true 22:15:10 but it's fast 22:16:34 yes 22:17:29 * GregorR hugs DirectNet, OBLISK, orkc, 2lc, and FYB. 22:17:33 I love you, C. 22:17:38 NOOOOOOOOOOOOOOOOOOOO 22:17:41 You're such a wonderful language. What power, what grace. 22:17:52 * Keymaker dies 22:17:56 (again) 22:18:15 * GregorR does some pointer manipulation. 22:18:35 C is easy to learn because it does exactly what you tell it, but like, if you make large projects with it, it sort of becomes an impossible mess 22:19:34 doesn't it? right? 22:19:49 it's all about design. 22:19:56 Any language can become an impossible mess. 22:20:04 Mozilla is an impossible mess because of bad design. 22:20:14 But yes, C doesn't HELP any ;) 22:20:32 :) 22:21:49 we need an INTERCAL article at the wiki 22:21:52 anyone feel like writing one? 22:22:02 no 22:22:05 can't do that 22:22:10 never even tried the language 22:27:21 INTERCAL is one of those classic esoteric programming languages everyone praises and nobody programs in, i guess 22:32:13 someone said recently in the GMP mailing list: 'C' gives you enough rope to hang yourself, and will even do the favor of throwing one end of the rope over the tree for you ... 22:32:29 heh 22:32:59 i made a lame stub for INTERCAL just to have something there 22:33:21 by the way, pgimeno, did you see the SQL backup i made available? 22:33:35 yes, it's here, thanks! :) 22:34:03 but I suspect I'm not the only one who wants to make backups 22:34:21 Most people look at that rope, and go "hey, that's handy!" then kill themselves. 22:34:43 The trick is to use the rope to devise a pully system, and then exert less effort to get your task done. 22:34:57 Also, stretch all metaphores far beyond any real meaning. 22:36:41 I just read partially the spec of INTERCAL, a few years ago 22:36:51 it's really funny :) 22:37:19 some day I want to read it fully 22:37:28 wasn't INTERCAL designed to be uninterpretable/compilable? 22:37:45 it was designed just to be different 22:38:10 there are interpreters and compilers, or that's what I thought 22:38:14 i have my spec writing setup complete... i can start writing specs fast now! 22:38:51 pgimeno: yes but afaik they tried to make it as hard as possible to code them 22:39:04 Now that's a good diea. 22:39:07 *idea 22:39:15 maybe, not sure 22:39:16 An esoteric language that is neither compilable nor interpretable. 22:39:20 I was going to try out INTERCAL today, but I can't even manage to compile the example programs :( 22:39:44 How about a language that acts differently depending on the author's eye color. 22:39:58 Since the computer can't know that, it can neither compile nor interpret it. 22:40:06 Though I guess it could be an input. 22:40:10 you would need a web cam 22:40:40 How about a language that acts differently depending on the author's thoughts 22:40:47 ;) 22:40:50 :D 22:41:11 and uses author's brain cells as memory 22:41:13 if the author is thinking "Sex" then it prints "Hello, world!" 22:41:18 :) 22:41:32 and if it is think "beer" then... 22:41:42 thinking! 22:41:45 that's easy in basic: 10 PRINT "Hello, World!" 20 GOTO 10 22:41:46 99 booootleeeees oof beeer on thee waaaal 22:42:57 some day I'll submit my Choon program 22:43:12 too bad the wav converter crashes 22:47:44 This sounds like the work of David R. Hawkins. 23:31:21 kipple: I've reproduced the problem; when I do an strace I get this: open("/usr/local/share/intercal-0.24/ick-wrap.c", O_RDONLY) = -1 ENOENT (No such file or directory) 23:34:44 there's an intercal package available for Debian, apparently (is it the first esoteric language to be in a Linux distribution?) 23:35:14 there is? 23:35:24 that's nice :) 23:35:32 two, actually; one in perl and the other seems to be c-intercal 23:35:43 -!- mathkid has joined. 23:35:44 my current specs (just lang design no syntax yet): http://www.harderweb.de/jix/langs/lazybrain/specs.rc.txt (redcloth text file) http://www.harderweb.de/jix/langs/lazybrain/specs.html the generated html 23:36:00 bbl 23:37:59 pgimeno: I'm pretty sure it's not the first, they've got Java. 23:44:59 updated my .txt => html script to output strict xhtml (the automatic content list generation is done by me... txt => html is redcloth and html cleanup is tidy) 23:47:32 -!- graue has quit (Read error: 110 (Connection timed out)). 23:49:41 i've done an important part of my specs and no one cares .. ;) 23:50:07 be patient ;) 23:53:49 For a basic idea of "be patient," consider that it was several weeks between my writing FYB and your picking it up ;) 23:54:28 GregorR: but it was 5min between i knew about FYB and my first test program ;) 23:55:42 Touchet ;) 23:55:46 With spelling 8-D 23:56:04 However, we cannot yet write programs in lazybrain. 23:56:33 hehe.. yes. but i just want some respond to my ideas.. 23:56:36 With spelling? 23:59:22 Yay! the debian intercal package works! 2005-06-04: 00:01:01 there is no dp intercal package 00:01:01 * kipple is reading the lazybrain spec 00:01:38 dp? 00:01:46 darwin ports 00:01:55 ah 00:02:09 automatic downloading+(patching if needed)+compilation of source code 00:02:33 there is apt-get for osx (fink) too.. but the packages are always out of date 00:03:41 jix: are the function's tapes local or global? 00:03:51 local 00:03:55 semi local 00:04:16 they are used for passing arguments.. but they aren't used for returning values 00:05:08 so, whatever the function does, it does not alter the main tape? (except for the return values) 00:05:17 yes 00:05:33 ok. the spec should be a bit clearer about that methinks 00:05:39 hmm.. 00:06:14 or perhaps not... on second reading it is quite clear :) 00:07:05 -!- graue has joined. 00:08:16 changed it a bit so that it is clear on the first reading 00:08:22 debian has the libacme-brainfck-perl package, which seems to implement brainfuck (it allows it to be mixed with perl code according to the package description) 00:09:04 -!- mathkid has left (?). 00:09:09 also, a whitespace interpreter, whitespace, is there 00:13:19 lazy brain confuses me too much 00:16:11 -!- graue has quit ("Leaving"). 00:19:11 -!- graue has joined. 00:27:10 graue: why? 00:30:07 22 commands... 00:31:28 23 00:41:06 hm 00:41:13 must go 00:41:26 see you on 7th or 8th. :) 00:41:36 nite 00:41:40 -!- Keymaker has left (?). 00:57:01 I've abandoned xhtml in favour of html4 since these M$ patents 00:57:45 -!- graue has quit (Read error: 110 (Connection timed out)). 01:01:00 Sorry! The wiki is experiencing some technical difficulties, and cannot contact the database server. 01:01:00 Can't connect to local MySQL server through socket '/tmp/mysql.sock' (61) 01:02:06 which wiki? the esolang wiki works fine... 01:02:14 it was down for about 20 secs 01:13:24 -!- jix has quit ("Banned from network"). 01:14:56 -!- graue has joined. 01:35:05 -!- wooby has joined. 01:35:55 ahoyo 02:00:20 -!- kipple has quit ("See you later"). 02:10:19 -!- graue has quit ("Lost terminal"). 02:53:02 -!- comet_11 has joined. 03:16:09 -!- CXI has quit (Connection timed out). 03:26:21 This stupid commercial says that they can give you any hair color, "within the physical limitations of electromagnetic waves." 03:26:25 I want ultraviolet hair. 03:26:30 WHERE'S MY ULTRAVIOLET HAIR?! 03:52:30 i'm sure it could be managed with the right chemicals 03:52:43 invisible wavelength hair is an interesting concept, lol 04:17:08 -!- GregorR-L has joined. 04:17:12 Gamma hair 8-D 04:17:20 "My hair gives me cancer" 04:33:04 lol 04:33:43 your hair could also give other people cancer 04:36:15 But would I care? No! I'd be too brain-cancery to care. 04:39:07 yeah if i had elite radioactive hair i probably wouldn't care either 04:41:36 :P 04:42:15 How about radio waves? 04:42:30 When your hair flowed around, different static would be sent over the radio. 04:59:17 it would be kind of cool to walk into a room and the TV goes bonkers 04:59:39 "hey sonny, you dig my ku-band hair?" 05:00:03 XD 05:00:49 so i desperately want to come up with my own esolang, but i'm idea-less 05:02:09 If I came up with an idea and gave it to you, it wouldn't be your idea. 05:02:13 So good luck ;) 05:05:45 yeah i know! that's the kicker 05:14:55 If I knew anything about the communication between proteins, it would be awesome to make a programming language based on genetic code :) 05:16:15 "Communication" is a stretch. 05:17:02 haha 05:17:47 well a hack would be to implement smallfuck, using g,t,c,a as the operators 05:18:08 programs would look cool, anyways 05:18:21 GATTACA 05:18:46 Not authentic enough for me *shrugs* 05:19:03 yeah me neither :\ 05:24:22 well, i'm calling it a night 05:24:37 have to polish off some takeout and watch some law and orders 05:25:08 g'night 05:26:24 Buhbye 06:04:04 OK, now I know how to build peptide chains ... 06:05:14 I'm still not sure how to turn that into programming :-P 06:05:30 haha 06:50:27 The function of the peptide sequences is deterministic but mind-numbingly complex. 06:54:54 -!- comet_11 has quit (brown.freenode.net irc.freenode.net). 06:54:54 -!- pgimeno has quit (brown.freenode.net irc.freenode.net). 06:54:54 -!- cpressey has quit (brown.freenode.net irc.freenode.net). 06:54:56 -!- wooby has quit (brown.freenode.net irc.freenode.net). 06:54:58 -!- lindi- has quit (brown.freenode.net irc.freenode.net). 06:54:58 -!- fizzie has quit (brown.freenode.net irc.freenode.net). 06:54:59 -!- ChanServ has quit (brown.freenode.net irc.freenode.net). 06:54:59 -!- GregorR-L has quit (brown.freenode.net irc.freenode.net). 06:55:14 -!- malaprop has quit (brown.freenode.net irc.freenode.net). 06:55:14 -!- cmeme has quit (brown.freenode.net irc.freenode.net). 06:55:14 -!- mtve has quit (brown.freenode.net irc.freenode.net). 06:55:14 -!- ZeroOne has quit (brown.freenode.net irc.freenode.net). 06:57:00 -!- ChanServ has joined. 06:57:00 -!- GregorR-L has joined. 06:57:00 -!- comet_11 has joined. 06:57:00 -!- wooby has joined. 06:57:00 -!- malaprop has joined. 06:57:00 -!- pgimeno has joined. 06:57:00 -!- cpressey has joined. 06:57:00 -!- lindi- has joined. 06:57:00 -!- fizzie has joined. 06:57:00 -!- ZeroOne has joined. 06:57:00 -!- cmeme has joined. 06:57:00 -!- mtve has joined. 06:57:00 -!- irc.freenode.net has set channel mode: +o ChanServ. 06:57:26 Well, I made a PHP genetic code -> peptide parser 06:57:26 -!- comet_11 has changed nick to CXI. 07:23:34 -!- Keymaker has joined. 07:23:39 hi 07:23:47 i just to came say "bye for a while" 07:23:52 Bye for a while! 07:24:05 see you all on 7th 07:24:12 keep up to good work 07:24:15 bye 07:24:17 -!- Keymaker has quit (Client Quit). 07:43:09 -!- graue has joined. 07:43:55 news flash: sort language gets name, nice website, faux-academic paper! details @ http://www.oceanbase.org/graue/sortle/ 07:44:59 w00t 07:45:24 cool name 07:46:11 Sortle 07:46:12 From Esolang 07:46:12 (There is currently no text in this page) 07:46:12 awesome :D 07:46:45 heh, well, go ahead and make it then 07:47:13 I would if I knew anything about it 07:47:32 oh 07:47:56 i vaguely remember a programming language called GCAT that pretended to be genetic code 07:52:23 you know 07:52:33 a vaguely remember hearing something about a sorting language 07:52:47 s/^a/i 07:53:02 not sure if i'm hallucinating or not 07:53:49 there's the language Sorted!, but it doesn't seem very similar to sortle 07:54:16 Bubble? there's also Jeffry Johnston's Bubble, based on bubble sort 07:54:55 i hadn't gotten around to reading this yet, but it's described at http://lilly.csoft.net/~jeffryj/compilers/bubble/bubble.txt 07:58:13 yeah 07:58:14 that 07:59:35 is it fun? it doesn't seem to have been implemented 07:59:59 -!- clog has quit (ended). 08:00:00 -!- clog has joined. 08:00:02 i have no idea 08:02:42 why are ^ and $ separate operators? 08:04:09 because i didn't realize they were exactly equivalent when i wrote the spec :) 08:04:35 i decided to maintain both of them just to see if anyone would notice 08:04:41 their implementation is the exact same 08:05:26 i noticed, can you remove one now? :) 08:06:32 maybe in commercial implementations, the difference will be that the ^ operator is licensed for noncommercial use only, and you have to pay extra to get the $ operator 08:06:39 but seriously 08:06:57 i'll replace the $ operator with something better when i have an idea for another string operator that will be useful 08:09:53 maybe the opposite of ^? "" if either string is empty? 08:12:13 OK, I need brainstorming help. 08:12:32 After I've produced peptide sequences, how should they be parsed into functional entities? 08:15:51 * GregorR-L peruses the human genome. 08:16:09 i'm blissfully ignorant as to what a peptide sequence represents in the first place 08:17:03 Amino acids are combined into peptide sequences, which in turn fold into proteins, which are the most prominant physical building blocks of life. 08:18:54 is this programming language supposed to be realistic? 08:19:05 what does a peptide sequence look like? GCAT and such? 08:19:48 Gregor: well you just have to work out how they fold into proteins, and then use the proteins as functional entities :P 08:20:00 CXI: Wow, that's easy 8-D 08:20:05 yeah eh? :D 08:20:14 graue: Chemically speaking, they're usually written something like this: SKPRVYASQDVR 08:20:28 That's some peptide sequence in neurons. 08:27:17 well, heck if i know 08:27:24 you're the peptide expert 08:27:54 No I'm not X-D 08:35:57 UGUCAUGUCGACGCGAGACGCGCCGUCGCACGCUUCGACUACUACUAUGCGUUCGAACUCCACCACUAA 08:35:57 CHVDARRAVARADYYYAAELHH 08:35:57 UCACGCGUUCGAGCAUCGACUACGCGUGUCGAUCGACACGUCGCAUCGAACCGCAUGAUCGAUCGAUGA 08:35:57 SRVRASTTRVDRHVASNRMIDR 08:35:57 CUCGAUCACAGUCACCGCGUCUAUUCGACCGUUCGAACGACACUCCUAUCGACGUCACCUCUCUACUAUGCUGUGCCUCGUAGCUGUACGUAG 08:35:58 LDHSHRVYSTVRTTLLSTSPLYYAVPRSCT 08:36:02 ^ A melanin concentrating hormone 08:42:11 what's the relationship between GCAT and GCAU, again? 08:42:24 is it A <-> T/U, G <-> C? 08:48:18 T -> U 08:48:25 In DNA, it's T, in RNA it's U. 08:48:47 Oh, I just answered the wrong question, didn't I? 08:49:10 a-g and c-t/u I think 08:49:39 N/M 08:49:43 It's a-t/u, g-c 09:23:53 -!- GregorR-L has quit ("Leaving"). 09:24:35 There's http://www.wisdom.weizmann.ac.il/~udi/DNA5/scripps_short/sld019.htm and the slides after that. 09:25:21 Not-really-related-but-still. 09:58:11 -!- sp3tt has joined. 10:05:01 hello sp3tt 10:13:29 -!- sp3tt has quit (Read error: 145 (Connection timed out)). 10:33:29 moin 10:39:09 good moining, pgimeno 10:40:40 -!- GregorR has quit (Read error: 110 (Connection timed out)). 10:45:41 (np: Scrap Heap - Hiccup Jam) 11:04:40 -!- puzzlet has joined. 11:12:58 hi puzzlet 11:17:59 -!- sp3tt has joined. 11:20:29 hi graue 11:26:47 i wish C had ||= and &&= operators 11:27:53 isn't |= !! enough? 11:28:10 graue: maybe += and *= will do it 11:28:37 |= !! works, i guess 11:28:53 what's "!!"? 11:28:58 not not 11:29:02 turns a value into 0 or 1 11:29:03 ah 11:29:26 the lhs should be already 0 or 1 for that to work 11:29:50 what was i thinking, !! works for tribit or something? 11:30:20 how are troolean operations defined? 11:30:36 (if George Boole saw me write that...) 11:30:51 -!- jix has joined. 11:30:55 there is crazy operators for tribits in [[Malbolge]] 11:31:00 operator* 11:31:01 -!- GregorR has joined. 11:31:17 moin 11:31:27 moin jix, GregorR 11:31:31 joheun achim 11:31:38 troolean algebra? 11:31:49 yeah 11:32:01 how does that go? true, false, or maybe? 11:32:09 maybe ;) 11:32:35 I have a strong preference towards balanced trinary though 11:32:54 how about analog boolean algebra; instead of false or true everything is a float from 0.0 to 1.0 11:33:12 that sounds like fuzzy logic 11:33:23 thats what i thought too 11:34:04 how about, like GTTCAAATGGTA? 11:35:07 i swear i remember a "GCAT programming language" from somewhere 11:37:18 i've seen an article about making a processor out of DNA's and RNA's 11:40:01 maybe making retro-virii out of those biocomputers to infect human world will become possible ;) 12:04:33 -!- kipple has joined. 12:10:37 moin kipple 12:10:42 hi 12:22:00 uhrg... some logic mistakes in my Lazy Brain design 12:25:35 -!- J|x has joined. 12:26:01 -!- jix has quit (Nick collision from services.). 12:26:09 -!- J|x has changed nick to jix. 12:30:15 -!- GregorR has quit (Read error: 60 (Operation timed out)). 12:32:27 -!- GregorR has joined. 12:37:16 ok.. that should work now 12:41:17 graue: I've read the Sortle spec. it's not clear to me how to push values onto the stack. 12:41:50 there are a list of operators that work on the stack, but I can't find how to acutally get any data on the stack in the first place... 12:42:00 "Befunge and BrainF*ck are both toy languages written expressly to be perverse in some way (Befunge to be uncompilable, and BrainF*ck to be absurdly minimalist.)" 12:43:03 says who? 12:57:31 Some slashdotter. 12:57:42 http://slashdot.org/comments.pl?sid=32469&cid=3504293 13:01:23 -!- sp3tt_ has joined. 13:02:52 bah. he got a slashdot entry for a polyglot with just 4 languages?? 13:09:55 -!- sp3tt has quit (Read error: 60 (Operation timed out)). 13:10:01 kipple, literal numbers or strings push themselves onto the stack 13:10:10 he sees uncompilability as absurdness? 13:11:27 every language is compilable though 13:11:38 ok. so will the expression "12" push 12 or 1 and 2 onto the stack? 13:11:41 12 13:12:28 ok. so how do you separate numbers? space? comma? semicolon? (is this missing from the spec, or am I blind?) 13:13:01 terms are separated by spaces 13:13:42 ok. you might want to make the spec a little clearer on this... 13:14:48 where is the spec? 13:16:26 -!- smart has joined. 13:16:53 http://www.oceanbase.org/graue/sortle/sortle.pdf 13:17:28 the format used is spelled out in "Source Code Format" 13:21:45 ah, yes. there it is. 13:25:12 -!- smart has quit (Read error: 104 (Connection reset by peer)). 13:33:29 -!- GregorR has quit (Read error: 104 (Connection reset by peer)). 13:37:33 -!- sexy has joined. 13:38:04 -!- sexy has quit (Read error: 104 (Connection reset by peer)). 13:39:01 i have a 5lang polyglot 13:39:45 me too 13:40:05 -!- GregorR has joined. 13:40:09 but I intend to add more 13:43:36 what languages has your poly? 13:43:55 BF, befunge, kipple, Ork and chef 13:43:59 and yours? 13:44:07 bash perl ruby c and BF 13:44:32 no malbolge? 13:44:41 >:) 13:44:44 i have also a version with kipple but it doesn't work with the online interpreter (with cipple it does) 13:44:56 what's the problem? 13:45:18 does the java interpreter ignore << ? 13:45:27 probably not 13:45:38 cipple does because in $E=<<#&>/dev/null there is no valid command 13:45:54 and i use heredocs to seperate ruby,perl and bash code 13:46:09 i assume my interpreter will give an invalid stack identifier error or something 13:48:57 hmm. here's a thought: If I allow < to be used as a stack name, then this expression could be used: a< cipple ignores everything that isn't valid code 13:50:21 yeah. well the spec doesn't say anything about that, so that's ok 13:51:41 hmm. I think I will allow ANY character as a stack name in the next version, except numbers, whitespace and # 13:51:47 i like the a< then a<+++>b would be valid code (brainfuck/kipple polyglot would be very nice) 14:07:24 + is a number? 14:07:31 no 14:07:33 no a stack 14:07:43 oh 14:07:47 and a command 14:07:49 it's either a stack or an operator 14:16:36 a friend of my brother is a friend of the false inventor 14:17:53 cool 14:19:26 hmm. should I keep stack names case insensitive, or change to case sensitive? 14:20:51 oh, man 14:20:58 I just realised a much easier way to write my regex language 14:21:29 I can do away with function names entirely 14:21:45 and just make it repeatedly reapply the regexes 14:22:46 kipple: i have no opinion on that at the moment 14:23:04 not a big deal, but it might break some old programs 14:24:10 sure, do it 14:25:57 yeah. screw backwards compatability :) 14:26:59 -!- sp3tt__ has joined. 14:27:02 -!- sp3tt__ has changed nick to sp3tt. 14:27:20 real men don't need backwards compatibility 14:31:56 -!- graue_ has joined. 14:40:09 -!- graue has quit (Read error: 145 (Connection timed out)). 14:41:51 http://slashdot.org/comments.pl?sid=32469&cid=3505272 rofl 14:44:45 -!- sp3tt_ has quit (Read error: 110 (Connection timed out)). 15:01:31 -!- graue_ has quit (Read error: 110 (Connection timed out)). 15:02:25 chef is awesome 15:06:06 -!- graue_ has joined. 15:25:27 -!- graue_ has changed nick to graue. 16:00:56 hmm 16:01:01 * CXI tries to figure out 99 bottles 16:01:22 which 99 bottles? 16:01:52 in Two Problems :P 16:01:59 ah 16:02:02 see, I'm not actually sure if it's turing complete 16:02:31 basically I figured I can just make it a list of regular expressions and evaluate them in order, rewinding the list if any match 16:07:20 ah well 16:07:24 I made it count from 1 to 99 16:07:27 so that's something :D 16:07:35 but I just need to find a less braindead way of doing it 16:13:15 Heh. My maths based language can print 99 bottles, but it's not pretty xD 16:13:29 http://rename.noll8.nu/sp3tt/beer.math 16:14:08 that's not bad 16:14:49 :) 16:15:39 hmm 16:16:56 http://members.dodo.com.au/~sgentle/99.2p 16:17:04 that only counts up to 99 :( 16:17:25 well, technically it counts down from 99 16:17:40 but it adds to the front of the list 16:18:52 At least it proves the name fits the language. 16:19:00 :D 16:19:16 or maybe it should be called 99 problems 16:19:38 heh 16:19:42 but a bitch ain't one? 16:20:19 (google 99 problems if you don't get it) 16:20:49 ah. didn't know it was a song 16:52:39 i just invented and implemented a new language 16:52:43 brb, testing it 16:53:06 wow. these languages sure keep popping up lately... 16:56:42 haha 16:56:53 now you see why wikipedia is so afraid of them 17:21:12 i think the interpreter works, now it's time to write hello world 17:27:11 why does "k">@>o in kipple produce 7? 17:27:17 shouldn't it produce the ascii value of k? 17:28:23 "k">@ pushes 3 values onto @, 1, 0 and 7. @>o only pushes one value onto o, nemaly 7 17:28:32 oh, ok 17:29:19 namely, I meant :) 17:32:47 "k">@ (@>o) would be the way to do that 17:40:50 not "k">(@>o)? 17:41:55 that would not work 17:42:19 "k">( would give an error that ( is not a stack 17:42:37 though I have considered allowing that 17:44:31 CXI: are there specs for 2p already? 17:46:44 heh, not really... I want to make sure it's turing complete first 17:47:32 have you seen Thue? it's turing-complete 17:50:23 hmm, interesting 18:17:00 -!- graue has quit ("Leaving"). 18:17:12 -!- graue has joined. 18:32:40 does anyone have a description of PingPong? 18:55:45 pgimeno: http://web.archive.org/web/*/http://www.inz.info/pingpong/ 18:56:21 wee, thanks! I tried it in the past to no avail. 18:57:00 no problem. :) archive.org is sometimes a true jewel. 18:58:26 however I mean that I tried archive.org in the past but I got an error or a not found 18:59:05 oh, ok. maybe you tried some wrong address then? 19:00:04 I don't know what happened 19:00:22 I'm pretty sure I tried that at least twice a few weeks ago 19:01:12 Wikipedia redirects to the Pong game :( 19:01:49 I've got an idea for my genomic programming language :) 19:02:18 My peptide chains will stack rather than fold, and simply based on every-other amino acid being "compatible" 19:02:44 Certain peptide chains will be attracted to the "output" receptor, and will cause the data on them to be output. 19:02:56 Same with input, except a new peptide chain will be created. 19:03:10 I'm still working on breaking peptide chains. 19:04:24 right :) 19:04:40 good luck with that genetic manipulation then. ;) bbl. -> 19:05:30 Heheh 19:07:28 damnit, the storage available to programs in my language is dependent on code size 19:07:43 i'll have to change something to fix this 19:08:41 (it took me two hours to realize that) 19:09:51 graue: do you mean Sortle or the new one? 19:09:55 how so? can't both the expressions and the expression names be of arbitrary length? 19:09:57 the new one 19:10:00 not Sortle 19:10:06 ah, the new one :) 19:11:34 actually, if a program reads input up to EOF, it has as much storage as it wants because it can keep getting new zero bytes 19:11:39 but that's not very pretty 19:13:12 what's the opinion about having all of the languages of the List of Lesser Known Languages in the Wiki, with a category just for them? 19:14:13 pgimeno: about this wiki-category "Lesser known programming languages". what exactly do you consider lesser known? 19:14:22 well, they're jokes, right? 19:14:35 graue: yes 19:14:38 if they're significant in your opinion they could go on the joke language list 19:14:49 kipple: the list is an old joke posted to usenet in the 80's 19:14:56 of languages that didn't exist 19:15:11 ah 19:15:30 one of them, VALGOL, has since been implemented 19:15:44 is there such a list already created? 19:15:49 anyway, I think this "joke language" category has some issues 19:16:26 while some languages are just a joke (Bitxtreme, HQ9+), some are fully functional 19:16:41 l33t, for instance 19:17:04 is it interesting for more than humor value to you? 19:17:23 not really 19:17:53 so that's why it's a joke 19:18:07 HQ9+ is just as fully functional; it's been implemented 19:18:40 well I was talking about being actually usable. 19:20:00 INTERCAL (and a lot of other esolangs) isn't really interesting to me for more than humor value, either 19:20:21 so do you want to make a list of remarkably useable programs as opposed to a list of joke languages? 19:20:51 no. I want ALL languages in the main list, and several categories to classify them further 19:21:01 ++ 19:21:05 kipple: I was asking to graue, sorry 19:21:16 ah 19:21:17 and I agree with kipple: arguably most esoteric languages are jokes 19:22:11 and where the line between jokes and interesting languages go is highly subjective 19:23:06 yeah I think that the wikipedia approach of adding a short explanation of the language together with the name is a good idea 19:23:26 I thought that that was possible with categories, hence my comment some days ago 19:23:55 but it turns out not to be possible, so the main list seems to be the proper place 19:25:35 well 19:25:53 i think it's reasonable to split languages into turing-complete, non-turing-complete, and unknown 19:26:15 that would filter out hq9+ which is not turing-complete 19:26:36 that's a good idea, categories for computational class 19:26:44 I disagree. turing-completeness isn't that important 19:26:49 yes it is. 19:26:53 i.e. ANSI C is not TC 19:26:54 of course, SMETANA and Befunge-93 are not Turing-complete, but still interesting 19:27:02 Argh! is not Turing-complete 19:27:04 graue: exactly 19:27:04 etc 19:27:07 okay 19:27:17 s/turing-completeness/anywhere close to turing :) 19:27:18 kipple: doesn't mean it isn't a nice category idea though 19:27:32 we can have as many sets of categories as we like 19:27:48 very true. we should have a bunch of categories 19:28:05 i still have no idea what makes smetana/befunge better than hq9+ computationally 19:28:11 indeed I've added some already (Lambda calculus paradigm) 19:28:12 actually befunge is turing-complete i think 19:28:16 not -93 19:28:24 it had a limited code size 19:28:26 you can program with smetana/befunge. You cannot program in HQ9+ ;) 19:28:31 yes 19:28:42 turing complete != "you can program in it" 19:29:19 turing completeness is often overrated IMHO 19:29:50 well 19:30:03 maybe a "finite state machine with enough states to do a lot of useful things at least" category 19:30:05 "TC with memory restriction" is important 19:30:12 which is handwaving of course 19:30:24 but essentially means "as good as computers" 19:30:48 befunge and smetana can do as much computation as a computer 19:30:53 hq9+ can't 19:31:43 i still like the cat programming language: every program is a quine! 19:31:51 what category should that one go in? 19:32:47 the same as HQ9+ IMO 19:33:32 "TC with memory restriction" = finite state automaton = lookup table, at least in terms of computability 19:33:46 the really interesting thing is not just computability then 19:33:58 but i'm not sure what it is 19:34:09 i've looked in the literature and there's really nothing that i could find about it 19:34:12 "Useable for programming"? 19:34:16 hmm 19:34:18 sure, informally 19:34:21 but define that?!?! 19:34:22 useable/unuseable 19:34:24 :) 19:34:26 can write 99bob in it? :D 19:34:37 HQ9+? 19:34:38 can write 'n' bottles of beer, maybe 19:34:42 I was just suggesting it being a Category:Useable for programming 19:34:42 99 is finite :) 19:34:47 true 19:34:59 i think it's spelled Usable 19:35:11 CXI: actually, no, you're right 19:35:13 or close 19:35:26 it's like, being able to write 99 bottles of beer, in less space than writing out the song literally 19:35:32 like a form of compression 19:35:36 heh 19:35:37 gzip 19:35:40 :) 19:35:45 (don't laugh, there's a gzip quine) 19:36:09 that's also what the malbolge program did 19:36:12 well, if wang tiles are a computer then... 19:37:43 graue: I think both spellings are allowed 19:37:53 okay then 19:38:20 at least, in smb.conf you can use both writeable and writable ;) 19:39:03 my English-Spanish dict does not list "useable", so it's probably wrong 19:39:33 my dict: usable also: useable 19:39:41 don't you hate it when you make a wonderful elegant symmetrical Turing tarpit with just the right level of pain and it turns out the storage available is limited by how many nested loops you use? 19:39:44 yeah. dictionary.com too 19:40:00 * pgimeno throws his dict out the window 19:40:05 http://dict.leo.org/?useable 19:40:34 i hate it when that happens 19:40:43 never happened to me 19:42:59 okay: how about distinguishing between pure joke languages (HQ9+, bitxtreme etc.) and humorous, though still useful languages 19:43:02 graue: sounds like a push-down automaton 19:43:47 a category for languages clearly intended as jokes would work, i think 19:44:05 a category plus a little mention in the list, IMO 19:44:08 well, just because a language is intended as a joke, doesn't mean it can't be useful 19:44:18 (as in turing-complete) 19:44:28 agreed 19:44:32 or as in us[e]able ;) 19:44:38 not that i can think of any examples at the moment 19:44:45 INTERCAL 19:44:46 cow 19:44:53 ook! 19:44:53 well yeah, intercal 19:45:08 suppose the joke category is only for languages which both were clearly intended as jokes and have not attracted significant attention from others after their creation 19:45:10 the problem is this is that unless the author makes the entry, we're sort of left to try to read their minds 19:45:11 yeah, ook and the like.. i'm not even sure they deserve a mention 19:45:21 they aren't even jokes 19:45:34 it's not funny, it's sad 19:45:54 to clarify my preceding statement, significant attention as us[e]able languages :) 19:46:01 well, I thought the Hello World program in Ook! was pretty funny the first time I saw it... 19:46:23 i'd actually like a rating/voting system , but that's probably beyond the scope of a wiki 19:46:33 like: 3 people thought this was amusiing, etc 19:46:35 i think the fact that we're whining about Ook! on irc is enough reason to document it, but it shouldn't be on the main list 19:47:33 I think it could be, with an entry like this: * [[Ook!]] (joke), direct translation of [[Brainfuck]] commands 19:48:10 (as well as COW etc.) 19:49:10 it could be in a "alternate representations" category 19:49:31 but only ook and cow would be in it 19:49:43 doublefuck 19:49:48 the huffman encoded BF 19:49:54 heh, that opens a whole new can of worms: is Malbolge an alternate representation of Dis? is it the other way around? 19:50:02 isn't fuckfuck one of those as well? 19:50:07 heh 19:50:08 yup 19:50:20 so all alternate representations are alternate representations of brainfuck 19:50:27 heh 19:50:32 boolfuck 19:50:40 perhaps they could all be grouped in one article then. 19:50:40 there's a nice list on wp: http://en.wikipedia.org/wiki/Brainfuck#Languages_based_on_brainfuck 19:50:43 yeah 19:50:57 along with smalfuck and the like 19:51:21 that's a good idea, lament 19:51:23 there is a difference in "based on" and "exactly the same" though 19:51:32 yes 19:51:49 but are there any bf-based languages that really deserve any attention? :) 19:52:17 yes there are 19:52:35 smallfuck for one 19:52:44 erm... i'm not sure i'd call the lambda calculus a "paradigm"... 19:53:03 I think we should aim to include every esolang, even ook, fuckfuck, cow etc. but those could be bunched together in one article, referenced from the BF article 19:53:13 i agree 19:53:21 and if the most succinct way to describe it is "it's Brainfuck with a...", it belongs in that article 19:53:23 cpressey: sorry, I'm not an academic, feel free to correct it 19:53:36 yeah, I think that's a good approach too 19:54:01 pgimeno: ok (still reading the diffs from the past few days :) 19:54:56 so the only remaining question is whether they should be listed in the main list or not 19:55:20 I think they should, so that anyone looking for a particular language can find them 19:55:25 about this "program forms" category: what exactly should be in it? only abstract concepts like the ones there now, or also things like hello world and 99bob? 19:56:17 I think categories for the level of presence of a langauge would be nice 19:56:24 probably measured in the amount of works there are for it 19:56:55 spec/compiler or interpreter/sample programs etc 19:56:57 CXI: yeah. but where to draw the line..... 19:57:08 also, SNUSP looks like a bf descendant and a 2-d language, should probably be in both cats 19:57:19 well, you wouldn't necessarily have to draw any lines 19:57:46 just have category:compiler/interpreter exists or whatever 19:58:59 cpressey: I agree, but graue apparently disagrees. 19:59:06 SNUSP and LNUSP are both derived from PATH, so if any of them should be in the BF-derived category, all should probably be 20:00:08 graue: the SNUSP article is written by you, right? 20:00:12 SNUSP is the most interesting of them and in its modular version it doesn't really look anything like brainfuck code, but core snusp is indeed close 20:00:14 yes 20:00:25 well, it says: " Core SNUSP is a two-dimensional Brainfuck with a more flexible way of expressing loops" 20:00:42 well, most SNUSP programs are written in Modular SNUSP 20:00:42 and " Core SNUSP is essentially Brainfuck with a two-dimensional control flow" 20:01:26 CXI: how about category:implemented ? 20:03:26 i like category: implemented 20:03:31 i think 20:03:42 yeah, that's nice 20:06:38 man 20:06:45 the wikipedia Chef Hello World isn't well-formed 20:06:46 no title :D 20:07:45 it's becoming apparent that there should be a list of categories to categorize each language (sorry for the repetition): joke, usable, implemented... 20:08:01 CXI: it has a title. it's comments it lacks. 20:08:27 mm? it doesn't have anything above "Ingredients." though 20:08:34 oh, wait, we may be looking at different pages 20:08:40 incidentally, this made me laugh: 20:08:41 The following code should theoretically translate to the peptide HELLQWQRLD, (cross fingers). 20:08:41 TACGTACTTAATAATGTTACCGTTGCAAATCTAATC 20:09:31 okay, yeah, the one on [[Chef programming language]] is okay 20:09:52 I was talking about [[Hello world program in esoteric languages]] 20:10:33 ah. I see 20:11:52 well, now it is correct :) 20:11:58 :D 20:12:12 pgimeno: yes. there are a LOT of potential categories 20:13:07 for instance: I think we should have a "stack-based" category 20:13:46 stack-based meaning which languages? 20:14:00 but what exactly is that? only langs with only one stack, like befunge, or including languages like Chef and Kipple? 20:14:36 I think that including all; that makes it easier to look for a particular language which is stack based 20:14:44 probably 20:15:01 languages that use stacks as its main/only data structure 20:15:11 what do you call the brainfuck datastructure? tape? 20:15:17 I'd call it a tape, yeah 20:15:38 I'm going to write an attempt of a [[Categorization]] page 20:15:46 but there are 3 different tape types.. no ends.. one end.. 2 ends 20:15:51 99 esoteric languages on the web, 99 esoteric languages. 20:16:18 You look one up and code a song in it, 98 esoteric languages on the web. 20:16:25 drink 99 bottles of beer and write a new... 20:16:34 XD 20:16:42 Rather 99 cans of jolt 20:17:00 alternatively: stay up late, write a spec. 100 esolangs on the web. 20:17:09 "Hello, 99 bottles of beer on the world!" 20:17:45 pgimeno, make it an [[Esolang:Categorization]] page 20:17:56 meta stuff should be in the Esolang namespace since mediawiki likes it that way 20:17:59 ok 20:18:01 jix: I don't think it is necessary to be THAT specific with the cats 20:18:14 hehe.. yes.. 20:18:27 cpressey: that needs a quine! 20:18:39 you missed a fourth type of tape, jix, the kind that loops around 20:18:46 uh 20:18:47 unless you count that as "no ends" 20:19:08 and the one that has one end end loops at the other end 20:19:12 Sugar high... Ugh. 20:19:21 like fyb 20:19:26 yes 20:19:29 haha 20:19:32 FuckYorBrane XD 20:19:35 how about a 99bob-based language 20:19:40 LOL 20:20:06 A brainfuck translation with parts of the lyrics. 20:20:40 On the wall, go to the store all represent different operations. XD 20:20:53 13 letters of "Hello, world!" on the wall, 13 letters of "Hello, world!" Take one down, pass it around, 12 letters of "Hello, world!" on the wall. 20:20:55 CXI: yeah! it could have 99 commands. Each verse a different one 20:21:03 :P 20:21:11 lol 99 commands 20:21:31 so you would need four lines of code to do the equivalent of a brainfuck > 20:22:05 99 commands in the spec. 99 commands. 20:22:09 haha 20:24:47 write one down and pass it some arguments. 98 commands in the spec 20:26:40 hmm, i'm tempted to add a debugger or an assert command to this esolang of mine, but that would be cheating 20:27:37 heh 20:27:43 I want to write a language made entirely of asserts 20:28:06 it just brute-forces the input until it matches all your asserts and then returns it :P 20:32:18 graue: i have to say, sortle's pretty neat 20:36:42 CXI: hmm prolog? 20:37:24 if you write your own naive sort function in prolog it scales O(n!*n) 20:37:37 in the worst case 20:37:54 (hm, maybe "unimplemented" would be a better category than "implemented") 20:38:38 i need a language where i have a simple platform independent canvas i can draw to and get mouse events from 20:39:43 non esoteric 20:40:51 python! 20:40:56 python/tk 20:41:07 hmm ruby/tk.. but i don't know tk 20:41:31 big deal 20:41:44 don't know about ruby but python has a very good tk reference :) 20:42:09 there are ruby/tk tutorials and references 20:42:37 then stop complaining :) 20:43:05 i don't want to learn how to use tk just for a stupid canvas 20:46:15 http://www.esolangs.org/wiki/Esolang:Categorization <- my first attempt 20:46:23 cpressey, sorry for the delayed reaction but cool, i'm glad you like it 20:47:54 graue: np... do you suspect that it (umm) "admits computation" or not? 20:48:45 i like that there is no strict requirement that esolangs be TC... it provides open research questions. 20:48:50 aura is an interesting case 20:48:51 too 20:50:15 i suspect that it admits computation, yes, although i haven't thought of a way to show this 20:52:21 hm, do "lesser known programming languages" have to be a category? 20:52:41 well, there are quite a few and I think they deserve one 20:53:06 heh, everything's going to be in like ten categories 20:53:06 but if you have a different thought you're welcome to expose it 20:53:31 yeah 20:53:48 "turing tarpit" seems a problematic category 20:53:57 ultimately I'd add an "esolang" category 20:54:03 hard to categorize 20:54:08 what's a tarpit and what's not 20:54:19 e.g. Lazy K could be trivially made one instruction shorter 20:54:25 by removing i 20:54:40 so it dosen't have "as few instructions as possible" 20:54:56 lament: doesn't lazy k needs i for church integers ? 20:55:19 jix: i can be represented with s and k 20:55:24 oh 20:55:55 how can you be represented with s and k? ;p 20:56:08 lazy k? that sounds a lot like unlambda 20:56:10 ```s`kk``s`kk 20:56:20 (no that's wrong) 20:56:29 lament: how can you... 20:57:07 CXI: but unlambda has unneeded commands with side effects 20:57:14 lazy-k is side effect free 20:57:17 so which came first? 20:57:25 combinatory logic came first ;) 20:57:36 pgimeno: i guess "purely functional" deserves a category 20:57:38 is that where s/k notation came from? 20:57:49 CXI: unlambda came first 20:57:51 lament: there's a "functional programming" cat now 20:57:55 I don't know much about functional programming 20:57:57 CXI: yes 20:58:02 pre-turing, iirc 20:58:07 which blew my mind 20:58:11 cpressey: yes, and also "functional paradigm" :) 20:58:23 change that at will 20:58:29 one of those must die 20:58:37 but there's a difference between functional and purely functional 20:58:44 unlambda is functional 20:58:54 "functional paradigm" has 0 members now, it can die 20:58:57 iota, jot, lazy k are purely functional 20:59:12 lament: not a difference worth categorizing on, imo... or if it is, call it "referentially transparent" 20:59:16 cpressey: sure 20:59:25 pgimeno: paradigm sounds better though :) 21:00:04 I'm not sure if Thue has a different paradigm and if it's worth being included in any if so 21:00:34 well, it does 21:00:51 there's even a name for it 21:01:00 string-rewriting 21:01:06 string-rewriting 21:01:08 yes 21:01:23 rewriting languages could be their own cat 21:01:30 I was tainted to include that but I was not sure as I've just said 21:01:32 (ignoring that any language can be described as a rewriting language :) 21:02:08 at some point, for categorization, you just have to go on what the author probably intended... 21:02:23 would malbolge go in "Unusable"? 21:02:31 hm 21:02:41 I don't think it's categorizable yet... 21:02:55 there should be category: unknown TC status 21:03:04 a very important category imo 21:03:06 i think ben intended "hellishly difficult" rather than purely "unusable" :) 21:03:08 it's usable to some extent, but it's possible that as an FSA it has too few states 21:03:50 lament: that's OK to me 21:04:06 is anyone editing the Esolang:Categorization page? 21:04:18 not i 21:04:48 can turing tarpit be a subcategory of turing-complete? 21:06:21 what's tarpit mean, anyway? 21:06:31 IIRC it's a misspelling 21:06:49 a pit full of tar, like LaBrea :) 21:06:50 I don't remember the details nor where I read about that 21:06:57 i don't think tarpit is a useful category for esolangs 21:07:00 most esolangs are small 21:07:01 where all the dinos got stuck... 21:07:04 heh 21:07:09 I know what an actual tarpit means 21:07:21 i propose to just keep turing-complete 21:07:24 ok :) 21:07:39 a turing tarpit is just "arbitrarily low # of instructions" 21:07:48 ah, okay 21:07:49 for some def'n of "instruction" 21:08:08 pgimeno: what do you think 21:08:34 I think that it's useful to hold Turing tarpits as a [sub]category 21:09:01 and i definitely propose we invent a word for "turing-complete with memory constraint" 21:09:04 and that it's listed in the categorization list 21:09:07 and use that as a category :) 21:09:18 lament: that's FSA and is there 21:09:41 but FSA sounds almost insulting 21:09:49 heh 21:10:04 brainfuck is listed as a turing tarpit 21:10:19 together with "Usable" it will be meaningful enough I think 21:10:39 but most brainfuck specifications make it a FSA 21:10:46 including the original one 21:10:55 FSA? 21:11:03 finite-state automaton 21:11:09 ah 21:11:59 it's not enough to be a FSA 21:12:08 it has to be "easy to extend" 21:12:34 brainfuck, befunge, smetana can all be trivially extended to arbitrary size 21:13:38 Unbound FSA? 21:13:52 but that's not a sufficient condition either 21:14:09 brainfuck without loops is a FSA, right? 21:14:39 even FSA's can have loops... 21:14:53 brainfuck without loops is, um... a tuple of integers? :) 21:14:59 yes, but a "turing-complete with memory constraint" language must have loops 21:15:08 so not all FSA qualify 21:15:27 (by loops i mean some way of making it not halt, at the very least) 21:15:30 lament: i would tend to agree, but (as i mentioned before) i can't find *anything* in the literature about it 21:16:01 you know your language is nowhere near TC when you can determine if a program halts with current computational resources :) 21:16:36 (and in befunge you can already write a program that won't ever halt or repeat state) 21:18:41 how about "brainfuck-complete" 21:20:12 "brainfuck-complete with upper memory bound 80 cells" 21:20:23 "brainfuck complete with arbitrary memory size" 21:21:10 I'm not sure that's a serious name :) 21:21:37 how serious does it have to be? :) 21:22:34 the nice thing about it 21:22:44 I'm somewhat puzzled... if an algorithm is required to stop, and a Turing machine is required to run an algorithm, and a SMETANA program can implement any algorithm... how come SMETANA is not Turing-complete? 21:22:49 is that if you say "BF-complete with upper memory bound 40" 21:23:05 and everybdoy will know approximately what class of problem it can solve 21:23:40 pgimeno: semnta can't store an infinite number states.. some algorithm require infinite states 21:23:47 jix: no 21:23:53 ok not 21:23:57 jix: no algorithm requires infinite steps 21:24:08 jix: unless it doesn't halt, in which case it doesn't matter what it requires 21:24:23 any halting algorithm can be implemented in smetana. 21:24:30 if you come up with an algorithm that requires n steps, i can come up with one that requires n+1 21:24:31 but you have to know memory requirements in advance. 21:24:48 smetana is brainfuck complete :) 21:25:01 oh, that's a point, lament 21:25:05 btw i'm going to use ruby/tk .. seems to be very simple 21:25:40 pgimeno: turing machine can do more than just algorithms, it seems 21:25:51 turing machines can hang, algorithms can't 21:25:55 I think that's THE point: given an arbitrary algorithm, you can't know in advance how much memory it will take 21:26:19 yep 21:26:43 the thing with "BF-complete with upper memory bound n" is that it's the same as "FSA with upper state bound m" or "lookup table with x entries" 21:26:57 where x >> m >> n, i imagine 21:27:22 er, maybe m > x actually 21:27:22 nope, some FSAs can't compute certain things (e.g. Brainfuck without loops) 21:27:33 ? 21:27:50 cpressey: all bf-complete with upper bound languages are FSA 21:27:53 they *can*, they just need more states 21:27:54 cpressey: but the reverse is not true 21:28:10 or am i wrong? 21:28:24 what does "bf-complete" mean? 21:28:38 you can compile brainfuck to this language. 21:28:48 and run your program with memory size n. 21:29:17 so you are saying that: not all FSA are languages that can have brainfuck compiled into them? 21:29:32 uhm, I think I'm getting cpressey's point 21:29:41 cpressey: i think so.. is that wrong? 21:29:44 you mean brainfuck with finite tape? 21:29:48 yes 21:29:57 (and finite cells) 21:30:00 I would consider "BF-complete with upper memory bound n" is more like linear-bounded automata, not a finite state automaton. 21:30:19 I mean, a FSA must always terminate (for finite input). 21:30:34 fizzie: hey!! 21:30:42 that's exactly what we were looking for 21:30:55 ok, so the claim is: exists F, F is an FSA that cannot be the result of translating a (finite-tape) brainfuck program to an FSA 21:30:58 ? 21:31:05 FSA must not always terminate 21:31:11 oh,m for finite input 21:31:12 yes 21:31:29 cpressey: it's not just that 21:31:30 hm 21:31:49 cpressey: it's that your language should be capable of expressing all the FSA corresponding to all the brainfuck programs with up to that memory size 21:32:30 lament: i'm sorry, that still sounds like "equivalent to an FSA" to me. 21:32:39 anyway 21:32:42 what fizzie said. 21:32:45 http://en.wikipedia.org/wiki/Linear_bounded_automaton 21:33:15 by the way, i'd prefer if wiki articles did not link directly to user or talk pages 21:33:23 As far as grammars go, linear-bounded automata (turing machine with a tape length limited to the input; what I would guess brainfuck-with-n-sized-memory) can recognize all context-sensitive grammars, IIRC. Type-1 grammars in the Chomsky hierarchy. 21:33:28 (so it is possible to mirror just the content, if anyone should later want to do that) 21:33:36 While finite state automata only recognize type-3 languages. 21:33:41 LBA sounds a lot closer 21:33:54 cpressey: but LBA seems to be equivalent to brainfuck complete :) 21:34:06 but LBA is already coined as a term :) 21:34:08 this is strange 21:34:17 it would seem that LBA is a subclass of FSA 21:34:22 i only wish there was a ref on wp 21:34:23 why aren't they? 21:34:31 not sure 21:34:48 graue: should there be entries for people (instead of linking directly to user pages?) 21:34:51 okay anyway 21:34:52 Why would they be? The grammars they can recognize are a superset of those FSA:s can. 21:35:06 fizzie: they have a finite number of states. 21:35:08 they can (e.g._ fail to halt, you mean? 21:35:16 cpressey, i suppose so 21:35:28 anyway LBA should definitely be a category 21:35:52 the language i'm writing atm is a LBA 21:35:56 If you want something more distinctive than just "turing-complete/not-turing-complete", why not use the chomsky hierarchy? 21:36:00 and most of the stuff that's now in "Turing complete" should migrate to LBA... which is kindof sad :( 21:36:03 incidentally, anyone want to see the perl script I use for Two Problems? 21:36:17 fizzie: I like that idea 21:36:25 CXI: yes 21:36:52 you implemented it in perl.. you should call it 3 problems.. 21:36:56 haha 21:37:03 LBA still seems not quite right... size of tape = function of input size. 21:37:14 this is compicated by the fact that many of these languages are interactive 21:37:30 http://members.dodo.com.au/~sgentle/2probs.pl 21:37:39 well, IO is supposedly irrelevant to turing-completeness 21:37:40 Anyway, every language an FSA recognizes can easily be recognized by an LBA (so L(FSAs) is a subset of L(LBAs)), and there are languages that can't be recognized by a FSA but can with a LBA (so L(FSAs) is a _proper_ subset of L(LBAs)). 21:37:54 heh 21:38:04 I should really fix that eye-bleedingly horrible bit 21:38:08 irrelevant to computation, yes 21:38:12 but not to communication :) 21:38:17 cpressey: but yeah, you're right 21:38:26 who the heck uses computers for computations anymore? 21:38:29 but that can be a separate category 21:38:34 heh 21:38:45 plus if you don't output anything your program is really easy to optimise 21:39:17 CXI: not true 21:39:21 CXI: because of the halting problem 21:39:58 what's "input" here? 21:40:04 CXI: consider a program that tries to express every number as a sum of two primes 21:40:15 well, you could call a halting program an optimisation of a non-halting program 21:40:18 and then you're safe 21:40:19 starting with 4 and going up 21:40:30 when it finds one it can't express, it halts 21:40:37 pgimeno: syntax is 2probs.pl sourcefilename arguments 21:40:43 go and optimize that, you'll win the fields prize and get a million dollars 21:40:48 http://members.dodo.com.au/~sgentle/99.2p if you missed it before 21:41:10 prints numbers from 1 to 99 21:41:24 CXI: sorry, I'm postponing taking a look at your prog right now (will look at it later) 21:41:38 and also prints an error message that I've been too lazy to fix (this isn't really production-quality) :P 21:41:38 but shit 21:41:42 input is a valid point 21:42:15 nah... i don't think so. 21:42:24 you could store all input in the body of the program :) 21:42:30 oh, right 21:42:35 and disregard IO 21:42:38 I thought the input question was about two problems 21:42:39 my bad :) 21:43:09 wrt to IO there're three types of languages i think? 21:43:14 four 21:43:19 no IO 21:43:22 output only 21:43:32 non-interactive IO 21:43:34 interactive IO 21:44:04 perhaps the first three could be categories 21:44:14 A Swedish site sells custom badges... I'm thinking about ordering one with "hello world" in brainfuck XD 21:45:01 nah.. order "you are dumb" in bf.. if someone asks you what it means ... :D 21:45:21 cpressey: what's that language called Version you've added to the language list? 21:46:05 it's rather hard to find information about esoteric programming languages, let alone a language with that kind of name. I hope you've got its homepage address somewhere written down... 21:46:31 jix: good idea. 21:47:00 Need to find a program that generates brainfuck that outputs a certain string... 21:47:29 sp3tt: do it manually .. generate delta values for the string and use multiplication to shorten the code 21:47:54 okay, added IO capabilities categories 21:48:04 ZeroOne: http://catseye.mine.nu:8080/projects/version/doc/version.html 21:48:36 True... 21:49:00 I have a BF interpreter in python around here somewhere... 21:49:12 heh 21:49:23 or do what I do, be lazy and generate output in binary instead 21:51:54 a la http://bur.st/~comet/xmas.b 21:52:06 yuck, /me merges lament's changes with his own ones 21:53:36 NB: I preferred "cell-based" instead of "tape-based" because that way it can be applied to fungeoids et al, which in my opinion share the same idea 21:54:21 er 21:54:35 i think i just overwrote your changes again 21:54:56 if there were any 21:54:58 you can't overwrite someone's changes 21:55:08 oops, I'll merge again 21:55:13 if someone has edited since you pulled up the edit form, it just gives you an edit form again 21:55:26 hm 21:55:32 then what is pgimento 'merging'? 21:55:33 The program should output "Your brain is fucked" XD 21:55:36 I just didn't submit 21:55:37 pgimeno 21:55:38 oh 21:55:41 anyway 21:55:50 i just killed the entire turing-completeness class of categories 21:56:49 did we decide on abolishing the Turing tarpits category or keeping it? 21:56:57 i moved that one over 21:57:01 if we keep it, it could be a subcategory of Turing-complete, which might be good 21:57:04 it has nothing to do with computational complexity 21:57:17 besides most languages in it are probably not turing-complete :) 21:57:21 so we are keeping it, though? 21:57:22 e.g. brainfuck 21:57:30 why have you removed the turing completeness? 21:57:31 well, it's the only category that actually has something in it 21:57:35 bf is not turing-complete? 21:57:37 Brainfuck is Turing-complete with unbounded memory, and it is usually specified as such 21:57:45 pgimeno: i replaced it with "computational class" 21:57:46 even if the original implementation didn't do it that way 21:57:58 pgimeno: turing complete/linear bounded automata/finite state automata 21:58:08 what we were just discussing for an hour 21:58:13 oh, that's a renaming then :) 21:58:17 ok 21:58:21 pretty much 21:58:32 but it does get rid of the amazing "usable" and "not usable" categories :) 21:58:35 There's pushdown automata between those two last ones, but I'm not sure there would be many languages in that one. 21:58:51 thue is a LBA of course? 21:59:08 err 21:59:09 I think it's Turing-complete 21:59:12 yeah 21:59:13 nevermind 21:59:25 probably TC 21:59:38 is this classification called "Computational class"? 21:59:42 or "Computational complexity" 21:59:52 what should the category for languages of unknown class be named 22:00:14 I was going to utter "computational complexity" at one point, but I'm not quite sure now. 22:01:04 I had written: * Usable for writing programs // ** [[:Category:Usable]] // ** [[:Category:Unusable]] // ** [[:Category:Usability unknown]] 22:01:17 "Computational complexity" reminds perhaps too much of time/space-complexity, which is really a different issue. 22:01:31 [[Category:Unknown computational class]]? 22:01:48 usability is different from computational class 22:01:55 sounds OK 22:01:59 and i'm not sure if it's a good category anyway 22:01:59 yeah, sorry 22:02:08 who are we to decide what's usable :) 22:02:13 just ask any sane person 22:02:19 none of the languages on the wiki are usable :) 22:02:26 I did connotation-mapping (read: googled for it) and came up with pages about P != NP, so perhaps the '-- class' is better. 22:02:36 unusable is HQ9+ etc. 22:02:59 malbolge is usability unknown 22:03:11 as is sortle 22:03:23 that's also reflected in its computational class 22:03:33 i.e. it's not an LBA 22:03:46 The computational class for HQ9+ would be something even more restricted than FSA, wouldn't it? 22:03:48 graue: how about "open research questions" or similar? 22:04:02 that's fine too 22:04:10 then you would have to specify each time 22:04:11 what exactly the question is 22:04:18 there're different research questions 22:04:21 fizzie: i would imagine so 22:04:33 lament: it's just a category 22:04:40 HQ9+ has infinite states :) 22:06:38 I seem to recall some pushdown-automata-like language (single stack, no other real storage), but now I've forgotten it. How is befunge classified, btw? At least '93 has that 80x25 fixed size limit... 22:07:00 fizzie: b93 = pda afaik 22:07:06 no proof 22:07:10 does LBA have to have arbitrarily big storage? 22:07:29 lba tape size is a function of input size (according to wp) 22:07:37 so, um 22:07:37 maybe 22:07:39 so yes 22:07:40 definitive maybe 22:07:40 okay 22:07:48 hrm :( 22:07:55 then LBA is not a very good description at all :( 22:08:11 no, it's not 22:08:23 fuck. 22:08:26 a brainfuck program can do something to an infinite input with only a finite tape 22:08:39 "do something" = turn a's into b' or whatever 22:08:46 yeah 22:08:53 Well, it's a good description as far as grammars recognizable by the language are considered, but it's perhaps not a very good measure for real-world things. 22:09:09 brainfuck-complete then? :) 22:09:34 heheheh BANCStar! i remember BANCStar (DIMLY...) 22:10:12 how do you distinguish between a language like brainfuck that can turn all a's to b's 22:10:17 and a language that can't do anything else? :) 22:11:01 As far as real-world uses are considered, most people want more than a "yes/no" answer from their programs, too, so Chomsky hierarchy (which is about the strings accepted by the program) probably isn't that good a category. 22:11:02 lament: that appears to be an open research question :) 22:11:26 fizzie: yeah :( 22:11:37 well 22:11:42 we have to be fair to no-IO languages 22:11:48 smetana, iota, jot 22:12:21 I've just made a few changes: moved Turing tarpits as a subcategory of Turing complete, added String-rewriting paradigm, and usability (Usable by default; otherwise [[Category:Unusable for programming]] and [[Category:Usability unknown]]) 22:12:53 I understand why brainfuck is named brainfuck <.< 22:12:59 damn, boo-yah 22:13:04 You could cheat and classify as Turing-complete all languages that are "turing-complete if not a simple memory space restriction of K, the changing of which would not change the language semantics _that_ much", but that's horribly unexact. 22:13:05 i ought to design and implement that someday 22:13:06 perhaps" usable for programming" is the best classification after all 22:13:25 fizzie: that's what i proposed 22:13:30 fizzie: "brainfuck-complete" 22:13:55 which is actually pretty exact if you specify brainfuck cells to contain 8 bits or whatever 22:14:03 i still think it (somewhat uninterestingly) comes down to a compression problem 22:14:27 a TM with a 1000-symbol tape is a FSM, but it is a much more compact representation 22:14:58 now, *why* it is a more compact representation - that is an interesting question 22:15:06 no kidding 22:15:19 every programmer seems to intuitively understand why, but where's the bloody formalism? 22:15:25 It's not really a FSM. (There's the halting thing, for one -- it can do state transitions without consuming input.) 22:15:35 ok, "FSM that might not halt" 22:15:41 man 22:15:47 these chomsky things are completely useless 22:15:48 or something close 22:15:53 as are the original turing things 22:15:57 because of their notion of "input" 22:16:38 Sigh. I can't even construct a simple loop in bf. 22:16:47 sp3tt: +[] 22:16:51 >++[<----->-]<. 22:17:08 That should decrease the current memory cell with ten, right? 22:17:09 link for BogusForth seems to be dead 22:17:23 Assuming the next memory cell was zero, apparently. 22:17:48 okay screw it, let's just keep "usable" :) 22:17:57 and have the category:usable itself be an "open research question" :) 22:17:59 BF-complete was already used by Fraans Faase, btw 22:18:10 well, there you go 22:18:11 s/Fraans/Frans/ 22:18:15 it's a natural way to classify things :) 22:18:48 Does brainf*ck specify any limitations to program length, btw? 22:18:54 but not in that sense I'm afraid 22:19:09 not that I know, fizzie 22:19:13 should we have some Template:Stub like in Wikipedia? we could use one to mark articles that only have one sentence or so. 22:19:15 fizzie: no 22:19:18 Befugne (93) would (probably) not be brainf*ck-complete, then. 22:19:28 fizzie: yes. 22:19:36 so that's still a crappy definition :) 22:19:53 "brainfuck-complete with memory and code restriction" just doesn't sound very good 22:19:56 ZeroOne: looks like a good idea 22:20:31 how about HQ9+ complete :) 22:21:02 well, not HQ9+, but have a list of problems that a language should be able to do 22:21:14 the only side effect is allowing a language that does nothing but those problems 22:21:15 "code restriction" opens up a whole new can of worms 22:21:46 but apart from that, it seems pretty good.. 22:21:49 i'm much happier just leaving all the contentious stuff uncategorized, btw. 22:22:05 it will also give people things to do 22:22:20 implement the "qualification" programs in all the languages :) 22:23:09 what are our "qualification" programs? 22:23:15 99 bob? 22:23:19 definitely :) 22:23:38 I always write a befunge interpreter, but perhaps that's not a good idea. :p 22:23:38 what does it qualify the language for? 22:23:55 maybe "99bob-complete" 22:23:55 99 bob using substaction and looping 22:24:06 well, 99 is not a great program 22:24:11 pgimeno: ok, here's the template in action: http://esoteric.voxelperfect.net/wiki/Ale 22:24:14 You probably can use an "approved by esowiki" stamp on the marketing brochures after that. 22:24:16 for some def'n of "subtract" and "loop" i suppose :) 22:24:25 but still 22:24:51 cool, ZeroOne 22:24:52 a bunch of math problems... number factorization.. sorting.. 22:25:14 none of it is relevant mathematically speaking 22:25:45 but in real world terms, it means a lot when something like Chess was implemented in befunge 22:25:56 Heh, and will we specify for how large inputs do these qualification programs need to work? The befunge qsort is pretty limited, for example, since all the data must fit on the playfield. 22:26:41 lament: TPK may be what you're looking for 22:26:55 Your (plural you) use of the "we" pronoun is contagious. 22:26:57 http://www.cs.fit.edu/~ryan/compare/ 22:27:11 i don't think the stub template is a good idea 22:27:19 it makes the site look messy and unfinished 22:27:29 just let stubs be stubs and if someone cares they'll be expanded 22:27:36 fizzie: note however that you can implement the actual algorithm in befunge 22:27:51 or, for example, in smetana 22:28:53 graue: the intention is to have a more or less detailed description of each language, not just a quick overview like now, right? 22:29:25 and it's just that really 22:29:30 it's not about the size of input 22:29:31 yes, but that'll happen when it happens 22:29:36 it's about being able to write non-trivial code 22:29:38 making the pages look a mess isn't going to speed it along 22:30:17 why is there so little math in all of this :( 22:30:59 graue but it would be good to create the sensation that the intention is detailed descriptions, and without the stub notice it seems like they're more or less complete 22:31:27 i like stub template 22:31:38 although, it's not necessary 22:31:39 almost everything is a stub now 22:31:45 yeah 22:31:54 it's fairly clear that more info can be added 22:32:00 yeah, but it would seem as if the intention is to have just short descriptions 22:32:05 and if no one does, well, we live 22:32:18 consider the following language: 22:32:19 we could add a note in the list 22:32:23 it's "seemingly turing-complete" 22:32:28 it has no interactive IO 22:32:30 "longer descs wanted!" etc 22:32:36 cpressey: yes, that's another way 22:32:41 when a program terminates, if the state is "hello world", it gets changed to "" 22:32:55 Is this turing-complete? 22:33:17 no matter what i do i can't get it to output hello world 22:33:48 lament: i've come across that before (actually ben did)... it seemed like a representation problem 22:33:57 you can output hello world in e.g. binary ascii 22:34:27 i think it came up because ben thought the original wierd couldn't output ascii 0 22:34:42 which it could, but it still raised an interesting question 22:35:03 say (eg) the alphabet of symbols you can write is a subset of those that you can read 22:35:10 is that turingmachine still tc? 22:35:20 it is 22:35:26 i'd think so too 22:35:27 because a turingmachine is always tc 22:35:34 (unless the subset is like the null set or something) 22:35:36 you only need 0 and 1 22:36:14 right, which makes me wonder about judging turing tarpits based on # of symbols (they can all be encoded in e.g. unary even, if you ignore the problem of "telling where the program stops") 22:36:20 ok, i officially give up and advocate to use "usable"/"unusable" 22:36:53 heh 22:36:59 tarpits are just small languages 22:37:12 yup 22:37:14 actually do they have to be small? 22:37:17 cpressey: any file can be coded in unary 22:37:18 i thought the requirement was 22:37:27 "everything is possible, but nothing of interest is easy" 22:37:40 that's the derivation 22:37:45 hehe 22:37:53 the meaning is "a Turing-complete language with few symbols/instructions" 22:38:47 yeah, "turing tarpit" is not well defined 22:39:04 it can't be 22:39:23 there's nothing magical about tarpits vs non-tarpits 22:39:32 it's more like a definition by enumeration of the currently accepted TTs 22:39:56 yep 22:40:53 pgimeno: yes, the "problem" is "where does it stop?" (i'm not saying it's a "real" problem... just that it might be, depending on how you look at things) 22:41:11 the problem with the TC stuff is that everybody uses TC to mean "almost TC" 22:41:32 nod 22:41:40 cpressey: stop in what sense? I don't get you here; if you have a file you know where it stops, and if you have a binary number you also do 22:41:41 eg on the smallfuck page 22:41:45 "Like Brainfuck, Smallfuck is Turing-complete. Provided you have an implementation that can initialize memory cells arbitrarily before running the program and print out their content when the program ends, you can use Smallfuck to make any kind of calculation." 22:41:47 err s/binary/unary/ 22:41:53 or, there's a bald claim to TC with no proof 22:42:19 when smallfuck is explicitly defined to have some memory limit 22:42:21 TC and implementations shouldn't mix 22:42:57 pgimeno: how do you know how it stops without having either a) a terminator symbol (which is not the same as your unary symbol) or b) a file size (which is stored how?) 22:43:40 cpressey: yeah, I agree about the terminator symbol; but translation to a file is made by storing the number with a '1' prepended 22:44:15 i.e. a one byte file is the digit 1 plus the 8 bits of the file 22:44:16 pgimeno: i don't quite follow - is '1' the file size? 22:44:27 oh 22:44:28 yet i keep having a feeling there's SOME sort of math behind this :( 22:44:33 but can you stor *that* in unary? 22:44:37 lament: me too 22:44:41 shrug 22:44:56 open research :) 22:45:30 cpressey: you can store in unary e.g. 257 which is 100000001, meaning the file with the ASCII character 22:47:10 but you need a terminator char if you use unary anyway 22:47:26 oh, ok - if you have a max file size (which all real filesystems do,) yes, i can see that 22:47:47 why a max file size? 22:48:11 Ok, Brainfuck totally rocks, pwns, and is teh shit! 22:48:12 that's "the EOF problem" which also rises in compression theory 22:51:06 pgimeno: a max file size? well... all i meant was that in practice, you don't use bignums ;) 22:51:23 * cpressey sees an "esoFS" approaching on the horizon :) 22:51:28 oh ok 22:51:30 haha 22:51:41 ++++++++++[>+++++++++<-] >-.>++[<+++++++++++>-]<.++++++.---.>++++++++[<---------->-]<--.>++++++++[<++++++++>-]<++.>++[<++++++++>-]<.>++[<-------->-]<-.++++++++.+++++.>++++++++[<---------->-]<++.>++++++++[<+++++++++>-]<+.>++[<+++++>-]<.>++++++++[<---------->-]<---.>+++++++[<++++++++++>-]<.>+++[<+++++>-]<.>++[<--------->-]<.++++++++.------.-.>++++++++[<-------->-]<---. 22:51:43 w00t 22:52:03 calamari was working in one for his shell 22:52:53 That prints "Your brain is fucked!" 22:53:01 lol esoFS 22:53:14 Esoteric filesystem? LOL 22:53:23 Chef-FS, imagine that. 23:03:10 i've been thinking of writing up an Esoteric Software License for interpreters i write 23:03:29 viral licenses have been done, but not polymorphic viruses! 23:03:57 hahaha 23:13:11 XD A badge with green text on black background. 23:13:41 And the text is a brainfuck program that outputs "Your brain is fucked". 23:30:55 Night all. 23:31:22 -!- sp3tt has quit ("Chatzilla 0.9.68a [Firefox 1.0.4/20050511]"). 23:35:28 that's a very long program. 23:35:31 i bet it could be shorter. 23:37:28 cpressey: perhaps program growth vs. problem complexity growth has something to do with it 23:37:39 not sure what exactly those two would mean 23:37:59 (it = "turing-complete-likeness") 23:38:21 so yeah, "compression", asymptotically 2005-06-05: 00:05:16 i've designed turing-complete language with only 5 instructions 00:05:32 do tell. 00:05:40 wait.. i can reduce it by one 00:06:30 it's name is XUML 00:06:45 that's a start. 00:07:08 it has 4 instructions: X = flip bit value 00:07:27 U = User interact (takes argument) 00:08:01 hmm wait 00:08:40 L = Loop (takes argument) 00:08:46 M = Move (takes argument) 00:08:48 Yay, a language starting with X. at last :D 00:09:15 i just noticed my syntax definition is wrong 00:09:22 lament: yeah, something like that... there are still a few books that looked promising at the library that i didn't check out; i'll keep looking... 00:13:07 i won't be at all surprised if nobody ever researched this seriously 00:13:53 mainstream CS seems to look at these things from a very different perspective 00:14:24 ignoring interactive IO and such 00:20:19 it seems the basic concepts CS operates with (in this regards) are not exactly the basic concepts relevant to esolangers 00:20:24 *regad 00:20:26 *regard :) 00:24:34 new language, hooray, fanfare etc: http://www.oceanbase.org/graue/qdeql/ 00:25:50 that's turing complete? 00:26:45 urgh i don't want to write XUML programms 00:26:59 (and did you forget about reenqueuing the 0 after a \ ?) 00:27:04 lament, i haven't proved it, but it intuitively seems so 00:27:12 hm? 00:27:24 if the byte is zero during a \ it just gets lost 00:27:25 is there any way to extend the queue size ? 00:27:33 yeah, it's dynamic 00:27:45 starts out empty, then you add to it 00:28:24 \ lets you enlarge and shrink the queue :) 00:28:31 what does - do on an empty queue 00:28:40 enqueues 255 00:28:44 okay 00:28:45 the boolfuck code: [[+]+] is LLLXXLXX in XUML 00:28:54 like it says, "dequeueing produces 0 if the queue is empty," so that's how it works 00:29:21 which is Loop(Flip Flip Loop(Flip) Flip) 00:29:28 jix, i like what i'm hearing 00:29:31 keep up the good work 00:30:25 you have to double flip (XX) because you cant place a subloop at the start of the parent loop 00:31:14 that is insane 00:31:34 i didn't wanted to add control characters 00:32:00 well, i meant insane in a good way 00:32:05 hehe 00:34:33 UXXUUXXXUXXUUXX prints a newline 00:37:45 but only if it's the last outputting command 00:46:53 auto converted (BF=>BOOF=>XUML) programs are going to be so fucked long 00:50:03 > is MMLXX and < is MLX 00:50:45 ... 00:55:07 I want to add a category for languages where the source is not a text file, like Piet. But what to name it? non-text based languages? doesn't sound too good in my ears... 00:55:23 non-ascii ? 00:55:38 that would exclude some text-based langs 00:55:45 include I mean 00:55:46 oh right 00:57:33 languages whose input is not in the form of a character stream is perhaps a bit verbose ;) 01:07:10 non-textual? 01:08:38 yeah, that's better :) 01:11:22 about the categories: do we really need categories for deterministic or one-dimentional? 01:11:40 shouldn't we just assume they are, unless otherwise categorized? 01:12:08 ++++++++++[>++++>++++++++++>+++++++<<<-]>>>++.<+.+++++++..+++.<++++.<+++[>----<-]>.>++++++++.--------.+++.------.--------.<<+++[>++++<-]>++.<++++++++++. 01:12:16 is autoconverted 14kb 01:13:03 but it outputs the same thing as the boolfuck=>xuml ULXULXULXXULXXULXULXXULXXULXXULXXULXXULXXULXULXXULXULXXULXULXULXXULXULXXULXXULXULXXULXULXULXXULXULXXULXXULXULXXULXXULXULXULXULXXULXXULXULXXULXULXULXXULXULXXULXXULXXULXULXULXULXULXULXULXXULXXULXULXXULXULXULXXULXXULXULXULXXULXXULXULXULXULXXULXXULXULXXULXULXXULXXULXULXXULXULXULXXULXULXULXXULXULXXULXXULXULXXULXULXULXXULXXULXULXXULXULXXULXXULXXULXULXULXULXXULXXULXULXULXXULXXULXXULX 01:13:29 the xuml handwritten version is even shorter 01:14:29 oh.. made some.. mistake in the autoconverter 01:14:34 kipple: Deterministic should indeed be the default, but one-dimensional is already the default 01:15:22 note that in http://www.esolangs.org/wiki/Esolang:Categorization there's not a category, meaning it's default 01:15:24 ah. that's what you've meant by not adding links for things like one-dimensional and Implemented? 01:15:34 yes 01:15:43 good 01:16:14 imperative and deterministic may be default too 01:16:21 btw, i don't think 2D langs should be a subcategory og multi-D langs 01:16:26 i think Implemented should be a category, though 01:16:37 who's going to want to search for Unimplemented languages? they're no fun 01:16:43 and there are a lot of them 01:16:54 and why not, kipple? makes sense to me 01:17:03 somebody looking for somehting to implement perhaps? 01:17:11 I don't see the benefit 01:17:18 maybe, but Implemented are generally more interesting, i think 01:17:24 agreed 01:17:45 do you see the drawback? i don't 01:18:07 multi-D-but-not-2D languages are special and can be easily found by looking in the base multi-D category 01:18:11 what's the problem with that? 01:18:12 I separated 2D and Multi = (3+)D, for the record 01:18:21 separated how? 01:18:23 just adds clutter to the multi-D page 01:18:36 no it doesn't, it only adds one category to that page 01:19:21 well, it's fine with me that way 01:19:24 well, true. lets keep it that way then 01:19:24 stuffing all the 2D langs on there would add more clutter 01:21:08 ok. I'm changing deterministic to default (removing category) 01:21:45 anybody disagree? 01:22:40 er 01:22:44 I was editing 01:23:05 ok. let me know when you're done then 01:24:42 done 01:26:36 btw, why is there an extra colon in the categories on that page? ( [[:Category:Nondeterministic]]) 01:27:02 because otherwise that page would also be added to the category 01:39:56 hmm, what counts as Implemented? 01:40:13 at least an implementation exists 01:40:15 what if only some features work, or the newest version of the spec isn't implemented, or the implementation is really buggy? 01:40:45 like, suppose the only Brainfuck interpreter supported +-<>., and [] support was "coming soon", implemented or no? 01:40:56 that's worth some notes in the text 01:41:12 I'd say implemented 01:41:29 me too, plus explain the situation in the text 01:41:33 fuzzy logic! 01:41:35 yes 01:45:36 do we need both Usability unknown and Unknown computational class? 01:46:02 well, Malbolge is Usability unknown and Finite state automata 01:47:15 hey! bitxtreme is a non-textual language, right? 01:47:41 isn't the source code binary? 01:48:08 true 01:48:52 well, now that category has at two languages! :D 01:49:00 Choon belongs there 01:49:07 oh wait, no it doesn't 01:49:13 source code only, right? 01:49:22 yeah 01:50:01 though it is a bit special 01:51:11 actually it's ascii 01:51:27 er, iso8859-1 01:51:30 I know. I was talking about the output 01:52:05 I'm talking about bitxtreme 01:52:07 there's no zero-dimensional category for NULL to go in? 01:52:28 I didn't think one single language would qualify for a category 01:52:50 I do! 01:53:00 then go ahead :) 01:53:33 hmm. so bitxtreme is text based after all? darn 01:54:05 someone needs to make a new zero-dimensional language somehow, i guess 01:54:09 How should we categorize language level? is low / high enough? 01:54:14 but it's not like such a thing is possible 01:54:24 Homespring and ZOMBIE would be "very high" 01:55:33 a scale then: turing tarpit - low - medium - high - high as a kite ;) 01:56:01 hm 01:56:15 well, i'm going to sleep, you have fun categorizing articles 01:56:26 and maybe you can add Qdeql to the wiki if you feel like it 01:56:30 good night 01:56:33 nite 01:56:34 -!- graue has quit ("Leaving"). 01:57:52 I'm not for categorizing language level 01:57:59 why not? 01:58:32 hm, on second thought maybe it helps looking for "powerful" languages 01:59:17 I think high/low should be enough 01:59:23 oh, var'aQ is not still there 01:59:34 or was it var'aq ? 01:59:50 * pgimeno adds a stub 02:00:13 I also think we should have a category for strongly metaphored languages (Chef, Shakespeare, ZOMBIE) 02:00:26 ugh 02:00:40 ZOMBIE looks pretty regular in my opinion 02:00:50 but yes, there are a few more 02:00:53 ok, perhaps not ZOMBIE 02:01:09 or maybe it should be called Themed languages 02:01:19 bf2xuml conversion is so baaad 02:01:32 boolfuck2xuml is ok 02:01:52 bad as in slow, or bad as in does not work? 02:02:10 bad as in output is very long 02:02:48 [-] auto-converted is a 500 byte XUML code 02:03:08 yuck 02:03:15 you need an optimizing compiler 02:03:28 yes 02:03:46 but the bad part is the bf2boolfuck 02:04:34 [-] is in boolfuck (not autoconverted) [+]>[+]>[+]>[+]>[+]>[+]>[+]>[+]> and autoconft to XUML LXMLXLXMLXLXMLXLXMLXLXMLXLXMLXLXMLXLXMLX 02:17:06 g'nite 02:19:58 -!- jix has quit ("Banned from network"). 02:25:38 -!- kipple has quit (Read error: 60 (Operation timed out)). 07:59:59 -!- clog has quit (ended). 08:00:00 -!- clog has joined. 09:20:44 -!- kipple has joined. 10:08:24 -!- puzzlet has quit (Read error: 104 (Connection reset by peer)). 10:27:39 -!- puzzlet has joined. 10:29:53 -!- puzzlet has quit (Client Quit). 10:29:57 -!- puzzlet has joined. 10:31:03 -!- puzzlet has quit (Client Quit). 10:31:06 -!- puzzlet has joined. 10:32:57 -!- CXI has quit ("If you're reading this, it's probably x-chat's fault."). 10:37:01 what client CXI was using? 10:37:54 -!- CXI has joined. 10:39:30 Xchat on WinDOS. 10:48:55 -!- sp3tt has joined. 11:01:10 -!- sp3tt_ has joined. 11:09:42 -!- sp3tt has quit (Read error: 60 (Operation timed out)). 11:29:46 -!- jix has joined. 11:34:26 moin 11:58:30 XUML parser done 12:33:58 XUML? 12:34:07 -!- J|x has joined. 12:34:21 -!- jix has quit (Nick collision from services.). 12:34:45 -!- J|x has changed nick to jix. 12:35:32 XUML interptreter done.. 12:38:41 What is XUML? 12:40:03 my tc language with only 4 instructions 12:40:08 X U M and L 12:40:48 and no other syntax elements (no () no [] no white-spaces no {}...) 12:43:44 moin 13:44:31 * pgimeno pages GregorR 13:50:53 wow autoconverted bf => XUML hello world is 12 kb 13:55:50 XLLLLMXXULXMMLXX is the first handwritten XUML program 13:56:04 an endless loop printing U:s 13:57:13 U = 01010101b 13:57:46 hehe 13:58:31 but xuml is little endian (because i want boolfuck => xuml conversion) so i need to start with a 1 13:58:33 handling bits one by one is awkward 13:58:50 but i don't need + and - just X 13:59:52 I'm only justifying the 12 Kb 14:03:31 not autoconverted it is much shorter 14:07:10 XLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLMXULXULXULXXUXUXXULXXUXXULXXUXXULXXUXXULXXUXXULXXUXXULXXUXXULXXUXUXXULXULXXUXXULXULXULXXUXUXXULXULXXUXXULXULXXUXXULXXUXXULXULXULXULXMMLXX 14:07:19 prints XUML\nXUML\nXUML\n.... 14:09:32 i'm in france next week. no internet.. no #esoteric :'( ;) 14:10:28 cu 14:10:31 -!- jix has quit ("Banned from network"). 14:34:48 -!- graue has joined. 14:36:21 hi graue 14:37:53 any clue of what kind of storage does [] use? 14:47:18 I mean [] a.k.a. Brackets 14:57:08 doesn't it say on the website? 14:59:13 it's too brief 15:02:42 does it have an interpreter or spec or anything? 15:03:40 yes 15:03:49 then that should tell you 15:03:50 interpreter 15:03:53 no spec 15:03:53 someone needs to add clunk: http://esoteric.sange.fi/essie2/download/clunk/ 15:11:20 interesting 15:11:24 reminds me of shrdlu 15:20:35 blagh, need to actually write this newsreader 15:23:26 woo, dodgy html parsing is a winner 15:28:31 Newsreader written in what? Brainfuck? 15:29:13 haha 15:29:18 worse, VB 15:32:33 graue: how do you rename a page? does it have to be deleted and the new one created? 15:40:09 http://esolangs.org/wiki/Special:Movepage 15:41:25 thanks 15:42:28 hum, then what? 15:43:26 "You have not specified a target page or user to perform this function on." 15:43:48 hmm 15:43:53 &target=pagename 15:44:57 it's a little silly - in theory there should be a link somewhere in the interface to do that 15:45:25 found it 15:45:54 it was not worth creating a redirection etc. 15:46:18 but now I don't know how to delete a page 15:49:28 you have to be an admin first 15:50:12 I'll leave that up to graue then (page: [[Category:Language]]) 15:51:25 CXI: you may be interested in this sed adder: http://www.formauri.es/personal/pgimeno/temp/addsed-r.txt 15:52:18 does your language work by replacing strings via regexps? 15:54:04 basically, yeah 15:54:59 nice, then it should be straightforward to adapt the adder to your language 15:55:35 well, it depends... :D 15:56:01 see, it actually stores the regexes in a list, goes through the list and rewinds every time it makes a replacement 15:56:46 oops, gtg, ttyl 15:56:52 alrighty, seeya 16:48:13 re 16:49:12 * CXI waves 16:49:15 does your lang admit \1, \2 etc.? 16:49:30 yeah... though it uses $1 $2 instead at the moment 16:49:37 I'll change it when I get around to cleaning up the code 16:49:45 k 16:50:23 right now I'm bashing away at this newsreader 16:51:43 when you say it rewinds, do you mean that it starts by the first RE of the list after each replacement? 16:51:53 yeah 16:52:32 think of it like a functional language with only one function :P 16:52:37 I don't think that's important then (for my adder) 16:53:53 what's the string's initial state? 16:54:04 is it user-given? 16:54:10 yeah 16:54:38 though incidentally you'd get stuck in a loop between s/2/11/ and s/11/2/ 16:55:01 what's the stop condition? 16:55:13 no patterns match :P 16:55:29 did I mention there's no /g flag? :P 16:55:38 yuck :) 16:56:18 still, it's easy to fix to adapt to these needs 17:04:47 G does what? 17:05:58 in a "s/regexp/replacement/g" sed statement, it replaces all occurences (as opposed to the first one when scanned from left to right) 17:07:13 Ah. 17:07:25 I want to read the 2P specs. 17:08:05 alright, I'll write one up quick-like 17:10:00 I was sorta putting it off because I wanted to know whether it could actually be useful 17:10:11 Thanks. 17:11:25 though keep in mind the interpreter won't actually match the spec until I fix it :P 17:13:02 useful as in "turing complete" or useful as in "easy to use"? I can tell you in advance that it's TC 17:13:13 ah, well then that's cool 17:13:16 -!- sp3tt_ has quit (Read error: 104 (Connection reset by peer)). 17:13:17 easy to use, hell no :P 17:13:29 hehe 17:14:24 you'd better specify which REs are admitted 17:14:36 if possible, don't restrict them to be Perl REs, please 17:14:44 I won't 17:15:08 *phew* 17:15:16 I'm thinking maybe gnu regex 17:15:28 is perl regex that different? 17:15:35 Posix REs would be good 17:15:50 POSIX EREs that is 17:16:01 well, there are quite a few extensions 17:16:27 the problem is supporting them in non-Perl interpreters 17:19:51 hmm 17:21:28 what are \1 \2 \3 called anyway? back-replacements? 17:22:37 back references IIRC 17:23:00 but only when used within a RE 17:23:04 yeah 17:23:20 i.e. not in the RHS 17:23:24 ah... 17:23:41 maybe sed has another name 17:23:55 eh, I'll just define them in the spec as back-references :P 17:25:29 "The replacement may contain the special character & to refer to that portion of the patter space which matched, and the special escapes \1 through \9 to refer to the corresponding matching sub-expressions in the regexp." (from the sed man page) 17:29:00 s/patter/pattern/ 17:29:38 -!- ChanServ has quit (Shutting Down). 17:31:37 -!- ChanServ has joined. 17:31:37 -!- irc.freenode.net has set channel mode: +o ChanServ. 17:42:42 heh, actually 17:42:52 it might not be possible to write a fair few things in it 17:43:04 if only because there's no way to distinguish what the user initially entered and what you're returning 17:43:35 as in, writing something to add the letter s to any inputted string 17:44:09 and /(.*)/(.*)s/ would just loop forever 17:44:12 er 17:44:22 I mean /(.*)/\1s/ 17:44:44 * CXI considers making the interpreter add '>' to the front of the input 17:49:57 hmm, but then you could never have a program that outputs a > 17:50:05 at the start of the output, anyway 17:51:28 you can escape the input string somehow at the start 17:52:53 e.g. s/\\/\\\\/g then s/^/\\i/ 17:55:54 but the problem is if the program was meant to output a string with \i at the start 17:56:53 then that'd be matched by the expression you used to check for ^\i and the program would loop infinitely 17:56:56 unescape it at the end; the regexps should then write \\i at the start instead of \i 17:57:24 -!- sp3tt has joined. 17:57:36 ah... hmm, yeah, that works 17:57:51 w00t, badge with brainfuck program on ordered :D 17:59:14 And also badges with a gnu, one that says "Proud filesharer", and of course one that says "How about a nice cup of stfu?". XD 17:59:28 heh, classy 17:59:33 what's the brainfuck program? 17:59:49 It prints "Your brain is fucked!" 18:00:00 that sounds like it'd be pretty long 18:00:40 Not with some clever multiplication... 18:00:42 ++++++++++[>+++++++++<-]>-.>++[<+++++++++++>-]<.++++++.---.>++++++++[<---------->-]<--.>++++++++[<++++++++>-]<++.>++[<++++++++>-]<.>++[<-------->-]<-.++++++++.+++++.>++++++++[<---------->-]<++.>++++++++[<+++++++++>-]<+.>++[<+++++>-]<.>++++++++[<---------->-]<---.>+++++++[<++++++++++>-]<.>+++[<+++++>-]<.>++[<--------->-]<.++++++++.------.-.>++++++++[<-------->-]<---. 18:00:57 Looks like this: http://www.knapp.nu/ShowBadge.aspx?id=2549463 18:01:32 yeah, not so bad, I guess 18:02:04 Should be here within 14 days :) 18:02:21 Ordered one with the firefox logo on too. 18:12:19 how about writing that in qdeql? 18:12:59 -!- graue has quit ("brb"). 18:17:15 qdegl? 18:26:26 -!- graue has joined. 18:27:59 puzzlet: around? 18:28:10 behind you 18:28:29 heh 18:29:15 just a note that in http://puzzlet.org/puzzlet/%EC%95%84%ED%9D%AC~Aheui in the links section there's a link redirecting to an "obsolete" page 18:29:29 ah, i forgot 18:29:45 even forgot to update those in Korean pages 18:31:10 * pgimeno wonders what each button will do in the JS interpreter 18:31:55 * puzzlet plans to make an extra frontend in English 18:32:41 that would be very nice for non-korean speaking people :) 18:34:39 to me it could say "press here to download and install Windows" without me noticing 18:35:48 which one? 18:35:59 any of the buttons 18:40:02 ah now i get it 18:41:42 * cpressey fears the wiki has gone category-crazy :) 18:42:04 what's the difference between {{Category:whatever}} and [[Category:whatever]] ? 18:42:10 the wiki goes wikipediastic 18:42:53 i'm not sure that {{Category:whatever}} is a valid syntax 18:42:56 {{}} is a template 18:42:59 [[]] is a link 18:43:04 oh, ok 18:43:07 thanks 18:43:07 so {{}} brings in the text from another article 18:43:12 np 18:43:18 ah, it will work that way 18:45:57 yeah, i think a lot of the categories are really bad ideas 18:46:31 in particular, low-level and high-level (how do you define that with respect to so many different programming styles?), and almost all of the other categories should be subcategories of "languages" 18:47:44 how does a subcategory help with respect to a category? 18:47:59 any there's going to need something like [[Category:Languages by storage types]] and so on 18:48:07 it means we don't have to put [[category:languages]] on practically every single page 18:48:38 graue: because the list will do the complete list of languages 18:48:52 wp has "article which should be a category" category... that way a topic can start life as an article, then eventually become a category when it's clear that it needs to be... maybe that model would work better than trying to categorize everything immediately 18:49:24 that's a good idea 18:51:19 I think that categories are a good way of getting an idea of what a language is like to start with 18:52:17 is it imperative? is it non-deterministic? etc. 18:53:14 of course that could belong to the description but using categories helps in making a cross-reference list at the same time 18:55:10 about the inclusion of most or all categories as subcategories of the Languages one, I don't know how to list e.g. all languages that way 18:57:11 -!- CXI has changed nick to coredumpage. 18:57:32 -!- coredumpage has changed nick to CXI. 19:02:02 for example, currently Turing tarpits is a subcategory of Turing complete, but you can't examine a list of all Turing-complete languages that includes Turing tarpits without entering each subcategory 19:02:39 is there a way around that? 19:03:24 [[List of Turing tarpits]]? 19:04:15 that would require manual editing of just another list 19:05:28 adding a language to a subcategory does not automatically add it to its parent category 19:11:04 so you can't examine a list of all Turing-complete languages that includes Turing tarpits without entering the subcategory 19:11:11 is it that hard to enter a subcategory? 19:11:30 that's not the problem 19:12:19 if all the current categories are subcategories of the Languages category, you can't have a list of Languages without entering every category 19:12:32 yes you can, by going to esolangs.org/wiki/Language_list 19:13:27 what's the use of that page which can't be done with a Languages category? 19:13:54 it doesn't require global modifications 19:14:03 for a category, you have to edit every page in the category 19:15:09 so what's a good non-esoteric high-level language i should learn? objective-c? java? ruby? erlang? 19:17:19 er... define "good" 19:18:07 you don't think any of those are good? 19:18:59 "good for what" is the question 19:19:16 java is quite more popular than the rest 19:19:44 but I don't know if popularity is meaningful for you 19:20:49 well, good for programming in 19:21:05 i don't care if it's buzzword-compliant or not, if that's what you mean 19:21:45 i don't want to do BOP in a strongly-hyped language 19:23:10 good speed-wise, ease-wise, self-explanatory-wise...? do you require it to be scriptable? have good string handling? etc. 19:25:20 what languages do you prefer? 19:25:23 graue: depends why you want to learn it (sort of like pgimeno said)... i can only say which non-eso languages i personally admire 19:25:26 erlang and lua 19:26:32 what's cool about erlang? 19:26:42 I quite like ruby 19:26:54 receiving messages based on patterns 19:27:09 at least, imo 19:27:34 is it (can it be) relatively fast? (not necessarily C-speed, but usable for some real-time stuff) 19:27:55 graue: it's billed as a "soft real-time" language (fwiw) 19:28:44 speed is, hmm, ok, in my experience... certainly acceptable for the things i use it for 19:28:53 it doesn't do so well on most shootouts though 19:29:02 although i'm not sure how much i trust the shootouts anyway 19:29:23 have you ever used Icon? 19:29:58 briefly. not for anything serious. i decided to go with lua instead, which has some similar features 19:30:28 icon was way ahead of its time... 19:32:16 i guess i'll study erlang in some more depth 19:32:44 *pitches in* give ruby a look too :P 19:33:18 what is the downside of ruby? 19:33:26 speed 19:33:34 it's so popular there must be a group of people who hate it 19:33:52 i'd like to hear from those people before spending much time on ruby, but it is interesting 19:34:14 heh, I'm not sure how easy it'd be to find any of those people 19:34:14 i'm not so big a fan of ruby, but i don't have any particular thing against it 19:34:46 I'm pretty quick to condemn a language, but I haven't been able to find much wrong with ruby at all 19:34:53 the syntax was a little strange at first 19:37:03 oh, erlang can load code into running systems, that's cool 19:48:01 graue: btw i suspect qdeql needs 2 queues 19:48:05 for TC 19:48:32 you have the problem (i think) of the length of the queue being unknown at any given point 19:49:04 so how do you (e.g.) know you've cycled through the entire thing if you e.g. want to get at a cell in the very middle 19:49:11 that's just a guess though 20:02:28 isn't that equivalent to the problem of the position of the tape pointer in brainfuck? 20:05:15 it seems to me that it should be possible to keep track of the length of the queue in a byte (or two, or three, or an unbounded number of bytes) that is kept accessible at all times 20:18:38 hmmm 20:19:17 i'm just not sure how you keep it accessible at all times 20:19:34 the tape in bf doesn't wrap around; you don't need to know the current length of it to navigate it 20:19:39 it seems like in a queue, you would 20:19:51 maybe if it was a deque 20:20:20 (then you could go "left" and "right" like in bf or a TM) 20:25:08 oh 20:25:09 hmm 20:25:11 my initial idea was a deque, someone in here said it could be done with just a queue 20:25:24 you might be right 20:28:36 maybe if you could test or subtract from the byte at the front of the queue without displacing it, something like that might make the difference? 20:28:41 it would certainly be easier to use 20:33:55 just write an UTM in it and you'll be sure it's TC :) (sorry, I was afk) 20:35:20 about the languages, I faced a similar decision some weeks ago and I decided to learn Python (not in your list though) 20:35:36 well, a seperate counter would clearly work, but is almost cheating (a FSA + 2 counters = TC, apparently) 20:40:19 cpressey: is there an specification of SQUISHY? 20:40:45 pgimeno: heh. um... the original? no. Squishy2K? yes, somewhere... 20:41:20 http://catseye.mine.nu:8080/projects/squishy2k/doc/squishy2k.txt 20:41:37 yeah, I was reading about Squishy2k 20:42:25 the original was more like thue-using-EBNF 20:42:30 but it was only an idea 20:42:40 I was wondering if it's worth creating a SQUISHY entry in the wiki, as the predecessor of Thue 20:43:15 i don't think so... it really wasn't that significiant 20:45:57 was Thue based on SQUISHY? 20:47:52 hey pgimeno, i tried to learn python before but i really found it confusing and counterintuitive 20:48:31 it seemed unclear what was or wasn't by reference, "deep copies" and "shallow copies" left my brain all fucked, so i stopped working on it 20:49:49 also, it seemed that there were exceptions for things that should be "compile-time" errors (e.g., the inconsistent indentation exception) so i was afraid i'd have to spend a lot of time fighting off silly exceptions, rather than solving the problem at hand 20:51:53 I haven't faced deep vs shallow, but for the indentation problem I guess it's a "well-formedness" checking feature but it's detected at "compile time" i.e. when the script is loaded and parsed into tokens 20:56:49 graue: you mean python fucked up your brain less that bf? 20:56:55 o.0 How's that possible? 20:57:03 More than bf* 21:08:01 there isn't a comparison there 21:09:29 as a language bf is very simple and easy to learn; i'm familiar with exactly how every one of its features works 21:10:01 in python, and this is a problem i've had trying to learn other high-level languages, the language is doing crazy stuff behind my back that i don't understand 21:10:23 pgimeno: no, thue was based on, ummm, a [semi-]thue grammar :) 21:10:40 -!- wooby has quit. 21:12:47 graue: yeah, you have a point there; but still, for quick'n'easy scripts (rather than big projects) I find it useful 21:13:54 cpressey: I asked because it's listed as the successor of SQUISHY in several places 21:16:20 hmm, i usually do quick'n'easy script type things in C 21:16:54 -!- CXI has quit (Connection timed out). 21:17:17 -!- wooby has joined. 21:19:40 pgimeno: hmm, well - not in any strong sense... the idea might have sparked the idea of having a minimal string-rewriting language 21:20:48 ok, thanks 21:22:46 -!- CXI has joined. 21:34:00 -!- graue has quit ("Leaving"). 21:37:42 -!- wooby has quit. 21:42:06 -!- sp3tt has quit ("Chatzilla 0.9.68a [Firefox 1.0.4/20050511]"). 21:54:21 -!- heatsink has joined. 22:03:38 Hey all 22:04:07 hi GregorR 22:04:24 How goes? 22:04:37 GregorR: is ORK based in Sorted! or SON-OF-UNBABTIZED? 22:04:53 No, I haven't even heard of them :P 22:05:03 oh ok :) 22:05:29 is it based on something at all? 22:06:17 Nope 22:07:29 so, where do you draw the line between "based on" and "inspired by"? 22:08:07 Well, the fact that I hadn't heard of either of those makes it pretty unlikely that it was "inspired by" :P 22:08:35 yeah, I was talking in general, regarding categorizing in the wiki :) 22:08:56 Well, lesse ... 22:09:04 C++ is based on C, but Java is only inspired by C++. 22:09:25 Because while C++ borrows the majority (actually, all) of C's syntax, Java does not borrow the majority of C++'s syntax. 22:09:32 However, "the majority" is not a razor-sharp line. 22:09:41 Plus, it does 8-D 22:10:51 -!- wooby has joined. 22:15:22 -!- lindi- has quit (Read error: 54 (Connection reset by peer)). 22:19:14 -!- lindi- has joined. 22:36:48 -!- wooby has quit. 22:41:45 lament: do you have a link to your Smallfuck-to-SMETANA compiler? Googling for "smallfuck" is, uh... unproductive 22:44:22 smetana? Like the those who do not learn from the past are condemned to repeat it person? 22:45:05 well, it was originally Smetana like the composer, but I'm open to other interpretations :) 22:46:36 "The Bartered Bride" is probably what he's most known for 22:47:52 Moldau is one of my favorite classical pieces 22:48:41 google claims that the guy who said that quote was named George Santayana, btw. (but google claims a lot of things...) 22:54:19 oh yeah 22:54:31 yea, I like moldau vltava too 22:55:08 that's probably why I rmembered the name. 23:10:36 hum, an algorithm written in Chef having bugs must be quite disgusting 23:11:32 isn't that true for most esolangs? 23:12:29 well, imagine a Fibonacci Numbers with Caramel Sauce with bugs X-P 23:15:48 well, the perl implementation doesn't make it easier with it's uninformative error messages :) 23:19:51 just imagine one of these in the caramel sauce: http://images.google.com/images?q=bugs 23:20:29 haha 23:20:32 (though some would be actually interesting) 23:20:42 well, some of them would be kind of kinky ;) 23:42:28 fwiw, I could argue that the 3 queues in the NULL language mean it's not *really* zero-dimensional... 23:42:55 doesn't the dimensional aspect refer to the code, not the data structures? 23:43:19 well, ok. it could have 0-dimensional code 23:44:16 but we should probably have a separate queue-based category. 23:48:11 categorization of esolangs is like counting the number of colours in the rainbow 23:48:51 btw kipple, i added an outline of a proof of turing-completeness to the kipple page 23:49:01 I saw it. nice 23:50:59 I'm not very familiar with theory of computation, so I wouldn't know how to write such things. 23:51:04 I consider the brainfuck interpreter proof enough 23:53:09 cpressey: I was looking for such a way of classifying the languages like this. I was using my bookmarks but it was not enough. The categories that characterize each language are IMO very valuable. 23:55:39 kipple: oh, there's a bf interpreter written in kipple? i wasn't aware... yeah, that's excellent proof too, i'll note it 23:56:03 IIRC it was the second program ever written in kipple :) 23:56:21 http://rune.krokodille.com/lang/kipple/samples/bfi.k 23:57:00 pgimeno: well, what i mean is, once you have a category established, one of the most valuable new esoteric languages that can be designed, is one that defies classification under that category :) 23:59:48 well, yeah but still I think it's good to have them 2005-06-06: 00:00:00 me too 00:01:20 heh. Befunge is now in 9 categories..... 00:08:05 it's very categorical 00:20:24 isn't TMMLPTEALPAITAFNFAL a joke language? 00:21:06 (as in "totally unusable except as a joke") 00:21:12 no idea 00:21:39 ah, that one. 00:22:36 well, it is probably turing-complete... though perhaps not always :) 00:23:51 if it is turing complete all days, is it turing complete? 00:24:04 * kipple doesn't like the idea of separating joke languages from the rest 00:24:14 me neither 00:32:22 nite all 00:33:41 nite 03:16:17 -!- heatsink has quit ("Leaving"). 03:21:15 pgimeno, how about like listing all turing-complete languages on [[Turing-complete]]? 03:24:49 -!- kipple has quit (Read error: 60 (Operation timed out)). 05:43:04 -!- malaprop has quit ("sleep"). 07:05:20 -!- graue has joined. 07:05:43 do SMITH and Muriel count as self-modifying? 07:20:23 cpressey: hey 07:20:40 cpressey: do you want it? 07:34:52 god 07:35:10 on [[Turing complete]], smallfuck is mentioned as a minimal example of turing-complete language 07:43:54 it is 07:44:24 well no 07:44:47 i should probably explicitly state somewhere that smallfuck implementations must have a memory size limit 07:44:56 or, change my mind and allow them to be infinite. 07:46:29 probably the latter. 07:54:15 what the hell haha 07:54:16 i read through all the mailing list discussion on the subject and don't remember seeing that 07:54:16 http://esoteric.voxelperfect.net/wiki/Ale 07:54:46 "stupid" is the term the author uses (see link) 07:55:02 i just wanted to make a page so someone could flesh it out later 07:55:15 we need a logo 07:55:25 or is that flower thing a logo 07:55:27 we need a PD Piet program to use as a logo 07:55:34 the flower thing is the mediawiki logo, so it sucks 07:55:35 PD? 07:55:40 public domain 07:55:42 ahh 07:55:55 also it should do something cool 07:56:01 yes 07:57:01 with a proper command set, a language with only one bignum should be TC 07:57:03 that would be cool 07:57:20 no 07:57:21 i mean 07:57:23 not necessarily 07:57:29 that language could simply be Brainfuck 07:57:38 and that's not cool at all 07:57:40 no it couldn't 07:57:51 it would operate on the digits of the bignum :) 07:57:51 [ only knows "0 or not-zero" 07:58:02 then it could be, yes 07:58:06 exactly 07:58:28 do you know of a graphics editor that'd be good for piet? 07:58:32 no 07:59:07 in fact, if you write one, release it as free software, because i don't know of any decent bitmap editors for working with pixels 07:59:54 hm 07:59:59 -!- clog has quit (ended). 08:00:00 -!- clog has joined. 08:03:53 the only interpreter is in perl!? awww 08:05:30 you lack perl? 08:05:38 i hate perl 08:05:39 oh 08:05:40 cool 08:05:44 there's a txt2gif converter 08:05:48 excellent 08:05:49 http://www.majcher.com/code/piet/ 08:05:56 (a piet-specific one) 08:06:54 and i can't download it, it's 403 08:07:29 does the wayback machine possibly have a copy from before it became 403'd? 08:08:09 oh, okay, it's part of the release 08:08:10 great 08:08:19 http://www.majcher.com/code/piet/Releases/Piet-Interpreter-0.03.tar.gz 08:09:16 cool 08:09:46 so what would a logo program do? 08:10:54 something that it can do while looking nice 08:11:08 the fibonacci program on the piet website looks nice i think 08:12:11 you think we can get some copyright renunciation out of the guy? 08:12:38 seems likeley 08:12:43 hm 08:12:56 why does it have to be public domain anyway? 08:14:35 because there's a blanket statement that anything on the wiki is, just to avoid complicating things 08:15:20 i guess you could say the logo is not content, but if it's an esolang program, people might think otherwise 08:15:21 you think it'd make a good logo? 08:15:23 http://www.dangermouse.net/esoteric/fibbig.gif 08:15:30 it would work 08:16:00 it's just the right size 08:16:52 i can email the guy 08:18:05 sure, go ahead 08:18:43 graue: why not use 3-clause BSD license or MIT license? 08:19:15 graue: those at least state that there is no warranty 08:23:06 those licenses don't solve the problem of you having to acknowledge, "Parts copyright (c) 2004 'Bob1233'. Parts copyright (c) 2005 'Graue', Parts copyright (c) 2005 '68.133.119.11'" etc for every nontrivial page 08:23:14 i'll add something stating that there is no warranty 08:29:14 okay, i sent the guy an email 08:31:31 by the way, what was it you found, again, about a language with a single queue being TC? 08:32:19 i made such a language (http://www.oceanbase.org/graue/qdeql/) and implied that it was TC, and cpressey is not convinced 08:33:30 i have never found nor said anything about that 08:33:47 all i did was ask you if it was really TC 08:33:53 cause i'm not convinced either 08:36:37 damn, am i confusing you with someone else in this channel? 08:36:45 someone said that 08:37:21 i guess you are 08:43:37 how stupid of me 09:03:24 man, piet is a cool idea but too painful 09:03:32 i don't feel like installing perl modules :( 09:04:04 maybe you can pay someone $50 an hour to convert it to ruby then 09:04:35 graue: how does wikipedia handle this? 09:05:12 it doesn't 09:05:39 i imagine that wikipedia itself is violating the FDL immensely just by continuing to exist 09:05:49 graue: but the ruby version would also require the same module 09:05:57 lament: convert the code in the module 09:06:14 the module is on the Sylvain guy's site 09:07:05 graue: the module is ImageMagick and isn't in Perl at all... 09:07:19 i'm just lazy, really 09:10:10 oh 09:10:40 and cheap, too 09:10:44 you know what would be awesome 09:10:50 a language that uses musical notation 09:10:57 any exist? 09:11:02 heh, yeah, that would be great 09:11:05 not to my knowledge 09:12:08 choon does'nt even come close 09:14:37 i'd be interested in a language that used natural language to control it, but in a totally unnatural way, so that any grammatically correct english sentence was a program 09:15:06 there's a research project it could be built on that analyzes sentences, "link grammar" or something like that, it's called 09:21:05 ok that's it i'm designing a music-based language 09:21:12 it's gonna be the best ever 09:22:07 programs will be polyphonic compositions in the style of Bach. 09:36:12 does atonal music crash? 09:36:35 okay, make that "potentially in the style of bach" :) 09:36:51 but they'll be polyphonic 09:37:14 that's a must, and i'm trying to figure out how to make that into a useful programming paradigm 09:37:48 is it too obvious to make each voice a thread? 09:38:08 well yeah 09:38:19 but what to do with that later? 09:38:25 there must be some incentive to use more than one thread 09:38:47 to use 2 to 4 threads at most times 09:38:53 so now your challenge is "design language that is useful for computation if, and only if, multiple threads are used" 09:39:02 the music part is solved 09:40:04 pretty much. 09:40:30 they don't have to be threads though 09:40:43 i was thinking of having some sort of assembly 09:40:47 how about if the only program state is based on which thread is running what code right now? 09:40:55 where one voice is an operation 09:41:02 and other voices are parameters 09:41:17 can that produce good music? 09:41:35 don't see why not 09:42:07 do you plan to use the tonal system? 09:42:11 but it's against the nature of polyphony to designate one thread as special 09:42:21 i.e. have one "melody" aka "operation" thread 09:42:33 yes 09:43:02 yeah, tonal system or something like that 09:43:12 fugue programming language! 09:43:13 intervals are significant rather than notes 09:43:15 puzzlet: yes 09:43:55 make enough room for expression, i.e. major and minor third in any direction is the same instruction 09:43:55 naturally i'll have to answer your language with a twelve-tone programming language 09:44:11 so i guess no, no tonal system :) 09:44:35 if you have a concept of major and minor third you are using the tonal system 09:44:54 not really 09:44:57 tonal system is like, you have major or minor. 09:45:09 not really, since they're always measured from the current note 09:45:10 the opposite of atonal system 09:45:17 there's no tonal center 09:45:43 i'm just saying, "up 3 steps or up 4 steps is the same instruction" 09:45:52 but it's based on intervals, and that is the tonal system 09:46:05 not exactly. 09:46:20 atonal system is based on intervals indeed 09:46:29 i mean either 09:47:28 the tonal system is based on interval content, whereas, for contrast, the twelve-tone system is based on interval order 09:47:53 i can't comment on the atonal system, but it would not be possible to meaningfully use the twelve-tone system in this language 09:48:05 i don't get it 09:49:18 well, that's okay 09:49:24 i don't mind programming in the tonal system 09:49:41 but the reason i'm not getting it is because you're not making any sense! 09:50:53 the reason i am ceasing my argument is because i don't believe i can explain it effectively! 09:50:57 okay 09:51:50 in the twelve-tone system, you take all 12 notes of the chromatic scale, shuffle them into a random permutation, and then add registral details by assigning them to different octaves and such 09:52:01 it's based on all twelve tones being there all the time, more or less 09:52:05 no that's serial music 09:52:26 are we calling the same thing two different names? 09:52:39 what i described exists and is called twelve-tone music 09:53:14 but calling every music other than twelve-tone music "tonal" is wrong 09:53:59 tonal music is based on tonality, the major chord. 09:54:37 and i belive that other side of the music is called "atonal", which twelve-tone music is part of 09:56:36 atonal music is actually a subset of the intersection of tonal and twelve-tone music, according to noted composer Charles Wuorinen, whose book i have just consulted on the subject 09:56:36 and beside that, atonal music includes other mechanisms like whole-tone scale music 09:57:17 Wuorinen sees "tonal" as part of "diatonic" and "12-tone" as part of "chromatic" 09:57:27 so perhaps this esolang idea is based on diatonic music, then 09:57:51 -!- sp3tt has joined. 09:58:09 -!- sp3tt has quit (Client Quit). 09:58:16 -!- sp3tt has joined. 09:58:43 diatonic music is based on scale 09:59:22 graue: no 09:59:31 it is based on chromatic 09:59:37 but the idea of melody moving by interval is free from any scale, and not falls in 12-tone 09:59:41 also. 10:00:03 yeah, it's just chromatic 10:00:09 but the programmer is free to make it as tonal as he likes 10:00:42 in particular, whatever the other instructions are 10:00:44 becuase he/she can choose from major and minor 3rd interval 10:00:58 , for example. 10:01:01 i have decided to make major/minor second a "skip the next interval" instruction 10:01:41 (an instruction like that is necessary so the voice stays within some reasonable frequency range) 10:01:45 lament: do going-up and going-down indicate different instructions? 10:01:51 no, don't think so 10:02:01 good 10:02:06 which leaves room for very few instructions really 10:02:35 but that's ok since they'll have arguments 10:03:07 you say a skip the next interval instruction, how about skipping the next n intervals? 10:03:22 that's too much 10:03:26 why? 10:03:36 just make the next interval (after the skipped one) again a second 10:03:48 you can write a lot with that 10:03:56 (i just tried :)) 10:04:09 lament: how do you plan about note duration? 10:04:14 not meaningful 10:04:38 (otherwise it will be practically impossible to make it sound good) 10:06:08 dunno what storage model could work 10:06:17 perhaps each voice has its own memory or something 10:06:32 a stack... 10:11:13 what, the parameters have memory different from the operation's memory? 10:11:39 i have no clue 10:12:39 anyway good night 10:14:33 good night 10:14:35 good night 10:16:33 -!- graue has quit ("Leaving"). 10:35:06 moin 10:35:21 we need a PD Piet program to use as a logo 10:35:56 I used the hello.png Piet program with permission from the author; he was very happy that it was used for something 10:36:49 (used in ) 10:37:18 do you know of a graphics editor that'd be good for piet? 10:37:37 maybe npiet works: http://www.bertnase.de/npiet/ 10:38:57 by the way, what was it you found, again, about a language with a single queue being TC? 10:40:25 fizzie gave this link: http://jackson.cs.miami.edu/~burt/papers/1993.1/Saq-JAIIO-2.ps 10:53:45 i got http://puzzlet.org/html/jsaheui_en.html done 10:54:58 cool 10:57:28 now I know what button to press, thanks :) 10:58:22 my pleasure 11:07:10 I find it still a bit hard to use 11:07:27 especially since I can't type Hangul 11:11:51 what was the link to the language description, again? 11:14:27 -!- puzzlet_ has joined. 11:19:00 well, all I could try is Hello, world 11:23:05 what os do you use? 11:23:25 windows in this case 11:24:57 can you configure to use Korean input system? 11:25:27 -!- puzzlet has quit (Read error: 110 (Connection timed out)). 11:25:34 -!- puzzlet_ has changed nick to puzzlet. 11:26:46 -!- DMM has joined. 11:26:49 there are external Hangul input system like saenaru and ngs, but i'm worrying either of them haven't been translated into English.. 11:26:56 I'm afraid not, and even if I can, I'm afraid of doing it and not being able to return to normal 11:27:04 evening all 11:27:18 evening? familiar timezone :) 11:27:22 hi 11:27:28 Sydney :-) 11:27:33 South Korea 11:27:58 I just got an email about the esolang wiki... 11:28:25 if you use X window system, i recommend to use nabi. 11:28:25 http://nabi.kldp.net/ 11:28:25 as the Hangul input system 11:28:25 yup, lament sent it if I'm right 11:29:18 gotta go for a dinner 11:30:22 DMM: thanks for your permission to use the hellobig.png as a logo, btw 11:30:30 s/logo/image/ 11:30:59 wow, I'm still writing my reply granting permission... :-) 11:31:34 sorry, I mean here: http://www.formauri.es/personal/pgimeno/compurec/EsotericLanguages.png 11:31:42 that was quite a while ago 11:31:44 oh! right :-) 11:31:51 argh 11:31:58 http://www.formauri.es/personal/pgimeno/compurec/EsotericLanguages.php 11:36:08 by the way, I have abused the idea on your BIT language and made up Bitxtreme: http://www.formauri.es/personal/pgimeno/prog/esoteric/Bitxtreme.php 11:36:20 oooh 11:37:54 rofl... I like the file extension 11:38:49 actually it's a joke language to ironize about the lack of space for writing complex programs in some space-limited languages, especially Malbolge 11:39:48 heh... that's great. I like the fact you zip all four sample programs for convenience... 11:40:31 :) 11:42:52 does zip really make a 562 byte file out of those? 11:43:31 that's what it did when I compressed them 11:44:25 cool 11:49:22 btw, I'm not sure if you're aware that there's been a recent incorporation of 99bob in Chef to de 99bob page 11:49:25 s/de/the/ 11:51:24 I heard from the guy who was writing it, didn't know he'd finished 11:53:34 there are two versions actually by two different people who submitted them independently and within a few hours 11:55:50 wow, that's a nice program :-) 11:57:48 the sous-chef one 12:04:28 * DMM heads off... getting late here 12:05:12 -!- DMM has left (?). 12:16:07 Noooo... I missed David Morgan-Mar :( 12:20:15 I'm sorry, sp3tt 12:20:38 Stupid lunch... 12:23:46 I wonder what the most complex program written in shakespeare is... 12:56:19 -!- kipple has joined. 13:07:15 back. 13:07:32 maybe i could provide a graphical Hangul input system for that interpreter... 14:13:58 While totally unrelated to esoteric programming, to me this is exciting, so I shall scream it out... I IMPLEMENTED ENCRYPTION INTO DIRECTNET!!!! YAAAAAAAAAAAAAAAAY! 14:14:50 what is directnet? what encryption? 14:45:52 I answered myself about directnet. 15:07:11 so, what's the status of the logo? 15:08:43 I played a bit with paint shop pro, and a some spoofs of the MediaWiki logo 15:08:49 http://rune.krokodille.com/lang/esologo1.png 15:08:56 http://rune.krokodille.com/lang/esologo2.png 15:08:59 -!- malaprop has joined. 15:09:23 the MediaWiki logo: http://esoteric.voxelperfect.net/w/skins/common/images/wiki.png 15:11:57 argh. "made some spoofs", i meant to say 15:16:46 kipple: apparently DMM replied to lament by email 15:17:51 I like esologo2.png more 15:19:33 put them all on one page: file://slartibartfast/rune/www/lang/logos.html 15:21:09 I like the idea of using a Piet program, but the ones I've seen so far are a bit ugly, IMHO 15:21:18 er, check that last URL :) 15:21:32 ha. sorry 15:22:00 http://rune.krokodille.com/lang/logos.html 15:22:08 added two more 15:26:51 I still like the last one more than the rest 15:27:37 * kipple is reading the Piet spec... 15:29:50 seen the npiet link I've given above? 15:30:05 no 15:30:36 http://www.bertnase.de/npiet/ 15:31:21 it comes with a tcl/tk editor 15:31:51 nice :) 15:34:03 nice code gallery on that page too 15:35:07 yup 17:07:41 -!- sp3tt has quit ("Chatzilla 0.9.68a [Firefox 1.0.4/20050511]"). 17:08:28 -!- sp3tt has joined. 17:14:48 -!- comet_11 has joined. 17:15:31 -!- CXI has quit (Read error: 104 (Connection reset by peer)). 19:15:38 hola 19:17:44 hola 19:19:23 здравÑ�твулте! (or so says Babelfish) 19:19:36 so yeah, DMM replied to me as i'm sure you're aware 19:19:58 pgimeno: that's strange, it's fine but one letter is misspelled 19:20:13 oh 19:20:13 can't be a grammar-based typo either 19:20:26 probably wrong dict or something 19:20:54 the program i asked DMM about to use is a logo isn't helloworld btw 19:20:59 it's the fibonacci one 19:21:11 but the npiet page says the program is broken... 19:21:43 I didn't notice that 19:21:58 http://www.bertnase.de/npiet/picture.html 19:23:02 oh, I see 19:23:20 I'm not sure what that means exactly 19:23:32 me neither 19:24:01 it seems npiet and piet reference implementation don't interpret the piet specification the same way 19:26:36 indeed that's noted and there's an example with the differences 19:27:23 (at the bottom of the page you've given) 19:28:01 quite 19:31:55 in malbolge, the discrepancies between the spec and the interpreter were resolved in favor of the interpreter 19:45:05 hm, has anybody looked at Aura? 19:46:43 it seems that all that exists is an undocumented interpreter 19:51:33 lament: yes please 19:51:40 (now i need to catch up on this log) 19:52:51 c 19:54:58 graue: re: do SMITH and Muriel count as self-modifying? ... in a loose sense, I'd say say... yes... but the sense is very loose (Muriel program need to make modified copies of themselves to do interesting stuff, and SMITH only really needs to append to itself, not (strictly) modify... 19:56:19 re one bignum... my understanding is an FSA + two counters (bignums) is TC. 19:56:41 (so maybe a rational bignum...?) 20:03:09 okay 20:03:19 http://z3.ca/~lament/smetana_sf.tar.gz 20:04:27 aura seems interesting 20:04:34 i wonder if it can possibly be useful 20:10:27 lament: ty 20:11:16 yay! 20:11:33 lament: it's in my to-look list 20:13:59 -!- sp3tt has quit ("Chatzilla 0.9.68a [Firefox 1.0.4/20050511]"). 20:14:42 -lilo/Wallops- Hmmm, check the links on ftp://ftp.debian.org/debian/dists , perhaps congratulations are in order! 20:15:01 apparently Sarge is finally out 20:16:30 if it is, it's insanely hard to program 20:16:35 but i don't think so 20:17:00 the interpreter is a pain to read 20:17:16 it's pretty simple 20:17:51 instructions are taken by character mod 8, if I understand it correctly 20:17:55 yes 20:19:55 * pgimeno hates programs made up of just one-letter vars 20:20:37 * lament goes away 20:20:53 later 21:44:20 From:Lode Vandevenne 21:44:22 The university page will indeed be gone in a few years, too bad, it's such 21:44:22 handy free webspace. 21:44:22 Feel free to host a copy of it for preservation. Normally I'll also have my 21:44:22 own webspace one day, but not yet, so it's a good idea to make a copy. 21:44:46 * pgimeno commits his page into the svn repos 21:45:15 (Lode Vandevenne is the author of gammaplex) 22:01:33 -!- comet_11 has changed nick to CXI. 22:47:04 -!- graue has joined. 22:48:14 new db backup at http://esoteric.voxelperfect.net/db/esolang-050606.sql.bz2 22:49:07 graue: Ah, been wanting to ask you. What's the schedule for those? Daily or weekly? And for the files repos? 22:50:23 graue: nice 22:50:31 the schedule is whenever i make them 22:50:37 about the files, what was the update frequency? 22:51:13 I thought the point of this scheme was to eliminate the possibility of losing everything because someone loses interest? How about a cron job instead? 22:51:44 malaprop: I was just about to say that ;) 22:52:16 We create this thing so that it can sort of automatically back itself up, and now we're relying on humans? No offense graue, but you are human. 22:52:54 well, i'm insulted! 22:53:11 And for dates, YYYYMMDD has the benefit of being ISO and common. 22:53:35 graue: PATHETIC FLESH-BAG!!! 22:53:41 :P 22:53:45 -!- lindi- has quit (Read error: 113 (No route to host)). 22:56:01 graue: Would you like a hand setting up cron jobs? 22:59:26 no thanks, i can do it 22:59:54 i'm trying to figure out how to allow anonymous svn read access so you can back up the files repo 23:01:24 Having svn read access does not allow you to recreate the repository, you'll need to take an 'svnadmin dump'. 23:02:38 I don't think that history is needed 23:03:08 If it's in svn, I want the history. I know someone will definitely end up using it. 23:04:03 well, I think it's svn just because it can't be ftp, so it's svn used as ftp 23:04:43 pgimeno: I know. But since it's in version control, it's just a matter of time until someone uses versioning. 23:05:26 maybe, but I hope not... 23:06:03 pgimeno: It'll probably happen about a day after the first person who wasn't here for the planning discussion is given access. 23:07:54 Gotta run, can pick up the discussion in ~2.5h. 23:08:07 later malaprop 23:16:23 -!- lindi- has joined. 23:22:48 the history isn 23:22:50 't needed 23:28:54 graue: I commited some files a while ago; when are they expected to show up? 23:30:00 a while ago = 1.5 h ago 23:30:29 they are expected to show up within 6.5 hours then 23:30:46 k 23:31:44 about the svn: how do I get access? anonymous read access would be nice, but I'd like write access... 23:33:15 is there a generic user account for this project, or do we get personal? 23:36:03 it's personal 23:39:28 kipple: read my private message 23:39:50 sorry. not paying attention... ;) 23:49:55 anyone should now be able to "svn co http://esoteric.voxelperfect.net/svn/esofiles/" and get everything 23:51:31 works nice :) 23:52:04 cool! 23:53:12 indeed it's accessible via browser: http://www.esolangs.org/svn/esofiles/ 23:53:37 very cool indeed 23:53:48 but if you open an HTML file it shows the source, and that doesn't have dates, filesizes... 23:54:30 yeah 23:54:32 cpressey, want an account for writing with? 23:56:32 graue: sure 23:57:05 question: do I have to set file permissions for files I add, or does svn take care of that? 23:59:04 svn doesn't handle permissions, just executable 23:59:04 hmm. I ran svn commit but nothing seem to happen.. 23:59:24 ok, so I have to set read access to all on every file I add? 23:59:29 first try svn status and see what you have 2005-06-07: 00:00:33 read access? nope, it doesn't handle permissions; files are files and must be readable by your client, that's all 00:00:34 ? esoarchive/kipple/src 00:00:34 ? esoarchive/kipple/impl/kipple1.01.zip 00:00:54 (that was from svn status) 00:00:56 do you want to add the whole src/ tree with all of its contents? 00:01:35 i just want to commit the files I added... 00:01:46 you haven't added the files yet :) 00:02:20 * pgimeno sends pm to kipple for a primer on handling svn 00:04:05 you need to use "svn add whateverfilename" on new files, and "svn mkdir someplace" to make new directories 00:05:23 I have got it now 00:05:44 though I made the directory through Samba, not svn... 00:07:11 yeah, it works if it already exists and you svn add it 00:07:27 basically that's what svn mkdir does: it creates the dir and adds it 00:08:32 thanks for the help. added some kipple just to test it 00:09:06 just be sure to update before you commit 00:09:30 oops. I have to do that as well? 00:10:14 it will avoid future problems (when overwriting files that are not up to date) 00:12:21 and please use a meaningful commit message when possible (for example: added Kipple implementation) 00:12:54 btw, i've just created a new esolang (first one in a couple of years) 00:13:02 http://catseye.webhop.net/projects/beturing/ 00:13:25 cool 00:13:46 2d tape! haha. that's cool 00:13:47 nice! 00:14:10 2D tape? that reminds me of the turmites 00:15:21 ah yeah.. i dimly remember a "turmite" program from my Amiga days... 00:16:33 http://mathworld.wolfram.com/Turmite.html 00:16:34 cool 00:17:56 yeah 00:17:59 wow 00:24:08 what's the wire crossing problem? 00:24:58 does it have any resemblance to the problem of crossing wires in wireworld? 00:30:03 the wire-crossing problem is (very informally) that languages like Befunge seem to need an "#" operator, or some other operator that can jump over things. 00:30:24 otherwise your paths of execution can't cross, and you can't write some interesting programs 00:30:27 (this is all conjecture) 00:30:38 kind of like light cycles in Tron, maybe...? :) 00:31:01 i've been googling for related stuff in the past few minutes, and i found this 00:31:03 http://planetmath.org/?op=getobj&from=objects&name=PlanarGraph 00:31:04 that's why you should use 3d ;) 00:31:35 there's no problem in 3d, so what's the fun in that? :) 00:32:06 does there exist a language where you write code in 3d? 00:33:24 graph theory is fun 00:33:48 kipple, Trefunge 00:34:13 so, what kind of file format does it use? 00:36:30 text files 00:36:40 with directives that say "advance the Z dimension" 00:36:56 i don't think it's ever been implemented... maybe it has 00:37:14 it uses a single 2d text file? 00:38:09 heh 00:38:22 exarkun was working on a 3d befunge 00:38:29 somebody else has also made one 00:38:39 theres one in basic somewhere i think 00:38:48 with graphical representation 00:39:01 kipple: yes 00:39:14 befungeGL? something like that 00:39:37 glfunge 00:39:45 then it's not what I was talking about. I meant where you WRITE code in 3 dimensions (as opposed to a 2d text file) 00:39:57 I think that somebody (not me 8-D) needs to make a 2D programming language that is NOT esoteric. 00:40:13 I don't know how, I think that for one you'd have to use a spreadsheet to edit it non-esoterically. 00:41:48 kipple, make a program that edits trefunge in 3D and saves source code in a text file 00:41:57 it's just a matter of representation 00:42:25 kipple: you're talking about editors, not languages, then? 00:42:31 cpressey: how do you like my smallfuck stuff :) 00:42:53 cpressy. languages 00:43:15 where the source code is 3 dimensional 00:43:37 lament: it's quite impressive, especially the compiled output ;) 00:43:42 kipple: you have to store the source code SOMEHOW 00:43:47 sure 00:43:52 kipple: in 1'dimensional memory 00:44:08 one way could be to use multiple text files per program 00:44:22 well, text files are technically 1d, no? 00:44:35 newlines are a convention that says "increment the y dimension" 00:44:36 well, ok... 00:44:49 funge just has another convention, there are lines that say "incrememnt the z dimension" 00:44:55 ok 00:45:15 http://www.di.fc.ul.pt/~jpn/gv/4dttt.htm - is this a 2D game just because the playfield is shown in 2D? 00:46:16 anyway, thunderstorms are here so i'm going to save my computer, brb later 00:46:17 -!- graue has quit ("Leaving"). 00:47:25 cool 00:47:30 thunderstorms 00:48:08 are cool 00:48:16 i think im finished with my music language 00:48:28 im just trying to figure out if it's any fun or not 00:48:28 -!- wooby has joined. 00:53:40 now I get what the wire crossing problem is 00:55:13 my brain was stuck thinking turmite-wise, that the state was internal to the machine rater than given by the position of the code head 00:55:45 GregorR: http://atlas.usafa.af.mil/dfcs/bios/mcc_html/raptor.html ... ? :) 00:57:25 pgimeno: hmm.. well, it's not like a turmite (not even much like befunge.) the only state (besides the contents of the playfield) is the positions of the code head and the data head 00:57:49 but the wire-crossing problem shows up in other places too, i'm sure (and they may be better places to study it) 00:57:59 like wierd, probably REVERSE 00:58:03 probably wireworld 00:58:21 except i don;t think wireworld is TC 00:58:30 no? 00:58:30 unless there have been advances since i played with it last 00:58:42 I thought it was crystal clear 00:59:04 wireworld can cope with wire crossing by using four xor gates 00:59:17 hm 00:59:20 it's been a while 00:59:22 I have designed a wire crossing with wireworld 00:59:51 yeah, they definately exist 00:59:52 http://karl.kiwi.gen.nz/CA-Wireworld.html#WW-4 01:00:32 i guess it is TC, if you can make a clock, logic gates, and registers 01:00:46 errrm 01:00:54 sans infinite tape. 01:02:29 damn 01:02:30 :) 01:08:40 kipple: there is also this: http://ryujin.kuis.kyoto-u.ac.jp/ylab/yamakaku/Visulan/ 01:08:50 (site can be VERY slow.) 01:08:56 i don't remember how it's edited, though. 01:09:10 nice example of a rewriting language, regardless 01:10:00 cpressey: btw, I havent' managed to use ALPACA (perl problems) 01:11:35 my knowledge of perl is null 01:12:39 can you run it without problems? 01:12:40 cpressey: looks interesting :) 01:13:55 pgimeno: um... i haven't tried in a while. i'll look at it in a bit. 01:14:19 i'm actually wondering if wireworld's unlimited space counts as "tape" or 01:14:22 not 01:14:45 you can make wireworld forms as big as you like... but you can make fsm's as big as you like too 01:14:49 that's about the same question as if unlimited size in smetana counts as tape or not 01:14:55 wireworld forms can't grow 01:15:03 I know 01:15:06 nor can smetana programs or beta-juliet programs 01:15:32 life, otoh, can 01:15:43 yeah 01:15:56 so i wonder what all these wonderful "turing machine in wireworld" articles are about? 01:16:13 this, for example, looks interesting: http://pages.prodigy.net/nylesheise/train_set.html 01:16:57 I think that they have an infinite wire 01:17:32 yes 01:17:47 so, "they can't grow" is no limitation 01:17:56 if your "space" looks like this: http://pages.prodigy.net/nylesheise/langton_5.gif you can make one of those Turmites 01:18:21 well, ... i'm still undecided but at least the problem seems clearer 01:18:25 i'll probably be off now 01:18:51 see y'all latere 01:18:54 later, even... 01:19:03 bye then 01:19:06 I'm off too 01:19:13 g'nite all 02:48:36 -!- graue has joined. 03:06:47 -!- kipple has quit (Read error: 110 (Connection timed out)). 03:11:15 -!- GregorR has quit (Remote closed the connection). 03:11:32 -!- pgimeno has quit (Read error: 104 (Connection reset by peer)). 03:15:51 -!- graue has quit ("Leaving"). 03:23:49 -!- pgimeno has joined. 03:47:07 -!- GregorR has joined. 04:20:14 pgimeno: i just tried alpaca.pl... it works for me... what part of it isn't working for you? 04:46:22 -!- malaprop has quit ("sleep"). 06:29:19 -!- wooby has quit. 06:40:10 woohoo 06:40:40 or something 07:59:59 -!- clog has quit (ended). 08:00:00 -!- clog has joined. 08:43:53 heh 08:44:02 if you can have wireworld with "infinite wire" 08:44:10 you can also have a smetana program with infinite instructions 08:45:50 the only problem then is that programs won't terminate 08:45:59 you'd have to have something like "Goto step -1" to terminate your program 08:47:41 wireworld is definitely very pretty, though :) 08:48:59 http://www.quinapalus.com/wires11.html 08:49:05 pure sex 08:54:29 whoa 08:54:50 * pgimeno is amazed 08:55:21 dunno what's more technically impressive, that thing or the life turing machine 08:55:25 probably the latter 08:55:37 but they both look so amazing. 09:01:15 life turing machine? you mean Conway's Life, right? 09:01:35 cpressey: still around? 09:02:54 yeah, that thing 09:03:21 the annoying thing is that after they do something like that, it's completely pointless to do anything with wireworld (or life) :( 09:04:36 heh, yeah, almost impossible to beat 09:06:54 where have you found about Life? 09:07:10 er.. everybody knows about it? 09:07:35 ah, ok 09:08:23 I was wondering if you saw a graphic so amazing as the wireworld one 09:08:29 yes 09:08:37 http://rendell.server.org.uk/gol/tm.htm 09:11:09 whoa (again) 09:11:16 I see 09:15:40 cpressey: $ perl ../../../src/alpaca.pl redgreen.alp redgreen.pl 09:15:41 Unknown 'strict' tag(s) 'vars refs subs' at ../../../src/alpaca.pl line 19 09:15:41 BEGIN failed--compilation aborted at ../../../src/alpaca.pl line 19. 09:20:29 (perl 5.8.4 if that matters) 09:26:25 removing the 'use strict' line seems to work 11:07:40 -!- kipple has joined. 13:01:59 -!- wooby has joined. 13:08:26 -!- malaprop has joined. 13:11:36 -!- wooby has quit. 14:19:00 -!- CXI has quit ("If you're reading this, it's probably x-chat's fault."). 14:19:11 -!- CXI has joined. 14:28:57 -!- puzlet has joined. 14:29:21 -!- puzlet has left (?). 14:51:34 Wowsa. 14:51:40 * GregorR just watched that Wireworld go. 15:15:09 -!- sp3tt has joined. 16:38:45 -!- Keymaker has joined. 16:41:37 'ello 16:41:44 i'm back! 16:41:46 :) 17:13:24 Keymaker: Did you write a polygot quine? 17:13:30 shh! 17:13:33 i'm almost done! 17:13:42 i was trying to keep it as surprise 17:14:12 (and to note; i have been away from 4th till today 18:45 when i arrived on this channel today) 17:14:34 just wait ;) 17:14:54 I look forward to seeing it. 17:14:59 ok 17:31:49 -!- CXI has quit (Connection timed out). 18:50:55 phew.. 18:51:02 now there isn't much left 19:06:18 * Keymaker Programs now a program to convert some data.. 19:17:05 -!- CXI has joined. 19:18:33 -!- graue has joined. 19:19:46 * Keymaker goes to eat some pizza, will be back soon.. 19:22:11 cpressey, in the Beturing documentation, you say "...a Beturing machine is incapable of having a state transition diagram that is a planar graph." 19:22:18 shouldn't that be "that is NOT a planar graph"? 19:40:12 i think i may have just disproved the "universal Turing machines need state diagrams that are nonplanar graphs" conjecture: http://www.oceanbase.org/graue/archway/archway.txt 19:59:58 graue: yes, that's how it should read 20:01:15 and i think i agree with your conclusion... based on an outline of a smallfuck interpreter in beturing i got half-done last night before falling asleep 20:02:43 pgimeno: that's really weird... i'm using 5.005_03... 20:04:16 it's possible they changed the 'strict' module for 5.8 20:04:44 anyway, deleting it should do no harm 20:04:52 I'm afraid that's the cause 20:05:48 that's one of the reasons i don't like perl anymore :) they couldn't even bother to bump the major revision number for incompatible changes 20:11:22 seems that this would be correct syntax now: use strict vars,refs,subs (but then, a lot of warnings or errors appear) 20:13:56 thanks 20:14:18 that works for me in 5.005, weird... i guess i was just doing it wrong the whole time?!? 20:15:43 all I know about Perl is that its syntax resembles C, vars start with $ and regexps are widely used, so I'm not the right one to ask :) 20:16:46 the description "write-only language" fits... :) 20:19:09 the "esoteric programming language" article on wikipedia once listed Perl as a prominent example 20:21:08 Heh. 20:21:25 :D 20:21:42 I saw a guestbook, it was on the l33t page, and there was a field named "What esoteric languages have you used?" 20:22:13 One answer was: "Brainfuck, befunge, malbolge, perl - oh wait that's not esoteric is it?" 20:22:28 And another simply read: "English". 20:23:11 * Keymaker dies 20:23:17 nooooooo 20:23:26 * Keymaker hunts small bug 20:23:47 And speaking of different languages, I was looking through the documents for subjects you can take in the Swedish equivalent of high school. 20:24:01 hey what happened to that math language of yours? 20:24:24 The page for Programming B listed the following languages: Perl, PHP, C++, Python, Java, and other. 20:24:30 I hope other includes BF. 20:24:52 http://rename.noll8.nu/sp3tt/mathspec.txt 20:24:57 i hope it includes XUML, Qdeql, and "math" 20:25:17 Code examples: http://rename.noll8.nu/sp3tt/hw.math, http://rename.noll8.nu/sp3tt/beer.math 20:25:19 are you still working on this? 20:25:26 Yes, kind of. 20:25:50 sp3tt; you're from sweden? 20:25:53 Yes. 20:25:57 ok 20:26:01 hi Keymaker, how was the bike ride? 20:26:09 not mention it :) 20:26:16 And you are from Finland. 20:26:18 it was half-success 20:26:19 yeah 20:26:24 If your hostmask isn't faked. 20:26:38 like when we were at ~30 km we were all wet because of rain 20:26:39 and cold 20:26:44 so we decided to turn 20:26:53 and did so, and got home ~1.30 am 20:27:11 and then we decided to use car instead and got to our target ~4.20 am 20:27:13 :) 20:27:17 oh 20:27:29 but there was good 60 kms.. 20:27:37 (that almost finished me) 20:28:28 Good night all. 20:28:34 'nite 20:28:52 sp3tt: nite, I'll comment about my impression later 20:29:13 Ok, it isn't finished though. 20:29:29 The interpreter can only print stuff so far >.< 20:30:00 http://rename.noll8.nu/sp3tt/mathlang.py 20:30:23 k 20:36:26 -!- graue has quit ("Leaving"). 20:47:58 -!- sp3tt has quit (Read error: 110 (Connection timed out)). 20:57:10 -!- wooby has joined. 21:01:45 YEAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 21:01:49 found the bug.. 21:03:35 Heh, I know that feeling. 21:03:42 :) 21:03:46 it'll be soon up 21:03:50 wait ~10 mins 21:15:37 rghh 21:15:41 small bug 21:15:53 takes a bit time more.. 21:25:04 -!- cmeme has quit (Connection timed out). 21:26:23 -!- cmeme has joined. 21:30:08 :( 21:30:15 still some bug 21:30:30 rggggggghhhhhh 21:30:46 * Keymaker dives into program 21:31:30 Remember to check for underwater obstructions before diving. 21:31:38 :) 21:50:28 bug fixxed 21:50:43 i'm almost done, hopefully, this time :) 21:54:42 with that polyglot quine thingy? 21:56:08 w00000000000000000t! 21:56:11 done done done done hahahahaha 21:56:12 :) 21:56:24 i'll update bf-hacks.org now 22:04:30 here it is: 22:04:31 http://www.bf-hacks.org/hacks/pgq.b 22:04:46 as it says on the page, i'll try to make it shorter sometime and add more languages 22:05:43 as it says on the page as well, it's made with simple technique 22:05:44 WOw, that's crazy. DId you generate that somehow or is it by hand? 22:06:02 the other part is made by hand 22:06:03 but not the 22:06:06 data that has 22:06:12 d[i]=0x...... 22:06:30 i made a program that converts input to that form 22:06:53 Well, congrats. 22:06:53 :) 22:06:56 cheers 22:07:12 the bugs i had were something annoying stuff that i just didn't notice 22:07:33 like that there was one cell increased by two in brainfuck version and i didn't notice that 22:07:46 and other stupid stuff.. 22:07:49 :) 22:08:40 while i was away i got some idea for an esoteric programming language 22:09:02 i'll try think more about it now 22:16:10 m 22:16:11 hm 22:16:24 so i just made an esoteric language 22:16:32 what kind of? 22:16:38 not sure 22:16:41 ok 22:16:42 factorial: 22:16:42 tell more 22:16:43 5(>(1-)#1-) 22:16:43 1 # >+ ! 22:16:43 > 22:17:08 hmm 22:17:17 how does it work? 22:18:36 first 9 fibonacci numbers: 22:18:37 9(< #1-) 22:18:38 1 !#< 22:18:38 1 < + 22:19:08 -!- graue has joined. 22:19:14 hey graue 22:19:18 hey 22:19:26 check out my factorial program :) 22:19:37 5(>(1-)#1-) 22:19:37 1 # >+ ! 22:19:37 > 22:19:43 the idea is this: 22:19:55 each line controls a separate stack 22:20:21 instructions < and > access data from neighD[D[D[D[D[D[Dbouring stacks 22:20:31 neighbouring 22:20:41 that sounds clever :) 22:21:02 i'm not sure how fun it actually is 22:21:17 the idea is to use this as a base for a language built on music notation 22:21:19 so the stacks run in parallel? 22:21:32 yeah 22:21:48 < gets data from the stack above (with wraparound) 22:21:56 > gets data from the stack below (with wraparound) 22:21:58 this: 22:22:00 < 22:22:00 > 22:22:23 will add to both stacks the top value on the other swap 22:22:24 err 22:22:26 *other stack 22:22:38 oh cool 22:22:40 i.e. they're executed "simultaneously" 22:23:18 nothing gets popped though. And maybe i should change that. 22:24:55 maybe so 22:25:12 as it is, i'm not even sure how to swap top values 22:25:42 (without the use of a third stack) 22:27:24 even with the third stack it's not trivial :( 22:28:03 with the use of the third stack, swapping values in the first two: 22:28:06 #< 22:28:08 #< 22:28:09 < 22:29:04 where # means drop 22:29:19 in music notation, < is a rising third 22:29:43 and # is unison 22:31:44 http://z3.ca/~lament/prelude.txt 22:31:46 http://z3.ca/~lament/prelude.py 22:33:48 note that it's practically trivial to compile Brainfuck to Prelude 22:34:00 you need two voices 22:34:09 [ becomes ( in the first voice 22:34:13 ] becomes ) 22:34:25 + becomes 1+ 22:34:29 - becomes 1- 22:35:07 < becomes 22:35:09 # 22:35:09 < 22:35:26 > becomes 22:35:27 > 22:35:28 # 22:35:47 , becomes ? and . becomes ! 22:36:51 that's not good 22:37:04 if it's trivial to compile brainfuck to it, no one will write in it; they'll just write in brainfuck 22:37:16 but Prelude is a lot easier to write in 22:37:32 because you're not limited to two stacks 22:37:42 oh, okay then 22:37:44 three seems like a good number 22:37:48 for general use 22:37:56 but you can have as many as you wish 22:38:06 brainfuck is trivial to compile to C as well 22:43:00 lament: shouldn't "- pop two values, add them and subtract." be "- pop two values, subtract them and push." ? 22:43:27 hahahaha 22:43:30 yes 22:43:57 when you say "# drop last value", you mean the top of the stack, right? 22:44:00 sorry, i wrote the spec in like 15 minutes and didn't enjoy it at all 22:44:03 yes 22:44:32 yeah. writing specs is not too much fun.. 22:44:38 indeed 22:44:40 also "voice above" and "voice below" is "with wraparound 22:44:50 so if you have only two voices, < and > do the same thing 22:45:04 interesting language :) 22:45:17 and three is a convenient number of voices because each one can access both others 22:45:18 Keymaker: nice polyglot quine! 22:45:35 cheers :) 22:46:28 actually i'll probably change < and > to ^ and v 22:46:38 i like < and > 22:46:46 ^ and v make much more sense 22:46:52 yes 22:46:56 they look uglier 22:47:01 -!- ChanServ has quit (ACK! SIGSEGV!). 22:47:17 i was just vary of using v because i was contemplating string literals 22:47:24 but screw that 22:47:55 -!- ChanServ has joined. 22:47:55 -!- irc.freenode.net has set channel mode: +o ChanServ. 22:48:08 how about: ^ or < and v or > 22:48:41 nah. stick to one of them 22:48:52 okay. ^ and v then 22:49:35 * lament changes the spec and the interpreter 22:50:39 does the ^ and v alter the stack above/below ,or just peek at it? 22:51:57 just peek 22:52:09 im not sure which way would be better 22:52:21 but i think just peeking encourages more cooperation between the voices 22:52:30 i.e. the other voice has to drop the value if it needs to 22:53:31 Keymaker: wow, a pretty nice quine! 22:53:50 thanks 22:54:13 tried it in both langs, it wrocks! :) 22:54:36 hehe 23:00:14 umm, the spec says "! output a character", but it outputs it as a number 23:00:58 yeah 23:01:16 change NUMERIC_INPUT to False in the interpreter 23:01:24 it's uhhh... for debugging purposes :) 23:01:43 maybe you should just add another operator.... 23:01:48 maybe it'll have both numeric and non-numeric 23:02:02 but then one of them would have to correspond to a seventh 23:02:06 and that's a bigass interval 23:02:19 huh? you lost me there.... 23:02:41 the main point of Prelude is to be a text representation of Fugue 23:02:57 which is the same language, but using music as source code 23:03:09 with different intervals corresponding to different instructions 23:03:14 that's why voices are called voices 23:03:51 (i doubt it makes much sense to actually implement Fugue) 23:04:27 "That sounds nice." (Gahh, what a horrible 'pun'.) 23:05:05 ahh 23:05:08 stop the punishment 23:12:33 nice language :) just made a hello world 23:14:08 time for 99 bottles of beeer! :) 23:14:27 kipple: show :) 23:14:43 keymaker: I thought it was quines that was your thing... :) 23:14:52 or digital roots 23:15:23 lament: well, actually it's only Hello (I cheated) 23:15:34 99999999+++++++H9992++++e7+l l3+o 23:15:34 v! v! v!v! v! 23:15:52 hmm. that didn't look good in my client 23:16:58 looks fine here 23:17:14 :) 23:17:24 i'm sure it could be more compact though :) 23:17:36 yeah 23:17:47 i should try to look at this programming language.. 23:17:57 Keymaker: and make a quine 23:17:59 :) 23:18:23 :) 23:19:44 kipple: maybe i should add string mode after all? 23:20:07 ok 23:20:23 then maybe I'll wait until you've decided until I try to do 99bob ;) 23:20:28 haha 23:20:58 Good old fibonacci: 23:20:58 1(v+ 23:20:58 1 !v v) 23:21:04 Gah, my paste botched. 23:21:06 Let's try that again 23:21:10 1(v+ 23:21:14 1 !v 23:21:16 v) 23:21:30 Using the "numeric output" thing. 23:22:10 It's iterative. I usually do recursive, but that'd be too non-trivial. 23:22:22 oooh 23:22:34 dense :) 23:23:12 For a fibonacci, it's pretty small indeed. 23:23:24 the bottom stack keeps growing? 23:23:31 is the file extension .p ? 23:23:39 i'm sure .p is used 23:23:44 ok 23:23:44 by thousands of different languages 23:23:48 I used .pre 23:23:48 'doh 23:23:51 ok 23:23:51 i had .pre 23:23:57 :) 23:24:31 so it seems like most programs would either have to be bloated with # instructions 23:24:40 or have huge memory leaks 23:24:44 I used .prel :p 23:25:11 And yes, it has a huge memory leak. What more do you expect from a 4x3 block of code. :p 23:25:11 oh well... huge memory leaks it is :) 23:26:07 implement gc 23:26:56 most modern languages do :) 23:26:58 hm, how would that work 23:27:14 it wouldn't, as it is not a real memory leak 23:27:25 yeah :) 23:27:31 I was just kidding anyway 23:27:31 the data is on the stack, and could still be used by the program 23:27:46 kipple: unless somebody writes an extremely smart compiler 23:27:49 i can't get kipple's hello working :(/ 23:28:00 Keymaker: change to non-numeric output 23:28:05 how 23:28:10 edit the interpreter 23:28:29 Merf, that prelude fib is denser than the simple befunge fib: 23:28:31 100p1>00g\:0v 23:28:33 ^ .:+p0< 23:29:01 Two stacks really make a difference. :p 23:29:13 three 23:29:34 but that befunge fib only prints the first 100, right? that's different 23:29:45 Uh, no, it loops indefinitely. 23:30:01 ah, of course 23:30:38 I just saw the number 100, and forgot all about befunge :) 23:30:43 haha 23:31:10 Although (with most interpreters) it has problems when the number goes >255, since the playfield cell is only one byte. 23:31:24 hm 23:31:30 i never specified the data type size 23:31:39 the interpreter uses bignums 23:31:50 i like bignums though 23:31:55 I noticed. It's nice for scientific purposes. 23:35:38 Usually I've written a befunge interpreter after fib, but I think I'll skip that for now. 23:35:44 aww 23:36:09 If it had functions, maybe. :p 23:36:27 Besides, it's 0140am again and I need to be at work "tomorrow"-morning again. 23:36:31 brainfuck should be easy to interpret 23:36:41 i don't get this working 23:36:43 two stacks for the program, two more for memory 23:37:27 A prelude->midi converter would be nice, too. 23:37:56 well no 23:38:01 Fugue would also have note durations 23:38:13 and some choice as to which exact interval you use 23:38:37 prelude lacks that information 23:39:06 it could be converted into Fugue but the result certainly wouldn't sound good. 23:39:19 heh, also cool would be some kind of midi parser... where a midi is the program 23:39:29 so you could program in cakewalk :) 23:39:47 Or program with a musical instrument. 23:42:01 or maybe a program that applies arbitrary "operators" to a piped-in mp3 or wav, and adjusts the rules until it spits out "Hello World" 23:56:26 Do the 'lines' (physical-lines-of-source, not logical-lines-of-code) for voices need to be equally long? 23:57:58 no 23:58:12 they're padded with whitespace at the end to make them of equal length 23:58:47 'k. 23:58:55 (Started to write the befunge interpreter after all.) 23:59:09 oh god :) 23:59:29 I probably won't finish this, much as I didn't finish the sed befunge interpreter. :p 2005-06-08: 00:02:01 dang. I was so convinced there was a bug in the interpreter 00:02:15 then I realized I had just confused ^ and v .... 00:02:55 that seemed more intuitive to me :) 00:04:27 ^ and v are "get from", not "put in" 00:04:31 if that's what you mean. 00:04:45 yeah 00:04:58 I was thinking it indicated the direction the value travels 00:06:24 but there's probably a bunch of bugs in the interpreter anyway 00:10:18 Heh, this will be very much non-dense, this befunge thing. 00:10:51 how many voices? 00:11:23 Let's just say "lots". 00:11:48 At least 11. :p 00:12:09 (I probably won't need more, though.) 00:12:21 (Well, maybe a few.) 00:12:58 Most of the time a lot of them will be silent. 00:17:11 cellular automata are cool 00:17:25 like, really cool 00:17:28 fizzie: you could always put a bunch of collectively-nop operations 00:17:28 super cool 00:18:19 fizzie: which in Fugue would be something like "push number/pop" 00:18:46 (push number - a second. then any interval, corresponding to the actual number. Then pop - a unison) 00:19:26 then again, voices that are silent most of the time could be assigned particularly ominous instruments 00:19:45 like bells or whatever :) 00:21:51 kinda neat when your program requires a symphonic orchestra to perform. 00:26:29 a python question; 00:26:44 is there any way to count the amount of cells/whaterver there is in list? 00:33:19 len(list) 00:33:45 thanks 00:35:01 mmm python 00:36:15 :) 00:36:46 I get paid to code in Python all day and it makes me very happy. 00:36:53 oooh 00:36:55 awesome 00:37:03 yes 00:43:40 Whee, my befunge program "12345@" prints out (a stack dump, at the end of the interpreter) 5, 4, 5, 1 and exits. :) :) 00:44:40 from a review of a topology textbook: "The beginner may be troubled as to the way connectedness is defined, since it is defined as the negation of disconnectedness" 00:44:43 With 13 voices. http://www.befunge.org/~fis/bef.prel if you want to see it, but it's very much work-in-progress (only supports > direction at-the-moment, no _| or anything). 00:45:58 Uh, "123+45@" was the program, I mean. 00:46:35 Oh, and the program input only reads 2000 bytes and assumes they form a 80x25 grid, and wrapping is not supported. :p 00:47:01 I used perl -e 'print "123+45@", " " x 7999;' > test.bef to create the input. 00:47:39 I'll improve it to read actual lines when I have some Free Time (tm). 00:52:20 :) 00:52:32 The topmost three voices select which parts of code to run, based on the current-command on the stack of the third voice, voices 4 and 5 contain the playfield, voices 6 and 8 are quite temporary, voices 7 and 9 hold the current IP and delta, voice 10 contains a '1' to drive the main loop (or 0 after a '@'), voice 11 has the befunge stack and voices 12 and 13 are temporary. 00:53:55 It seems I've implemented only the befunge commands #, $, *, +, -, [0-9] and @. Will do the rest later. 00:54:04 ok 00:54:24 by the way; any way to print a character in python so that it would not make new line as well? 00:55:05 putch() perhaps. 00:55:23 (Disclaimer: I don't do python.) 00:56:02 i'll try 00:56:30 didn't like it 00:56:32 Seems that ending a 'print' statement with a , (comma) would also work. 00:56:48 "A "\n" character is written at the end, unless the print statement ends with a comma. This is the only action if the statement contains just the keyword print." 00:57:22 also sys.stdout.write() 00:58:08 now this works 01:37:07 is INTERCAL a Turing tarpit? 01:37:29 is Befunge a Turing tarpit? 01:38:27 Turing tarpit? 01:38:57 befunge? I would say no. way too many unnessecary instructions 01:40:12 I don't think INTERCAL qualifies either. 01:41:03 malaprop: http://esoteric.voxelperfect.net/wiki/Turing_tarpit 01:41:34 I think Befunge is just for fun. 01:42:23 *sigh* when will I ever learn to spell necessary.... :( 01:47:42 me goes sleep 01:47:44 me tired 01:47:52 clock 3:51 am 01:47:57 me too 01:48:00 good nite :) 01:48:03 nite 01:48:06 -!- Keymaker has left (?). 01:49:22 -!- wooby has quit. 02:37:12 My new language: #esolang 02:37:21 Here, let me test it. 02:37:34 somebody.write("Hello, World!\n"); 02:37:38 (it may take a while to go) 02:37:47 Hello, World! 02:37:51 GregorR: this channel is #esoteric 02:38:05 it worked! 02:38:18 GregorR: I think you're going to have trouble with recursion. 02:38:40 And if you write a working 99 bottles program, we'll have to kickban you. 02:43:55 lament: The name is a conjunction of #esoteric and lang :P 02:45:25 for every i from 99 down to 2: somebody.write(i + " bottles of beer on the wall, " + i + " bottles of beer!\nTake one down, and pass it around, " + (i - 1) + " bottles of beer on the wall!\n"; 02:45:35 :P 02:45:41 Oh, forgot the ) at the end 02:45:45 -!- graue has quit (Read error: 60 (Operation timed out)). 02:45:45 -!- kipple has quit (Operation timed out). 02:46:17 GregorR: Hm, you expect us to be dynamically typed and just convert i from int to str for you? That's kinda presumptuous. 02:46:23 XD 02:50:53 PLUS, it's nondeterministic! 04:11:29 -!- graue has joined. 04:36:19 -!- malaprop has quit ("sleep"). 05:05:18 graue: hey 05:05:24 so will you change the logo? 05:22:39 did you make a new one? 05:24:22 no 05:24:53 then i have nothing to change it to 05:25:24 the Piet fibonacci numbers program 05:25:37 http://www.dangermouse.net/esoteric/fibbig.gif 05:26:05 did the author agree to PD-ize that? 05:26:07 yes 05:26:09 oh 05:26:13 i missed that detail 05:26:14 okay then 05:26:20 he replied to my email, and also came here 05:26:50 wait, isn't that the program that has a bug? 05:27:25 http://www.bertnase.de/npiet/picture.html 05:28:12 do you know perl? 05:29:11 a bit 05:29:47 then perhaps you can get the original interpreter to run and check if it has a bug or not :) 05:30:34 i don't know that much perl :) 05:30:38 i.e. this is most likely not a bug but a discrepancy between npiet and original piet 05:32:43 well, "original piet" was implemented in perl by Marc Majcher, who is not the author of the fibonacci program 05:34:13 it would be weird for it to have a bug 05:34:26 there's a fairly detailed explanation of the program on http://www.dangermouse.net/esoteric/piet.html 05:34:33 with a trace 05:35:10 npiet trace is here: http://www.bertnase.de/npiet/fib-trace-big.png 05:36:20 i know 05:46:22 -!- wooby has joined. 05:48:27 i rather like kipple's spoofs, especially the last two 06:02:39 -!- wooby has quit. 06:06:29 -!- graue has quit ("Leaving"). 07:56:30 -!- sp3tt has joined. 07:59:59 -!- clog has quit (ended). 08:00:00 -!- clog has joined. 08:52:45 -!- Keymaker has joined. 08:54:58 i'm 18 now. today is my birthday 08:58:33 congratulations 09:05:32 http://www.efnet-math.org/Meta/sine1.htm 09:07:14 cheers 09:35:00 -!- Keymaker has left (?). 11:14:14 -!- pgimeno_ has joined. 11:14:15 -!- pgimeno has quit (Read error: 131 (Connection reset by peer)). 11:41:04 -!- kipple has joined. 12:25:22 -!- sp3tt_ has joined. 12:32:55 -!- sp3tt has quit (Read error: 145 (Connection timed out)). 13:53:48 -!- malaprop has joined. 14:00:08 -!- sp3tt_ has changed nick to sp3tt. 14:57:20 -!- sp3tt_ has joined. 15:05:33 -!- sp3tt has quit (Read error: 60 (Operation timed out)). 16:06:38 -!- Keymaker has joined. 16:07:24 hm 16:34:39 * Keymaker leaves 16:34:44 -!- Keymaker has quit ("Freedom!"). 17:02:43 -!- cmeme has quit (Connection reset by peer). 17:03:01 -!- cmeme has joined. 18:50:30 -!- cmeme has quit (Read error: 131 (Connection reset by peer)). 18:52:31 -!- cmeme has joined. 18:52:47 -!- cmeme has quit (Remote closed the connection). 18:53:32 -!- cmeme has joined. 18:55:39 -!- cmeme has quit (Remote closed the connection). 18:56:50 -!- cmeme has joined. 18:56:53 -!- cmeme has quit (Remote closed the connection). 18:57:36 -!- cmeme has joined. 19:18:27 -!- pgimeno_ has changed nick to pgimeno. 19:36:59 Keymaker: happy birthday! 19:37:50 he's not here ... 19:38:50 I'm hopefully talking to him via the log 19:39:13 he uses to read it 20:07:35 lament: very interesting the sin(1deg) expansion, I already knew a different sin(3deg) one (plus I've just found one without any imaginary part) 20:09:50 (actually muMATH found it but anyway) ;) 20:14:55 SIN(#PI/180) == -3/4/(-27/8 (4 - (7 + 6^(1/2) (5 + 5^(1/2))^(1/2) + 5^(1/2))^(1/2))^(1/2)/2^(3/2) + (2187/32 - 729/128 (7 + 6^(1/2) (5 + 5^(1/2))^(1/2) + 5^(1/2))^(1/2))^(1/2)/2)^(1/3) + (-27/8 (4 - (7 + 6^(1/2) (5 + 5^(1/2))^(1/2) + 5^(1/2))^(1/2))^(1/2)/2^(3/2) + (2187/32 - 729/128 (7 + 6^(1/2) (5 + 5^(1/2))^(1/2) + 5^(1/2))^(1/2))^(1/2)/2)^(1/3)/3 20:15:15 :) 20:41:35 not much interest in #math apparently 21:21:35 -!- sp3tt_ has quit ("Chatzilla 0.9.68a [Firefox 1.0.4/20050511]"). 21:27:30 there are so many new esolangs these days, it's hard to keep up... 21:27:50 -!- Keymaker has joined. 21:27:57 hello 21:28:00 thanks pgimeno :) 21:28:07 happy birthday :) 21:28:14 cheers 21:28:18 :) 21:29:20 i was making a new language today 21:29:25 in spain you reach independency from parents at 18, don't know in your country 21:29:30 really? 21:29:34 yes 21:29:39 (and same here in finland) 21:29:46 but 21:29:46 same here 21:29:48 :) 21:29:55 i'm not sure does it work 21:29:58 i mean the method 21:30:04 i must investigate it more 21:30:24 what is it like? 21:30:40 categories? ;) 21:30:42 all stuff isn't clear, here is something :) 21:30:47 wait, i'll type 21:32:25 i'll probably call the language "snack", that is, because the interpreter eats the source code. execution of program will be finished when the whole code is removed/eaten. :) the interpreter i've been working on is made with python because it seems to be really cool and fun language. anyways, i'm not sure will this method work: 21:32:31 (wait more, typing..) 21:34:07 like when the program is started, the whole program code is stored into memory. when the code is executed, '#' sets toggle to 1 or 0, depending its value (in the beginning it's always 0). '?' instruction, executed if toggle is 1, will place the entire programs source to that place 21:34:44 when the program is loaded, it will be put on stack, and when reading instructions they are popped from it (and that way removed) 21:35:32 anyways; this piece of code #?# (when got to '?') would result the program be ##?# at that point 21:35:55 i'm not sure what to make the other instructions be, or anything.. not sure if this will work. 21:35:57 :) 21:36:55 so program execution is from right to left? 21:37:40 yes 21:38:10 imagine it as stack, filled with program source from left to right 21:38:26 (i'll be back in 5 mins, eat something!) 21:38:29 hum, not much instructions to do anything I guess 21:38:33 k 21:45:47 yes 21:46:02 that is problem :p 21:46:14 i haven't planned any 21:46:19 i know it would need more 21:47:13 another idea was to make language that would let user switch between program memory and memory memory :) 21:47:23 that was user could do self modifying code 21:47:33 and so on 21:48:14 that would probably not-delete the instructions after executing them 21:48:17 dunno 21:49:50 about python; anyone know how i can make 2d arrays? 21:50:23 hum 21:50:49 re instructions: I can't help you with that 21:50:57 that's ok 21:51:03 [[1, 2, 3], [2, 4, 9]] 21:51:13 thanks 21:51:19 how do i use them? 21:51:31 like for example access some x,y? 21:51:43 [[1, 2, 3], [2, 4, 9]][1][2] 21:52:08 lists are 0-based, btw. 21:52:15 ? 21:52:18 what that means? 21:52:33 first element in a list is accessed with [0], not [1] 21:52:39 yeah 21:52:44 that i knew 21:52:56 1-based would be confusing 21:53:55 0-based vs. 1-based is an arbitrary decision in a language without pointers 21:55:47 I planned to implement a trick for my malbolge interpreter, then I went for straight list and now that the malbolge programs are growing I'm regretting it 21:55:49 "0-based is more natural: I mean, who's ever heard of anyone who'd start counting from 1?" 21:56:20 :) 21:59:54 rgh.. can't get this working.. 22:00:06 data = [[],[]] 22:00:06 data[[8],[5]]=33 22:00:06 print data[[8],[5]] 22:00:18 what i'm doing wrong? 22:00:47 In Python a list doesn't have an element [8] without also elements [0-7] 22:01:08 Perhaps what you want is a dictionary indexed by tuple. 22:01:30 like for example i would like 2d array like: 22:01:49 int stuff[500][500]; in c 22:02:24 Do: data = {}; data[(8, 4)] = 33; 22:02:27 that'll work as you want 22:03:42 yes! 22:03:45 exactly 22:03:47 thanks 22:05:19 Remember, in Python everything is an object. Tuples are immutable objects, and dictionaries can be indexed by any immutable object, whether that's an int or a tuple. 22:09:00 btw, my trick was to use a tuple of 1-element lists so that the content of the tuple was changeable but random access was quick 22:10:13 pgimeno: dictionary access is constant time. 22:10:44 yeah but it needs hashing which is not so fast as indexed access 22:11:36 Ya, but it's not a weird use of a dict. :) What were you writing that was so time-sensitive? 22:11:54 a malbolge interpreter :) 22:12:30 Everything is time-insensitive when the amount of operations goes past few millions or so. 22:12:42 s/in// 22:13:00 Ya, I figured he was either doing something fast or big, was just curious. 22:13:08 s#in/#-in/-# 22:13:28 I sure hope I won't need to fix _that_ regexp too. 22:14:06 doh, now I get it :) 22:14:25 (That second one is supposed to be applied on the first.) 22:14:32 yah 22:15:27 I finally used a list but even the cat program is slow... list access seems to be O(n), not O(1) 22:15:42 Ya, list access is linear time. 22:16:50 Does that language have arrays? 22:17:03 there's an array package but I'm reluctant to using third party libraries if avoidable 22:17:08 Python does not, no. 22:17:24 Sets, tuples, lists, dictionaries. 22:17:48 there are, but it's a third party language extension 22:19:44 anyway this should work: stuff=ysize*(xsize*([0],),) 22:19:52 then stuff[y][x][0] is every element 22:21:33 I'm off, bye 22:21:53 bye 22:22:21 -!- calamari has joined. 22:22:28 hi 22:22:32 hi 22:22:38 * calamari can get online again.. yay :) 22:22:48 hi malaprop 22:24:22 welcome online! :) 22:24:48 It's alive! (Read: welcome.) 22:50:46 this is strange. looks like the voxelperfect web server treats files differently based on whether or not they contain comments: http://esoteric.voxelperfect.net/files/kipple/src/ 22:51:25 some files (the ones including # comments) seem to be classified as text files, while the rest do not... 22:51:58 It could be some heuristic based on first line. 22:52:07 annoying 22:52:34 :) 22:52:41 mmmh.. esoteric servers.. 22:55:21 Depending on the server you could possibly work around it. If it (is apache and has mod_cern_meta enabled || othewise supports cern httpd metadata thing), you can add a directory .web and there files foo.k.meta and Content-type: text/plain into the files. 22:56:12 well, i'm off to nature (read: night photographin') 22:56:13 And possibly adding a "DefaultType text/plain" to .htaccess of that directory could also work. 22:56:18 :) bye 22:56:28 -!- Keymaker has left (?). 22:56:46 Bye, and I want a camera that doesn't have a stoopid 15-sec max limit of exposure time. 22:59:13 here is my latest contribution to insanity: http://esoteric.voxelperfect.net/wiki/BF_instruction_minimalization 23:09:27 latest EsoShell: http://lilly.csoft.net/~jeffryj/EsoShell 23:11:14 I'm pretty sure that'll be good enough to be called the real 1.00 23:11:34 so if I need to change anything I'll update the version number from here on out :) 23:15:12 looks nice 23:19:03 kipple: thanks :) 23:19:47 do you have other languages planned? 23:23:54 btw, the brainfuck interpreter outputs numbers, not chars..... 23:25:15 * calamari tries it 23:25:52 indeed.. wonder how that happened :) 23:26:26 do you use System.out.print() with an int as argumen? 23:28:41 fixed 23:28:48 must have been debugging something at the time 23:29:08 I took the (char) cast off the print for some reason :) 23:30:52 I don't have any current plans to add new languages.. but anyone else is welcome to 23:31:11 The API is fairly straightforward 23:33:12 Basically, all you do to add a language is have your class extend "Program" and put the class file in the Programs directory. Well, I guess you'd also want to edit the help program so people know about it :) 23:34:02 Wish I knew a way to have Java automatically tell me the accessible files.. too many security restrctions 23:34:26 yeah, applets are very restricted (for good reasons, though!) 23:34:36 definitely 23:34:43 just frustrating sometimes 23:35:21 if the directory is browseable with HTTP you can get it that way 23:37:09 are you speaking in general, or would you happen to know which class I can use? 23:37:25 in general 23:39:29 Gaaah, stop talking!!! I can't keep up with the logs ;) 2005-06-09: 00:06:36 hi GregorR 00:06:58 lol.. autocomplete gave away my laziness :) 00:51:43 -!- calamari has quit (brown.freenode.net irc.freenode.net). 00:51:43 -!- cmeme has quit (brown.freenode.net irc.freenode.net). 00:51:46 -!- cpressey has quit (brown.freenode.net irc.freenode.net). 00:51:55 -!- cmeme has joined. 00:56:06 -!- cpressey has joined. 01:00:11 -!- calamari has joined. 01:47:27 -!- heatsink has joined. 02:38:10 -!- calamari has quit (Read error: 110 (Connection timed out)). 02:56:36 -!- kipple has quit (Read error: 110 (Connection timed out)). 04:58:03 -!- heatsink has quit ("Leaving"). 05:29:10 -!- calamari has joined. 05:32:59 hi 05:36:17 * GregorR eats calamari. 05:36:21 Mmmmmmmmmmmmmmmmmmmmmmmmmmmm, squid. 05:36:34 -!- malaprop has quit ("sleep"). 05:40:50 brb 05:49:20 -!- calamari has quit (Read error: 145 (Connection timed out)). 06:08:20 -!- calamari has joined. 06:08:28 re 06:08:51 hi 06:09:27 hi pgimeno, how's it going? :) 06:09:53 fine, except that a mosquito woke me up earlier than I wish 06:10:08 have you been away or something? 06:10:18 where do you live? no mosquitos in Tucson, AZ right now :) 06:10:25 Spain 06:10:51 pgimeno: yeah, I walked into the kitchen and the room was full of gas.. had to get off to call maintenance 06:11:13 yuck, sounds dangerous 06:11:47 yeah.. I'm not very familiar with gas stoves yet.. I've had electric all my life 06:12:34 I've tried esoshell but even 'help' fails to work... I don't know what happens 06:12:50 brb 06:21:16 pgimeno: yeah, that's weird.. 06:21:46 I wonder if I can write a Java 1.1 version of the applet... I should try it 06:40:29 cool, got a test button working in AWT.. now on the rest of the application :) 06:40:53 Ah, good ooooooooooooooool' AWT 06:42:10 especially the ooooooooool' part ;) 06:42:19 Hence the preponderance of 'o's ;) 06:43:50 this is java 1.4, for the record 06:44:26 I'm running Java pre-alpha 0.1, will it work for me? 06:47:18 hehe 06:47:41 SO, who wants to form the #esoteric chat room on DirectNet? 8-D 06:54:14 GregorR: are we moving? :) 06:54:28 No, I'm just trying to get users :'( 06:54:51 * calamari likes freenode 06:55:01 DirectNet isn't IRC :P 06:55:13 oh really? what is it? 06:55:22 It's DirectNet 8-D 06:55:25 heh 06:55:37 It's my instant messaging and chat system (shameless plug points +1) 07:07:14 * pgimeno goes to work 07:22:49 hmm it works.. kinda :) 07:23:41 * calamari attempts to remove a duplicate set of unwanted scrollbars 07:33:55 calamari: btw, a tricky keyevent bug has been fixed in gnu classpath and now esoshell can be used with it 07:34:16 there's still some repaint problem though, but it does not render it unusable 07:36:37 lindi-: cool! :) 07:37:02 I'm not quite sure that I 07:37:15 'll be able to restrict the cursor w/ AWT.. but I'm trying 07:43:11 calamari: why AWT? 07:43:39 lindi-: the applet does not seem to work at all with IE.. I'm hoping now it will 07:43:50 I should try it :) 07:44:28 also, I want to try to get it working for pgimeno 07:44:51 pgimeno? 07:45:09 yeah 07:53:40 hmm, I don't get it.. still doesn't work in IE 07:59:59 -!- clog has quit (ended). 08:00:00 -!- clog has joined. 08:13:14 well, it's running in IE, kinda 08:21:06 -!- sp3tt has joined. 08:22:29 i have no idea what pgimeno is 08:24:42 lindi-: pgimeno is a guy that hangs out in here :) 08:24:51 me, concretely ;) 08:24:53 re 08:25:02 pgimeno: hi :) 08:25:10 calamari: ah :) 08:25:14 thanks for the effort, calamari 08:25:38 pgimeno: try this (I'm very curious) http://lilly.csoft.net/~jeffryj/EsoShell-AWT/ 08:26:00 It looks terrible and doesn't work right.. but maybe it'll load? 08:27:10 it does load indeed and it looks terrible indeed ;) 08:28:01 cool.. it's "working" in IE 08:28:11 you have to click where the cursor should be :) 08:31:30 StringBuffer didn't have a delete method until Java 1.2.. lol 08:32:08 I bet there are plenty of these little 1.2+ bugs hiding everywhere 08:32:56 I repeat that this is 1.4 08:34:24 pgimeno: IE doesn't seem to like it unless it's 1.1 or below 08:34:36 * pgimeno tries 08:34:59 I mean the Java methods 08:35:09 maybe iut's the way I'm compiling it 08:35:55 hm, I see, IE does not load anything 08:36:15 really? works here (ie 6) 08:37:30 okay, now they work in reverse: EsoShell/ works in IE while EsoShell-AWT does not (IE 6.0.2600.0000.whatever, Java 1.4.2_06) 08:41:54 snapshot: http://www.formauri.es/personal/pgimeno/temp/esoshell.png 08:42:31 the truncation is there in the original 08:46:56 yeah thats the awt version.. I didn't bother fixing the size yet 08:47:17 k 08:48:24 what I'm trying to find out is whether I can actually run 1.2+ functions in IE.. I have Java1.4 installed so the answer should be yes 08:49:11 if so, then I can probably use the original Swing stuff 08:51:48 is bf supposed to work? 08:52:29 in the Swing version, yes 08:53:08 there are lots of awt bugs right now 08:53:52 "write once, run everywhere"... ha 09:00:49 pgimeno: sure, just use gnu classpath :) 09:05:07 I think I found my problem, at least.. it may be using Microsoft Java and not Sun 09:05:15 -!- sp3tt_ has joined. 09:05:51 yay for qemu 09:10:07 lindi-: gcj must have come a long way since the last time I used it if it can run Swing apps now 09:13:27 -!- sp3tt has quit (Read error: 145 (Connection timed out)). 09:47:30 cool.. my Java install was broken.. even http://kidsquid.com/EsoShell works in IE6 now.. boy is Sun Java slow compared to the Microsoft JIT.. took about 10 minutes to load the applet in qemu 09:50:24 I guess MS preloads stuff to create the illusion that it loads faster 09:51:19 This box has Sun's jdk-1.5/5.0/whatever, and it loads in a ~second. 09:51:41 man, google maps is so awesome 09:51:47 pgimeno: or it's so old that it only can use java 1.1 ;) 09:52:12 fizzie: yeah, same with my linux machine.. it's only slow in the emulator 09:53:42 pgimeno: any idea how to add the applet to the wiki? 09:53:54 lament; it seems to lack this thing called Europe. 09:54:30 hmm, I'm not sure that's possible directly 09:54:38 yeah, but i'm in america 09:54:48 calamari: it has 09:54:55 but it's just so completely amazing 09:55:19 you can switch to satellite view and get from anywhere to anywhere by scrolling the thing 09:55:50 the quality gets very shitty outside populated areas though :( 09:56:35 calamari: try asking graue 09:57:58 Mt. St. Helens 09:57:59 http://maps.google.com/maps?ll=46.197510,-122.187195&spn=0.212173,0.276031&t=k&hl=en 09:58:11 for spain we have http://sigpac.mapa.es/fega/visor/ 09:59:48 oh man los angeles is fucking HUGE 10:00:25 pgimeno: oh that's right.. hafta beg to upload files, don't I? hehe 10:01:08 well, you can get svn write permissions but that's not a wiki page by itself 10:01:38 http://maps.google.com/maps?ll=46.197510,-122.187195&spn=0.212173,0.276031&t=k&hl=en 10:02:22 i mean 10:02:23 http://maps.google.com/maps?ll=51.208649,-73.164825&spn=0.848694,1.104126&t=k&hl=en 10:05:15 -!- DMM has joined. 10:06:12 hi DMM 10:06:17 evening 10:12:12 I read about Homespring for the first time today. Wow... that just blew me away :-) 10:14:16 we've been wondering which of npiet or the perl interpreter is more correct according to the piet specs 10:15:07 oh... I haven't looked at them myself. What's the difference? 10:16:52 please see http://www.bertnase.de/npiet/picture.html 10:16:55 (bottom) 10:17:36 oh hi dmm 10:18:00 DMM: graue is afraid to use your fibonacci program as the logo 10:18:09 DMM: because the npiet page says it has a bug and doesn't work 10:18:27 (the page pgimeno just gave a link to) 10:18:34 I intended the npiet behaviour of sliding in a straight line 10:19:11 hmmm, there may be a bug :-( 10:19:23 It's hard to code in when you don't have an interpreter :-) 10:20:26 so you never actually checked the program? 10:21:21 not with an interpreter. There was none when I wrote them. I traced them by hand. 10:23:07 it might just need a black codel instead of the white one above the yellow block 10:29:27 I've just tried that and it prints 112 and exits 10:29:28 hmmm 10:29:33 hmm 10:29:40 hm 10:29:40 does Prelude qualify as a turing tarpit? 10:30:02 -!- calamari has quit (Read error: 110 (Connection timed out)). 10:30:04 it has 19 instructions 10:30:09 ten of which push numbers 0..9 10:30:16 pgimeno: please feel free to debug it properly :-) 10:31:49 112 implies it's traversing the loop once and then falling out 10:32:31 might need changing of the yellow codel below the blue loop entry point to another colour 10:37:15 I just like making the languages... actually coding in them isn't nearly as much fun. :-) 10:37:27 :) 10:39:07 I have some cool ideas for more non-textual languages 10:39:45 I'm kind of surprised that Piet seems to be the first one 10:40:37 I'd like to see a graphical language with graphical output 10:40:42 I want to do a Tetris-based one, where you drop different blocks into a well, and when the rows disappear, the configuration of colours in the row causes operations to occur 10:41:09 there're non-textual languages 10:41:22 aardappel made a bunch i believe 10:41:32 oooh 10:42:42 a Tetris-based lang could be NP-complete to code in :) 10:45:11 indeed he has. A lot of tree-based ones though... 10:46:47 reference for Tetris NP-completeness: http://theory.lcs.mit.edu/~edemaine/papers/Tetris_TR2002/ 10:49:52 hm 10:49:56 * lament creates http://esoteric.voxelperfect.net/wiki/Popular_problem 10:50:06 not sure if the article name is any good 10:53:26 good article. Yeah, there's no obvious name for it 10:55:17 * DMM ponders a quine in Piet... 10:55:47 hm 10:55:57 you never specify the format of input 10:56:30 it's "any lossless graphics format", pretty much? 10:56:31 numbers or characters :-) 10:56:41 oh, that... yeah, basically 10:57:10 i'm actually working (sort of) on a language where source code is polyphonic music 10:57:24 although ideally it's really just the colours. The encoding into a graphics format is just a way of representing the program, not the program itself. :_) 10:57:42 i'm so confused as to what format i would use that i doubt i'll ever implement it 10:57:54 oooh... I thought of a music-based language just yesterday. But I guess I'll let you do it first :-) 10:57:55 i'll just write programs and play them on the piano :) 10:58:06 well, i already have one as it happens :) 10:58:20 documented? 10:58:21 just not sure if it's good enough 10:58:22 no 10:58:23 well 10:58:27 have a look at Prelude 10:58:40 http://esoteric.voxelperfect.net/wiki/Prelude 10:58:53 Fugue will be the same, except with different intervals corresponding to different instructions 10:59:06 each "voice" is indeed a separate voice 10:59:10 note duration doesn't matter 10:59:47 interesting 11:03:50 I was thinking of a language based on actual music. Where the note, duration, key, time signature, etc are important 11:04:06 you'd write it on a stave 11:04:24 well, there's no reason to have EVERYTHING be important 11:04:34 well no... 11:05:05 Fugue you write on a stave. But the only thing that matters are the intervals (and the number of voices) 11:06:18 music notation is just way too packed with different kinds of info 11:06:22 wow, now you got the complete spec? 11:06:35 for Fugue? on 11:06:37 *no 11:06:49 well 11:06:59 i can just tell you the provisional list of intervals 11:07:23 i'm just afraid my provisional list sucks 11:13:52 * puzzlet is trying to learn Prelude 11:14:47 I got some TV to watch... later guys 11:15:10 lament: about ^ and v, does it pop the top value from current voice? 11:15:16 puzzlet: no 11:15:21 it doesn't pop anything at all 11:15:26 -!- DMM has left (?). 11:15:42 only ! and # would pop the top value? 11:15:44 yeah 11:16:59 ah, i get it 11:17:26 my thinking about a music-based language is that only note increases/decreases count as instructions; that allows for maximum expressiveness IMO 11:17:42 That's how Fugue will work. 11:17:54 nice! 11:18:01 I should just release the damn spec actually. 11:18:05 i like the () idea, looks like a pair of repeat bars 11:18:14 In fact, how about I do that. 11:19:19 what is your plan to notate down the music into a file? 11:19:32 No plans at all 11:19:38 I'm not planning to implement Fugue :) 11:19:54 that's sad 11:20:33 i wish to write a meta-code, which itself is a true fugue.. 11:21:16 haha 11:21:48 if Fugue code is written on midi, midi format doesn't have repeat bars. 11:22:18 why not write an implementation? just write a Fourier analyzer to interpret the sound coming to the soundcard; you could even whistle the programs 11:22:38 puzzlet: actually repeating a sound when the program is in a loop is kinda silly. 11:22:56 pgimeno: you can't very well whistle three-part polyphony 11:23:25 with the help of two other guys, you can :) 11:23:26 that's why we should do a pair programming 11:23:31 or trio programming 11:24:37 programming in pairs is part of the "xtreme programming" philosophy 11:24:56 i know. i was joking :) 11:25:22 hahaha 11:25:37 so, instead of handing the keyboard one to the other, they could both whistle at the same time 11:26:05 that can increase the production of code 11:31:56 I guess I should implement the rest of my Prelude Befunge interpreter. 11:32:58 okay 11:33:02 http://esoteric.voxelperfect.net/wiki/Fugue 11:42:33 interesting, indeed 11:43:12 though it needs too much information in my opinion 11:43:44 imagine the BF quine that starts with a lot of +++++++>++++>++++++++... 11:44:36 so write a symphony 11:45:18 note that ++++++++ is just three notes in Fugue 11:46:01 any third and an ascending minor sixth 11:46:01 I was thinking in the line of "note increment wrt the last" = 1; "note decrement wrt the last" = 0; "same note" = "repeat last symbol", and a minimalistic two-symbol language like whirl, iota or jot 11:46:34 oh 11:46:44 might work but notes would soon go out of range 11:46:50 audible range, that is 11:47:07 no, because you can always correct 11:47:14 by pushing a number and popping it 11:47:23 oh, then that's OK 11:47:32 i.e. any third + any interval whatever + repeat last note 11:48:01 you've forgotten to include it in the main list, btw 11:48:08 include what? 11:48:16 Fugue 11:48:19 oh 11:48:47 do we really need both the main list and category:language 11:49:25 Fugue is definitely harder to write nice-sounding music in than a language like you proposed 11:49:44 my idea was that the main list hold short one-line descriptions of each language 11:49:52 but who ever sad writing music should be easy :) 11:49:56 *said 11:50:35 I remember someone saying that most songs can be distinguished by coding the increments/decrements of notes in them 11:51:12 that's what suggested me the idea 11:52:50 bbl 11:54:42 lament, how do you define ' ' in Fugue? 11:55:05 there is no ' ' 11:55:13 you can have pauses 11:55:19 or long notes 11:55:34 then do note lengths matter? 11:56:06 only in that they establish what comes before what. 11:56:15 (or simultaneously with) 11:57:34 ah 12:07:04 -!- kipple has joined. 12:45:23 -!- Keymaker has joined. 12:45:45 . 12:46:55 .. 12:47:23 [.>] 12:49:48 ++ 12:51:13 [-] 12:51:15 :p 12:52:07 i'm reading about pygame 12:52:12 it's confusing when there are + and - signs all over what others say. 12:52:20 [20:47:57] +.. 12:52:21 [20:48:25] +[.>] 12:52:21 [20:50:50] +++ 12:52:21 [20:52:15] -[-] 12:52:42 w+h-a-t ++do +y-ou+ ++me-a+n++? 12:54:01 it seems it's server's problem 12:54:53 i see + and - signs everwhere in freenode, and even ACTION's don't look as what they should look. 12:55:58 that's strange 12:56:10 hm 12:56:24 I think it must be because of your IRC client 12:56:31 yeah 12:56:56 i use irssi. i checked rawlog, but there are the signs there too 12:57:49 and it just came out to happen yesterday when i restarted the client. no changes to configuration 13:05:51 Uh, strange. I don't see any +s. 13:06:00 (This is irssi, too.) 13:28:14 anyone know where i could find this file pygame-1.6.win32-py2.4.exe (windows pygame)? 13:28:19 can't download from official site 13:28:41 (404) 13:30:03 Well, http://www.willmcgugan.com/pygame-1.6.win32-py2.4.exe for example. 13:30:05 Says google. 13:31:05 google? is that some new search engine? 13:31:09 anyways, thanks 13:31:53 Keymaker, you must be kidding 13:33:55 ? 13:34:02 never heard of any google before 13:35:31 http://www.google.com/ 13:40:03 i was joking ;) 13:42:01 you scared me 13:47:23 :) 13:47:36 Since Keymaker just found the internet yesterday ;) 13:50:10 :) 14:14:10 -!- lament has quit (Read error: 110 (Connection timed out)). 14:23:32 -!- malaprop has joined. 14:24:19 -!- lament has joined. 15:52:23 kipple: seen movie "hawaii, oslo" 15:52:27 ? 15:53:47 yes 15:54:04 ah 15:54:07 was it good? 15:54:15 it was ok 15:54:22 ok 15:54:39 why? are you gonna watch it? 15:55:04 i just thought because it starts screening here and there reads it was huge success in norway 15:55:08 and maybe 15:55:42 it was a bit overrated IMHO. It got extremely good reviews here 15:55:50 ok 15:55:55 the story sounds interesting 15:56:56 or should i perhaps go to see "white noise"? 15:57:02 some new horror movie 15:57:13 don't know anything about that one 16:00:16 yeah 16:01:04 it sounds a bit cliché.. 16:01:18 or dunno :) 16:01:37 movies just tend to be cliché today because everything's done before 16:21:16 ok.. i'll go to see movie "hostage" 16:21:21 at 20:30 16:31:51 * sp3tt_ wrote a 4 page PDF on brainfuck >.< 16:31:56 I was bored. 16:36:19 :) 16:36:40 upload it somewhere, i'd like to read it later when it get back home 16:37:24 (i need to leave now because i booked the movie ticket from web so i need to get it before 19:30) 16:37:27 'bye 16:37:33 doh, Piet is troublesome in that inserting or removing an instruction means changing the whole program 16:37:37 later Keymaker 16:37:41 -!- Keymaker has quit ("I've seen this déjà vu before.."). 16:38:23 that's the issue of incremental instructions 16:39:49 it's easier to write a new program than to modify an existing one 16:40:33 I wanted to fix the fibonacci Piet program but I think that writing another one will be easier 16:41:41 I think that one which prints "ESOTERIC" will be OK to be used as a logo 17:24:08 -!- sp3tt_ has changed nick to sp3tt. 17:33:19 this Piet program prints "ESO": http://www.formauri.es/personal/pgimeno/temp/eso-big.png 17:35:41 pgimeno: nice 17:35:54 I'm sorry, I'm not much of an artist 17:46:23 Wow. 17:46:27 That's awesome. 17:48:17 nice pgimeno! 18:35:08 -!- wooby has joined. 21:11:50 -!- graue has joined. 22:09:57 -!- calamari has joined. 22:10:03 hi 22:10:33 hey 22:11:20 hio 22:11:34 hey lament, wooby.. what's new & exciting? 22:12:07 not much, working through a bison tutorial with the ultimate hope of fashioning a BF compiler 22:12:36 nifty 22:12:55 what will be the hll? 22:13:12 something you invent, or c-like? 22:13:53 what do you mean by hll? 22:14:05 i'm at the very start of this tutorial, you see :) 22:14:11 high level language 22:14:16 calamari: i'm guessing he wants to compile brainfuck 22:14:20 maybe I misunderstand what you're trying to do 22:14:37 lament: oic 22:14:52 lament is correct 22:15:14 my usual fun is compiling to bf, so I get easily confused :) 22:15:35 lol i know what you mean, i'm interested in that too :) 22:15:47 how about you, what's new and great 22:16:32 -!- sp3tt has quit (Read error: 54 (Connection reset by peer)). 22:19:01 wooby: http://esoteric.voxelperfect.net/wiki/BF_instruction_minimalization 22:19:38 wooby: I think that last step still needs a bit of work, though :) I'd like a way to modify every bit, not just every other 22:22:21 -!- Keymaker has joined. 22:22:24 hm, that's fascinating 22:22:27 pgimeno: looks great 22:22:31 calamari: wow!!!!! 22:22:34 that stuff is great 22:22:50 i don't remember if i have mentioned that before, i saw that link yesterday 22:22:56 (iirc) 22:23:24 Keymaker: thanks.. but I haven't really progressed much past BitChanger of a few years ago 22:25:33 but that's really good achievement too 22:26:43 I'm not sure that it's turing complete yet 22:28:11 for example (}()) should be like [-]<.. but it only gets it by luck 22:36:23 actually it'd be (()}) wouldn't it 22:44:48 -!- graue_ has joined. 22:49:05 hi graue 23:18:35 and btw, "hostage" was very good movie 23:21:20 hi calamari 23:26:11 graue: I'd really like to integrate EsoShell into the wiki. Would you like to work on it with me? 23:26:49 i'd rather not have executable code running out of the wiki 23:26:56 it's for information, not running programs 23:27:51 graue: your vision of the wiki is a bit narrower than I'd hoped for 23:28:28 I'm halfway wondering if you'll be pulling up those in-progress pages at any moment 23:30:29 now I realize it's your wiki, you're running it, and all that.. which I appreciate.. but perhaps if you're going to stifle the expressive purposes of the wiki we need to abandon your stranglehold and start a new wiki elsewhere 23:31:20 calamari: how exactly were you thinking of integrating the esoshell into the wiki? 23:32:05 kipple: when all this wiki talk started up again, it was suggested that it'd be cool to be able to experimentally test esolangs from the wiki 23:32:24 yeah, I know. I think it was me who suggested it... 23:32:39 add a prominent external link then 23:32:56 you could put it in the files archive and link to it from the wiki. 23:34:00 Speaking of wiki and files, what's the word on scheduled dumps? 23:35:10 help me out, how do i dump a mysql database from the command line? 23:35:40 there's a program called mysqldump 23:35:56 mysqldump -a -c -C-e --add-drop-table --delayed-insert -Q -u (username) -p(password) -h (host) (db-name) 23:36:10 er, there should be a space between -C and -e 23:36:26 and probably tag onto the end > filename 23:36:47 or pipe it to gzip 23:37:12 kipple: or bzip2 as it deals better with text 23:37:20 so true 23:37:27 doesn't bzip2 deal better with everything, not just text? 23:37:47 bzip2 deals especially better with text 23:38:04 lament: I don't know, I haven't done or seen good research. 23:38:19 would be nice if the images directory is included in the zip as well 23:38:52 or you could just download the one and only image from commons.wikimedia.org if anything happens 23:39:47 yes, but hopefully there will be more eventually... 23:40:25 then hopefully i can archive the images directory too, eventually 23:40:35 hehe. sure 23:40:42 -!- calamari has quit (Read error: 145 (Connection timed out)). 23:45:24 i'm getting an error 1044, access denied... when using LOCK TABLES 23:45:30 -!- calamari has joined. 23:46:26 wb calamari 23:46:50 hi wooby.. lost my connection 23:46:54 * calamari checks what he missed 23:47:49 graue: so you're saying that you're not going to host the files or the html to run them? 23:48:38 no, i'm not saying that; they could go in the files archive, or in a new area 23:48:53 i am saying they should not be part of the wiki 23:49:07 graue: why not? 23:49:41 because java applets are a huge can of worms 23:49:47 in what way? 23:50:08 i for one will not be able to use them; they'll freeze my windows 98 box, and on gnu/linux they'll give me ugly messages about installing nonfree plugins 23:50:20 it's silly to junk up a page like that, when the point is information 23:50:34 the applet wouldn't be on every page 23:50:53 graue_: sounds like your db user doesn't have access rights to lock the db tables 23:50:53 it'd only be on one page 23:51:13 but why not have that page in the files archive? 23:51:29 kipple: how does that work? you need html to run the applet 23:51:37 so? 23:51:46 the files archive is accessible with HTTP 23:51:51 so if it's just a file it can't be run 23:52:03 it defeats the purpose of being an applet 23:52:09 you just put both the HTML file and the JAR in the archive 23:52:57 whouldn't it look nicer to have the wiki framework around it? 23:53:07 I don't see the big problem 23:53:17 no, it would not look nicer to make the wiki display missing plugin messages and/or freeze my browser 23:53:47 graue: umm.. java doesn't freeze my browser.. fix your browser then 23:54:20 well, that's constructive 23:54:24 calamari: He's using IE, can't fix. 23:54:43 the applet would have to be on a page of it's own anyway, so people who don't want to run applets can just avoid that page 23:54:44 the machine is a pentium 2, it's old and slow 23:54:54 kipple: it would be 23:55:19 the point is my old, slow, broken computer can still access the wiki, because the wiki is just text, just information 23:55:28 but then again, that would not be much different from an external page 23:55:29 and you'd be able to edit it just like any other wiki page, to add content about ysing the program 23:55:48 so add that content to the EsoShell article 23:56:00 the instructions and program shouldn't be on the same page 23:56:19 um, I disagree 23:56:34 * calamari had so many plans for this.. so frustrating to be blocked by ignorance 23:56:47 it's very nice to have instructions on the same page, so you can simply scroll down when you need to look at them 23:56:47 you aren't blocked 23:56:58 using an external page is not a blockade 23:57:30 here's an idea.. don't go to the EsoShell wiki page ;) 23:57:39 what if i want to read about it? 23:57:46 then read about it 23:57:57 what page do i go to to just read about it? 23:58:10 the EsoShell page 23:58:14 :) 23:58:22 anyhow... 23:58:30 which you just told me not to go to 23:58:37 it'd be nicer to have separate pages for different languages 23:58:51 it's not that hard: files archive (and hypothetical other sections of site) = stuff, wiki = descriptions of stuff 23:59:01 for exmaple, a page full of bf programs to copy and paste in while running the applet 23:59:11 then i encourage you to add a link at the bottom of each language, pointing to the convenient interpreter for that language 23:59:49 graue: you still haven't said what is so wrong about allowing a Java applet directly on the wiki 2005-06-10: 00:00:01 umm. I think he has... 00:00:19 he has told me how he has a slow computer.. that's about it 00:01:27 * calamari gives up then 00:02:20 when I have time, I'll start a new wiki that is more user friendly 00:17:27 ok, let's try this again 00:17:36 there is "stuff", and there is "info about stuff" 00:17:58 a program is "stuff" 00:18:15 the wiki is for "info about stuff" 00:18:18 Is an example program stuff or info about stuff? 00:18:57 And I'll note that I don't see any reason the wiki can't also store "stuff". 00:19:09 me neither... 00:19:29 the reason is that "stuff" can crash your computer, or require a certain operating system, or eat up your RAM 00:19:35 "info about stuff" is just information 00:19:50 my slow computer is one of many possible examples of why mixing "stuff" and "info about stuff" is a bad idea 00:20:18 i am quite happy to store relevant "stuff" on esoteric.voxelperfect.net, if people are interested in having it there 00:20:22 If you don't want "stuff", don't download it. If your web browser lets websites crash your computer, it is broken, period, and should not be used as the baseline for everthing. 00:20:54 i don't think websites should have programs in them at all 00:21:23 does that mean every website with a java applet is broken, period? or is my opinion NOT the final say on what is or isn't broken? 00:21:38 Looking at the existence of Flash, I've got to say that almost every else in the world disagrees with you on that one. 00:22:27 that's exactly my point 00:22:54 your opinion that my "broken" web browser should not be accommodated is not law, either 00:23:15 Your opinion on what is broken is invalid because you're not seeing that it's your browser that's broken. It's like the ethnic joke where the guy goes to the doctor and says "My leg hurts when I poke it, my chest hurts when I poke it, my head hurts when I poke it" and the doctor responds "Your finger is broken." 00:23:51 -!- graue_ has quit (Read error: 145 (Connection timed out)). 00:24:05 I'm not trying to be mean or insulting, just point out that web apps are not uncommon or inherently bad. 00:27:15 that doesn't change the fact that they don't belong on a wiki 00:27:30 there is nothing hard about the concept of separating content from information about that content 00:27:41 that's not a "fact", that's your opinion... 00:27:52 They do belong on a wiki, the wiki has file support for just that reason. 00:28:08 the wiki has file support to store images 00:28:59 graue: why does the esoteric wiki have to fit into the "normal" wiki.. we're supposed to be out there, right? :) 00:29:00 -!- graue_ has joined. 00:29:09 Dividing data and metadata is arbitrary. If you're providing both, provide them together. 00:29:47 And MediaWiki does not have file support just for images; otherwise it would not be possible to upload anything but images. 00:29:59 that said, I can understand graue's reluctance to change his wiki.. he started that wiki before we all got together and started decided things.. so it isn't quite fair to ask him to change what was already there 00:30:43 I disagree. I'm asking because I see straightforward ways to make things better. Is very much in the wiki spirit. 00:32:18 -!- wooby has quit. 00:32:45 malaprop: I think graue has his own ideas about how a wiki should be run, and doesn't want to change those to fit what the rest of us would like.. that's totally his choice tho. That's why I think it might be best to choose to start fresh 00:33:20 I'd rather build up than start again from scratch. It's why I'm such a pain in the ass. 00:33:52 please, let us not end up with two competing wikis! 00:34:40 And on that note, I unfortunately have to go. I may be online again in a few hours or it'll be tomorrow morning (~13h). 00:34:46 cya malaprop 00:34:47 * malaprop idles. 00:42:46 having to put something one mouseclick away is a very stupid thing to fork a wiki over 00:44:13 graue: I don't see it that way, exactly.. this one item certainly isn't a dealbreaker. What gets me is how you do not seem to care about the opinion of the rest of the community.. we had a lot of plans that were made together, and you singlehandledly vetoed those plans when we decided to go with your server. 00:46:01 graue: we were going to have file uploading, but you didn't want that, until we complained so loudly you couldn't ignore it.. this java applet thing was in the works pretty much from the very beginning=, we we're going to have multiple wikis, etc.. 00:46:50 which is totally fine for your own server.. hey you're the boss.. but I don't think you're being very cooperative 00:47:30 and so, in the future, when something needs to be done.. I'm sure it will be the same way 00:47:57 i have vetoed all of one plan, put forward by two people; there is no problem moving the java applet one mouseclick away; the multiple wikis idea was rejected with everyone's agreement because it wasn't practical; file uploading is a feature that was implemented separately from the wiki with everyone's agreement who happened to speak up 00:48:30 you're blowing a lot of hot air and it's silly, just for one extra mouseclick people will have to make to get to your java program 00:49:24 graue: I recall things differently 00:49:49 everyone wanted to be able to uplaod files, only requiring a user account 00:50:15 you were the only one that wanted all the sql beg you to upload file hoops 00:50:16 revolution!!!! 00:50:34 lament: hehe 00:50:51 * calamari isn't upset, btw :) 00:50:56 people of the world rise against graue's tyrannical rule 00:51:01 *peoples 00:52:21 lament: I see no problem letting him run his wiki the way he wants to 00:53:18 I think we should have left it that way from the beginning.. it was a mistake, is all. His wiki predates the whole eso preservation thing 00:54:32 that is true. 00:58:15 i actually started my wiki to preserve esoteric languages 00:58:27 it just took a while for people to become interested 01:25:24 personally it took a backup solution to become interested. otherwise Wikipedia would have been better 01:26:41 i still think ftp would be the best 01:26:51 :) 01:32:52 ftp for a wiki? 01:32:57 you mean for the files, right? 01:35:16 probably 02:04:11 i mean, we don't actually need a wiki. 02:11:58 well, I've discovered the reason I can't get a file list for my applet's help program.. http doesn't support getting a file list.. hehe 02:12:57 -!- kipple has quit (Read error: 145 (Connection timed out)). 02:14:50 with webdav it does 02:14:58 but that probably isn't exactly practical 02:15:37 make .listing files? 02:15:53 yeah.. it'll have to be something like that 02:23:45 -!- graue_ has quit ("brb"). 02:23:54 the built in commands don't change much, unless a new language is added 02:24:51 it'd be cool to have some kind of programs page that it automatically loaded up, so you had a bunch of example programs to run. Would need to be a wiki though, otherwise content would be nonexistent 02:28:06 -!- wooby has joined. 02:28:12 re wooby 02:28:21 was just thinking about your idea 02:28:31 me too :) 02:28:32 I think it can be done 02:28:35 any ideas? 02:28:39 it'll just need to be in one file 02:28:45 what mechanism do you propose for referencing code? 02:29:09 yeah.. have a certain wiki page, for say BF programs. Then, a program on the page would look something like 02:29:49 name: myprogram.b 02:29:54 code: ....... 02:30:09 then the program could parse the page to grab the programs 02:30:42 i see 02:31:05 I think you were hoping for something more interractive? 02:31:12 i was thinking more along the lines of storing code fragments in a db table, with author, description, and usage information 02:31:31 oic, so like a library of bf snippets? 02:31:40 yeah exactly 02:32:00 the problem is it would be so difficult to come up with a standard for handling return data 02:32:44 it also wouldn't work well for languages such as Befunge that are two-dimensional 02:33:10 i'm beginning to think it wouldn't work well in general 02:33:22 but it's still a cool idea for a wiki page 02:33:38 suppose you had a code fragment recognized by the interpreter as 1, which say... converts a cell value to ascii value 02:33:43 could save your neatest bf tricks for posterity 02:33:53 so you could do like +++1 => 3 02:34:17 that would work cleanly because the return value is only a byte 02:36:44 I wonder if I could rig file writing to automatically edit the wiki.. that'd be cool, permanent storage 02:37:23 actually, just the close operation would want to write anything 02:37:26 haha wikiFS ;) 02:38:01 yeah.. it'd be cool.. because you could edit it yourself, or you could use the applet, and it's just plain text on the wiki page to view 02:39:45 i'd imagine javascript to be conducive to interactive lang interpreting, at least for BF 02:39:51 do you consider that an option? 02:47:32 sorry.. was afk. java or javascript seem file.. both are client side though.. I chose Java because it was more powerful 02:47:49 s/file/fine/ 02:50:47 yeah 02:53:15 ha, just perusing the bfbasic readme 02:53:29 'randomize' would be an interesting function to implement 02:57:27 'lo all 02:58:04 hio 03:00:53 How goes? 03:01:28 * wooby abides 03:24:42 wooby: it was fun :) 03:37:35 -!- graue_ has joined. 03:38:36 Hola sen~or graue_. 03:38:49 Please mentally combine the n and ~ ;) 03:38:57 will do 03:40:41 I suppose the fact that you're now logged in as graue_ instead of graue suggests that you didn't get my response in #directnet ? 03:40:54 ah, nope, but i'll go see what it was 03:41:55 -!- graue has quit ("this client is obsolete"). 03:42:22 -!- graue_ has changed nick to graue. 03:42:33 #directnet just lost its peak user count ;) 03:54:10 -!- calamari has quit (Read error: 104 (Connection reset by peer)). 03:55:46 you know, i gotta say calamari's idea for loading programs from a wiki page is pretty cool 03:56:43 i wonder if it could be accommodated by creating a new namespace 03:57:06 Dern too much talking... 03:57:12 Mind making a brief of the idea? 03:57:15 you'd go to "Brainfuck" and say "hey, this seems cool" and follow the esoshell link to the "EsoShell:Brainfuck" page with the programs and stuff 03:57:38 calamari has made a small fake shell program as a java applet, and it has esoteric language interpreters 03:57:44 Yeah, I know that much. 03:57:46 the idea was so people could try new languages out conveniently 03:57:49 Right. 03:58:00 recently he mentioned loading languages automatically from a wiki page 03:58:16 like you could put a "99 bottles of beer" example in the "EsoShell:Brainfuck" wiki article (or whatever) 03:58:25 and the shell would be able to load it directly 03:58:31 that is my understanding 03:59:01 so, any idiot could add a cool program to test out 03:59:08 Why not have the wiki itse---because some would need input. 03:59:12 Yay answering my own question! 04:00:17 i wonder if calamari would go for the "EsoShell:" namespace idea 04:00:35 -!- calamari has joined. 04:00:39 hey calamari 04:00:44 we have been talking about you 04:01:00 please to read http://tunes.org/~nef/logs/esoteric/05.06.09 and catch up on the discussion 04:01:01 hi graue 04:01:28 sorry.. was getting ready to go out.. gotta watch star wars again :) 04:01:35 great 04:01:40 well, check it out later then 04:01:55 short story: i think it would be cool if you did your java applet thing in a new namespace on the existing wiki 04:01:57 I'll check it now :) 04:02:00 like, "EsoShell:Brainfuck" etc 04:02:01 oh 04:02:07 okay 04:02:13 that would be interesting 04:02:20 brb .. reading 04:04:02 that sounds great.. I was actually wondering how to pull that off while in the shower hehe 04:04:39 my previous idea of being able to edit old files from esoshell might cause problems.. but saving new ones should be okay 04:05:11 dunno.. it all depends on what I can get the wiki to tell me 04:05:40 I know in moin it would tell me when the page was locked and that I had a certain amount of time to make my edit 04:05:53 that sort of thing 04:06:11 the only thing I'm afraid of is that popluar things to run would be locked all the time 04:07:10 mediawiki doesn't lock anything; if you try to save an edit based on an out of date revision, it just tells you there's been a conflict 04:07:26 does it allow you to resolve the conflict? 04:07:38 or do you just lose it? 04:07:49 i'm not sure, exactly... i'd have to try it again, but i think it possibly does 04:08:37 lets find out.. http://esoteric.voxelperfect.net/w/index.php?title=User_talk:Calamari&action=edit 04:08:42 I'm editing that page 04:09:13 someone do a quick edit and then I'll save mine 04:09:26 okay i did one 04:10:07 interesting 04:10:19 it gives the new text in an upper text area 04:10:24 and the old in a lower one 04:10:48 well, it works at least 04:10:50 that's cool though 04:10:52 yeah 04:10:56 it's enough.. 04:11:11 at least EsoShell can know that there was a conflict and work with it 04:11:28 and it's good because people won't be ablke to lock others out 04:21:41 -!- wooby has quit. 04:25:57 graue: just did a quick test 04:26:18 graue: as long as the page I'm reading is from the same base url as the applet, I can read it 04:26:55 so, I could read http://lilly.csoft.net/~jeffryj, even though the applet started from http://lilly.csoft.net/~jeffryj/EsoShell 04:27:06 I could not, however, read http://www.google.com 04:27:54 is that going to be an issue at all with what you had in mind for setup? 04:29:15 actually.. even if it is, it's cool and I want to write it anyways.. hehe 04:31:56 huh.. weird.. when I view source on the wiki, I don't get everything 04:32:31 nm.. must be blind 04:33:03
how convienient! 04:34:36 any thoughts on how to wrap the filename and source? need to think about 2d languages, whitespace.. etc :) gotta run 04:34:42 -!- calamari has quit ("Leaving"). 04:41:41 -!- wooby has joined. 04:51:37 -!- GregorR has quit (Nick collision from services.). 04:52:05 -!- wooby has quit. 04:52:07 -!- GregorR has joined. 05:26:21 -!- malaprop has quit ("sleep"). 05:28:09 -!- graue has left (?). 06:03:53 Bwarhar 06:45:31 okay 06:49:37 :P 07:42:14 esoshell page crashed firefox 07:59:59 -!- clog has quit (ended). 08:00:00 -!- clog has joined. 10:18:22 good morning 10:18:30 i felt asleep :D 10:18:52 i just went to bed for a while and slept ~11 hours 10:19:01 :\ 10:29:58 hi, seems that I missed an important conversation about 8 hours ago 10:31:10 lament: are you using multiple profiles simultaneously? my mozilla crashes if I don't open the java applet in the main profile 10:31:36 -!- sp3tt has joined. 10:35:12 no, i'm not 10:40:22 -!- Dc[Fkn3] has joined. 10:40:36 -!- Dc[Fkn3] has left (?). 10:42:13 what was the conversation about? 10:43:14 Keymaker: about esolangs and the wiki 10:44:42 -!- sp3tt has quit (brown.freenode.net irc.freenode.net). 10:45:18 -!- sp3tt has joined. 10:46:02 I think that graue's idea of a separate namespace is a nice solution for everyone 10:48:42 I personally like most of the current directions of the wiki, and given that a solution that is universally accepted is impossible, I think that that's about the best that we can have 10:49:00 yeah, I think it's a neat idea 10:49:02 except for the backups, but that's currently being worked on 10:52:46 that said, there's an issue with the files section that needs a solution: some esolang authors may disagree with their distributions being hosted there, so permission should be gathered before posting files there (those which are explicitly FOSS don't need a permission, I think) 10:53:38 that's about the only showstopper for the preservation effort 10:53:39 though you'll want to tag them with whatever the correct license is 10:54:17 isn't that usually included within the distribution? 10:54:31 good point... maybe a generic tag that says "this file is not necessarily within the public domain" 10:54:48 hm, yeah 10:55:55 the script that gathers the svn head and makes it public could perhaps add such a tag 10:56:16 with "makes it public" I mean in the files/ dir 11:03:19 -!- Keymaker has quit ("I've seen this déjà vu before.."). 11:04:06 one more issue about the "java on the wiki" (hope it can be sorted out): I don't like everyone being able to upload and use java applets in every page; that should be restricted to privileged users or something 12:08:10 -!- kipple has joined. 12:15:43 pgimeno: I agree that java applets upload should be restricted 12:16:42 otherwise, it seems like a lot happened here while I was asleep :) I like the ideas for the EsoShell that came up! 12:17:03 EsoShell? 12:17:11 You mean like... command.com? 12:18:30 no, I mean this: http://lilly.csoft.net/~jeffryj/EsoShell/ 12:42:12 kipple: nice, seems that there's consensus after all 12:46:54 yay, I've managed to fix the fibonacci generator in piet without modifying the whole program (white cells are cool) 12:48:19 now it turns out that 100 Fibonacci numbers are too much for the range of an int 13:01:51 http://www.formauri.es/personal/pgimeno/temp/piet/fib.php 13:02:01 err 13:02:04 http://www.formauri.es/personal/pgimeno/temp/piet/fib2.php 13:07:23 damn, the colors are not equal 13:07:34 equal? 13:08:05 seen the page? when I compare the original and mine, I see different colors 13:08:12 -!- malaprop has joined. 13:08:15 probably a gAMA chunk 13:08:57 yes, there are some minor differences. does it matter, as long as it works? 13:09:20 not at all, but I'd like equal colors to match for proper comparison 13:09:35 gAMA chunks don't alter the RGB of each color 13:19:06 indeed, that was because of a gAMA chunk present in the original; now I've uploaded the fixed version 13:19:28 corrected and resubnitted ;) 13:22:17 so, what was the conclusion? is npiet implemented correctly? 13:25:07 I think so 13:25:33 that's not actually related to the program itself; DMM said he didn't have an opportunity of testing it 13:25:43 he wrote it without the help of an interpreter 13:27:00 that program won't work in the perl interpreter because of the handling of white blocks though 13:27:06 yes. that's a useful tool for checking if the language design is ok, before implementing it 13:27:26 ok. so is the perl interpreter wrong then? 13:28:16 I think so; the spec is pretty clear and even if there's a bit of room for reinterpretation I think it's too forced to interpret that in the way that the perl interpreter does 13:29:04 anyway, fixing it is just a matter of adding a pixel :) 13:29:10 so I think I'll do that 13:31:05 hm, I'm wrong, it's two pixels 13:50:28 resubnitted 13:50:50 that one should work with the perl interpreter too 13:54:05 I'm not totally sure though 14:06:09 the issue with npiet is that cells are 32-bit integers instead of bignums, so fibonacci numbers greater than the 45th one don't come out well 14:06:22 does perl handle bignums? 14:07:39 without the aid of a library, that is 14:25:50 As far as I know, it doesn't. The bitwise operators use integers (32-bit here), and afaik most arithmetic is done using floats. 14:26:23 Judging from what 'man perlop' says about Integer Arithmetic. 14:27:44 Although Math::BigInt apparently is part of the standard. 14:46:16 thanks; I don't know if the perl interpreter uses that 15:58:41 -!- Keymaker has joined. 15:58:56 hi. 16:00:08 low. 16:10:43 :) 16:27:13 is piet turing complete? 16:27:27 i'm too lazy to search information by myself 16:28:37 i'm lazy too but i guess so 16:28:50 just guessing 16:29:21 ok 16:58:11 I'm pretty sure it is 16:59:54 at least if the stack is able to hold bignums 17:00:40 And you have infinitely extendable canvases to paint 17:00:56 that's not needed, I think 17:01:42 as soon as you have a canvas with an UTM program in it, you have a Turing-complete language 17:04:22 I would have said that it's a pushdown automaton, but I recently saw that BF just needs a few (5 at most, 2 at least) cells with arbitrary integers in them to be TC 17:04:36 http://www.esolangs.org/wiki/Brainfuck#Computational_class 17:05:26 and the stack rotate operation makes Piet able to handle the stack as a finite amount of variables 17:05:41 hm, that should be stated in the wiki 17:05:58 I'll go for it 17:12:45 the stuff in esowiki is interesting 17:13:09 it'll be quite cool afterall! :) 17:27:02 -!- graue has joined. 17:35:35 lament: is that 'smallfuck to smetana' stuff anywhere? 17:35:42 or have you written anything about it? 17:35:50 i'd be interested in reading 17:50:01 -!- calamari_ has joined. 17:50:07 hi 17:52:20 'ello 17:53:59 oy 17:54:05 hi 17:54:16 can one just edit the esolangs wiki? 17:54:22 i'd like to add some stuff 17:54:25 please do! 17:54:49 ok. i'll do so. after the dinner ;) 17:54:50 it is nice if you create an account before editing, but not mandatory 17:54:55 ok 17:55:00 i'll do that 17:58:10 i brought the dinner here :) 17:58:53 please avoid food stains on wiki articles 17:59:07 oops too late :) 18:13:22 by the way, is it allowed edit User:Keymaker page? :) 18:13:31 yes 18:13:43 hah 18:13:48 then i'll modify 18:15:10 you can edit practically any page (including other users' pages) 18:17:45 yes 18:17:45 but i meant that is it ok if edit it.. 18:17:45 that you people don't count it as self-advertising or anything 18:17:45 (only linkin' two of my websites ;)) 18:18:19 that's what the user pages are for! don't expect that anyone else will edit it 18:19:19 do you have user page? 18:19:24 (haven't checked) 18:20:08 http://esoteric.voxelperfect.net/wiki/Special:Listusers 18:20:08 http://www.esolangs.org/wiki/User:Keymaker 18:20:26 cool 18:20:39 (i meant your link) 18:48:16 Keymaker: here is what you probably shouldn't do: http://esoteric.voxelperfect.net/wiki/User:Calamari how's that for overdoing it? :) 18:51:02 hehe 18:51:05 I think that is a nice user page. 18:51:09 yeah 18:51:12 i added a new page: 18:51:13 http://www.esolangs.org/wiki/Hello 18:51:54 Keymaker: http://z3.ca/~lament/smetana_sf.tar.z 18:51:56 oops 18:51:59 Keymaker: http://z3.ca/~lament/smetana_sf.tar.gz 18:52:39 cheers 18:53:11 Hah. Who needs Hello when we have HQ9+ ? ;) 18:54:27 hq9+ was great :) 18:54:40 I just checked out Hello's home page and thought: "what? an esolang made by a woman? can it be?" 18:54:50 but it wasn't 18:55:00 yeah. just a guy named Anne 18:55:32 too bad, i was almost contacting the person until i read that :) 18:55:43 if I was nammed anne I'd make esolangs too 18:57:04 esolangs are an exclusively male activity 18:57:05 very macho 18:57:31 well, most of you guys (okay, me too) have nicks which makes it impossible to know your gender, so maybe there are some women here as well... I've just assumed you're all male (probably very sexist of me) 18:58:15 lol @ lament :p 18:58:20 :D 18:58:28 kipple: Or you've been on IRC for more than ten minutes. 18:58:48 heh 18:59:12 efnet has women 18:59:17 "IRC. The place where men are men, women are men, and 16 year old girls are FBI agents" 18:59:31 heh 18:59:35 case in point 18:59:35 hehehe 18:59:38 efnet doesn't have women :P 18:59:53 don't remember where that quote is from though 18:59:59 either the way, we need females here. 19:02:15 well, if there are any, I expect they pretend to be male. 19:02:35 Why pretend? Folks will assume just fine on their own. 19:02:47 touche 19:13:52 so, I'm curious.. how can we display a whitespace program on the wiki without using images? 19:14:35 I'm not sure you can 19:14:39 I could invent some kind of escape code, but that wouldn't work well for a 2-d whitespace, if there is ever such a thing 19:15:09 um 19:15:14 there're women on IRC 19:15:21 there even are women on Freenode 19:15:35 but to expect women in #esoteric is clearly a bit too much 19:15:42 :) 19:16:56 It would be possible, but I don't think you ought to. 19:18:00 That is, with whitepsace. 19:18:09 Gregor: you are the only one here who explicitly identifies yourself as a male. Got something to hide??? ;) 19:18:29 * GregorR detaches his/her artifificial penis 19:18:45 ah, you were talking about whitespace :) 19:19:08 cpressey is a known male :P 19:19:24 gregorR: I'd like to automatically feed programs from the wiki into esoshell.. but does the wiki allow arbitrary chars like that? 19:19:41 Ahh, I see. Doubtful. 19:20:08 how about a mini preprocessor table at the top.. so that you could set a=" ", b="\n", etc 19:20:09 I don't know, I guess ... If there's some equiv. to
, it should be happy.
19:20:11  maybe there is some 
 equivalent?
19:20:19  Ahahaha :P
19:20:22  great minds, etc...
19:20:23  maybe, that would definitely be best
19:21:31  anyone remember how to set expert mode in ircii?  
19:22:03  I guess since I don't remember means I am non-expert.. so.. brb :)
19:22:12 -!- calamari_ has left (?).
19:24:04  this esolang wiki editing is fun
19:25:19  
 works!!!
19:25:32  does it maintain TAB characters?
19:26:33  yes
19:26:41  see test here: http://esoteric.voxelperfect.net/wiki/User:Rune
19:27:36  you can't enter tabs directly in the editor (at least not in my browser), but pasting works fine
19:28:32  Keymaker: how exactly does the digital root thing work?
19:28:39  cause it doesn't do anything
19:30:39  oh, i see
19:30:42  you had DOS linebreaks
19:36:46  mh where?
19:36:58  digitalr.t
19:37:01  ah
19:37:02  yes
19:37:14  they were breaking the interpreter
19:37:21  i used the ready-compiled dos interpreter
19:37:21  presumably it works in windows
19:37:26  oh
19:37:29  i was using the python one
19:37:32  ok
19:37:41  (is it the same one?)
19:37:47  i don't think so
19:37:56  iirc it was in original thue package
19:38:47  ah
19:39:06  indeed, yes
19:39:27  the code should be fine
19:39:35  (digitalr.t)
19:40:23  anybody know if whitespace it TC?
19:40:23  yeah
19:40:28  it works after i changed the linebreaks
19:40:32  ok
19:40:43  interpreter's fault :)
19:41:45  well, you can't expect any reasonable piece of software to recognize dos linebreaks :)
19:42:39  yes
19:42:40  true
19:42:51  :)
19:44:07  but dos linebreaks include char #10, so it should work on most systems, no?
19:44:51  kipple: what should work?
19:45:04  dos linebreaks...
19:45:27  kipple: no, dos linebreaks will work on dos and on especially forgiving editors on real operating systems
19:46:01  But a whitespace nterpreter should read: \r - this must be a comment, ignore ... \n - line break
19:46:05  And hence work regardless.
19:46:22  yes. exaclty my point
19:46:25  (Well, unless you use MacOS <=9 linebreaks)
19:46:42  did they change it in OS X ?
19:46:50  Yeah, it's UNIX linebreaks now.
19:47:07  nice. If only MS would do the same
19:47:21  No, they're just going to make them longer :P
19:47:37  GregorR: neither 0xA or 0xD are named "line break". 0xD is Unix is carriage return. 0xA is line feed.
19:47:39  It'll be CR-LF-PageB-tab-tab-space-lf
19:47:46  and \n = 0xD
19:48:19  malaprop: From a UNIX-centric whitespace nterpreters standpoint, \n = linebreak.
19:48:24  That's what I meant.
19:48:37  ok
20:17:08  i made a logo for esowiki, featuring esododo:
20:17:09  http://koti.mbnet.fi/yiap/stuff/esolang.png
20:17:29  (although the creature doesn't probably look like dodo)
20:17:32  hey! the dodo is back :)
20:17:48  :)
20:18:46  i just thought it could be fun/look nice. i don't like that yellow flower so much
20:19:30  Keymaker: The yellow flower is the logo for MediaWiki.
20:19:35  yeah. several people have been making logo suggestions. maybe we should have a contest
20:20:13  ok
20:20:25  btw, anyone got link?
20:23:59  pgimeno has been using piet programs
20:24:20  ah yes
20:24:23  saw one today
20:24:28  I think he meant to use the fibonacci program, but the eso-program would be much better IMHO
20:24:33  did you see that?
20:24:34  hmm.. what about random logo?
20:24:45  yeah
20:24:53  random logo could be nice
20:24:55  kipple, i like your last spoof
20:25:15  I made some spoofs of the wikimedia logo: http://rune.krokodille.com/lang/logos.html
20:25:26  yeah, and i like the fourth one
20:25:38  yes, I've heard, graue :)
20:26:17  there are a lot of variations that could be done with that theme...
20:26:29  why does the dodo face away from the page?
20:26:42  it'd be looking off the side of the screen
20:26:58  well, dodos are stupid birds... :)
20:28:18  and the other reason is i simply just can't draw anything :D
20:30:20  sorry for the late answer, got an unexpected visit of my parents right after pressing enter in the last line I wrote
20:30:37  :)
20:31:22  I have both corrected DMM's Fibonacci program in Piet and created one which reads (and prints) "ESO" but then don't need to be used as logos
20:31:34  s/then/they/
20:31:58  http://www.formauri.es/personal/pgimeno/temp/piet/fib2.php
20:32:09  http://www.formauri.es/personal/pgimeno/temp/eso.png
20:32:23  argh, broken, hold a sec
20:32:26  someone needs to make a three instruction language: [, ], and yellow flower
20:32:34  then we can say the mediawiki logo is a program
20:32:36  hahaha
20:32:53  the lang could be called Flower Power
20:32:56  http://www.formauri.es/personal/pgimeno/temp/eso-big.png
20:38:14  the eso logo is really nice
20:38:23  hehe. mmh flower power..
20:39:57  thanks
20:40:51  it can be reduced at will; it's not fixed-size (though an integral number of pixels per codel is recommended)
20:42:17  graue: can file upload permissions be established?
20:43:24 * Keymaker goes trying to make music
20:43:34  (with 'buzz' tracker)
20:46:17  pgimeno, er what?
20:46:48  for the wiki, I mean
20:47:34  it's not permitting you to upload?
20:47:50  I've been reading yesterday's log about the possibility of a separate namespace for EsoShell
20:48:11  I like the idea very much but I don't like everyone being able to upload and post java files
20:50:29  so if file permissions can be established for some users I think that will be safe
20:58:57  yes. it should be restricted to admins
20:59:53 -!- calamari_ has joined.
20:59:54  re's
21:05:12  hi calamari_ 
21:05:22  hi pgimeno :)
21:31:03  rgh..
21:31:07  making music is so hard
21:31:11  better just listen :)
21:31:59 -!- sp3tt has quit (Read error: 54 (Connection reset by peer)).
21:46:30  keymaker: what type of music are you composing?
21:47:48  dunno could one call it composing..
21:47:53  well, hard to tell
21:48:38  monotrack/schranz
21:49:03  with industrial flavour
21:50:05  sounds interesting
21:50:15  hope so
21:50:20  only song i've finished
21:50:25  is about half a year old
21:50:33  and made with different program; modplug
21:50:49  it's called "radiation machine"
21:51:13  it's monotrack
21:51:27  i guess i could upload it if you want to hear it.
21:52:55  oh. and the track must be heard loud. if you listen that one low it doesn't sound good. preferably with good speakers
21:53:09  you gotta feel the bass
21:53:17  yeah
21:53:31  it isn't very danceable, i warn
21:53:38  but ok, i'll upload it now
21:54:03  thanks
21:55:02  i'm now uploading, takes a while
21:55:24  sure, don't worry
21:55:39  as i haven't made up any artist name the artist is "factory esthetic".. :\
21:55:49  (so don't care about crappy naming!)
21:56:04  heh
21:56:09  as well, the file is "radiation beta" although it's done :)
21:56:30  I have just an unfinished one
21:56:42  music?
21:56:49  yes, module
21:56:56  ok
21:57:16  I ran out of ideas :)
21:57:36  :)
21:57:39  ok, here it is:
21:57:40  http://koti.mbnet.fi/yiap/stuff/radiation beta.mp3
21:58:12  as warning, again, it's not very good!
21:58:24  why don't you upload the module?
21:58:41  because i have added some effects with audacity
21:58:52  that's cheating
21:58:56  add the effects properly
21:59:05  i can't. don't listen then :p
21:59:35  graue: so, about the permissions...?
21:59:54  i don't think that's possible
22:00:09  umm
22:01:01  that's a problem IMO
22:01:42  can a wiki page hold a java program that is not an uploaded file?
22:02:02  i.e. in a different URL (the files section)
22:02:25  (np: factory esthetic - radiation machine)
22:02:34  ?
22:02:40  ah now playing..
22:03:25  sounds good
22:03:30  thanks!
22:04:26  maybe a bit too exaggerated the bass IMO, unless you want to break my window :)
22:04:32  haha :)
22:06:07  cool
22:06:15  cheers :)
22:06:22  I like it
22:06:25  i like the ending "sequence"
22:06:31  like where the beeps go off
22:06:44  can't explain..
22:06:50  pgimeno, possibly
22:07:30  that'd be safe enough (for me at least)
22:08:18  Keymaker: you can hardly explain music, if at all
22:08:37  true
22:08:40  but yeah, the ending sounds good
22:09:13  :)
22:14:23  hmm
22:14:35  i should start making some content to bf-hacks.org
22:14:42  new program or some text
22:14:58  but i'm not that good writing about math/computer subjects..
22:15:10  so perhaps i'll just program something
22:15:24  or then start writing the first issue of the brainfuck magazine
22:15:41  either the way, i'll switch to linux now, takes some mins..
22:15:43 -!- Keymaker has quit ("I've seen this déjà vu before..").
22:20:20 -!- Keymaker has joined.
22:20:28  hmm
22:26:34  can't invent name..
22:50:12 -!- calamari_ has left (?).
22:50:24 -!- calamari_ has joined.
22:52:35 * calamari_ reads scrollback
22:53:21  I don'tthink I'm following very well... but one thing for sure is that the class file and wiki pages need to be at the same url, or Java freaks out with security exceptions
22:53:47  anything at the same url is fine, but if the url changes any, Java won't allow it
22:53:59  err host I should say, not url
22:54:11  is the host going to change?
22:55:05  ah, no it isn't
22:55:10  I think they can be made relative
22:55:58  the only issue with that is that there are two possible servers for the URLs: www.esolangs.org and esoteric.voxelperfect.net
22:56:06  then I think we're okay.. the current class file prints a bunch of html garbage.. that is http://lilly.csoft.net/~jeffryj  but the class file was run from EsoShell/
22:56:27  pgimeno: as long as the redirect happens before the java file runs, it's okay
22:56:38  for example, try http://kidsquid.com/EsoShell
22:56:45  only if they can be really relative
22:56:57  they're not redirects
22:56:58  otherwise that's an issue
22:57:06  yeah, won't they be?
22:57:19  can you examine the host that was given in the http request?
22:57:53  graue: Java doesn't care what I look at.. once it makes up its own mind, we're stuck with that decision, afaik
22:58:09  see what I'm saying?
22:58:26  it decides what the codebase is
22:58:31  graue: my concern is just if the  or  or whatever tag is used allows relative paths; if that's possible then there's no issue, and I'm pretty sure it is
22:58:38  actually.. hmmm 
22:58:48  in the html, it is possible to specify the codebase
22:59:01  so I can tell it the codebase is on a different host than the html
22:59:18  that can work.. as long as the code is actually where I'm telling it
22:59:27  anyways.. I need to get going
22:59:30  bbl
22:59:31 -!- calamari_ has quit ("Leaving").
23:08:42  wow
23:08:45  this is crazy
23:09:38  http://www.de.ioccc.org/2004/gavare.c
23:09:43  IOCCC entry
23:09:59  it creates a bmp
23:10:07  like it's a raytracer
23:10:14  amazing
23:18:23  is that valid C?
23:18:39  dunno, it gave me couple of warnings
23:18:43  but not errors :)
23:19:17  wow
23:19:24  indeed
23:19:33  we need similar program in brainfuck ;)
23:19:42  the variables aren't even typed...
23:19:58  do they default to int then?
23:20:05  have you ran the program?
23:20:09  no
23:20:11  ok
23:20:13  try it out
23:20:17  I will
23:20:27  and i don't know, probably they default to int
23:20:40  Untyped variables are ints.
23:20:41  something about int was said at ioccc iirc
23:20:54  ok
23:21:14  variables only default to int in C89 and C95
23:21:18  in C99, that program would be invalid
23:21:48  One of my homework exercise solutions used untyped variables.
23:22:14  a,b=0;main(){read(0,&a,1)?b=b*2|a&1,main():printf("%u",b);}
23:22:44  great
23:22:44  Keymaker: did it take long to run on you rcomputer?
23:23:17  not long
23:23:22  maybe about minute or two
23:23:33  maybe three
23:23:43  well, my linux box is 187 MHz, so I guess I'll wait...
23:23:48  yeah :)
23:23:54  do you think we should have articles for language inventors on the wiki?
23:24:05  do you know what the A parameter is for?
23:24:07  or then you can terminate the program and change the values in the beginning of the code
23:24:12  to get smaller picture
23:24:19  (less time, less space ;))
23:24:28  isn't that the X and Y params?
23:24:37  and no idea about A
23:24:46  The 'A' value is an anti-alias factor. Setting it to 1 disables the anti-aliasing feature (this makes the output look bad), but setting it too high makes the trace take a lot more time to complete.
23:24:51  http://www.ioccc.org/2004/gavare.hint
23:25:16  so just make x and y smaller
23:26:50  graue: perhaps some of them
23:27:02  like urban müller!
23:27:10  and cpressey seemed to be
23:27:12  but is there really much to say?
23:27:15  wanted on the list
23:27:16  of
23:27:22  (no :))
23:27:25  something
23:27:29  can't remember
23:27:40  probably it was "wanted pages"
23:27:42  a short paragraph about Urban could be on the BF page
23:27:44  or something
23:28:12  yeah. well, seems to be we don't know much about this genius
23:28:20  but i'm gonna find out someday
23:28:25  by sending e-mail :)
23:54:48  http://www.esolangs.org/wiki/Esolang:Authors
23:54:52  discuss

2005-06-11:

00:30:53  lalala
00:51:58  graue: any progress on the automated DB backup?
01:36:28  i'm waiting for lock tables permission
01:36:39  supposedly it can be provided to me
02:16:34  http://esoteric.voxelperfect.net/db/latest.sql.bz2
02:18:37  it should now update on sundays at about 00:01 UTC, maybe a little later
02:19:50  great
02:20:22 * malaprop sets up a mirroring script.
02:20:31  How about svn dump?
02:23:25  um, just check it out
02:23:42  So you want me to start hassling you again as soon as someone commits a revision, eh? :)
03:17:46 -!- calamari has joined.
03:18:21  hi
03:18:38  Hullo
03:36:10 -!- kipple has quit (Read error: 110 (Connection timed out)).
03:59:56  graue: latest.sql.bz2 seems to be 0 bytes in length
04:05:28  does it?
04:05:31  brb investigating
04:06:13  funny, it's 449514 bytes on the server
04:06:31  I do 'wget http://esoteric.voxelperfect.net/db/latest.sql.bz2' and get http 200 but 0 bytes.
04:06:48 -!- CXI has quit (Connection timed out).
04:07:04  yeah, me too
04:15:37  try http://esoteric.voxelperfect.net/db/latest.sql.gz
04:16:17  still 0b
04:16:47  really? works for me
04:17:19  Really, from two different systems.
04:18:57  well, seeing as how it works fine for me, i can't do anything about that
04:19:45  Are you trying from that machine itself?
04:21:53  no, i am not
04:23:14  Works fine for me.
04:24:28  doesn't work even from a new, third host
04:26:36  ah, hm, .gz works but .bz2 is 0b?
04:26:45 * malaprop didn't notice the changed extension at first.
04:27:31  ah, that's why i gave you a url :)
04:27:59  It looked the same at first glance, heh. Why gz instead of bz2?
04:29:27  because gz files don't get served as 0 bytes
04:30:09  lol
04:35:42  I've got a cron job and simple page set up, I'll post to the mailing list after dns propagates a bit.
05:16:26 -!- malaprop has quit ("quit").
05:27:44  esoshell wiki writing testbed: http://lilly.csoft.net/~jeffryj/cgi-bin/miniwiki.cgi
05:34:22 -!- Keymaker has left (?).
05:50:12  what does that do, just change itself?
06:04:50  graue: yeah.. it's handy because I can access it from lilly.csoft.net while testing out the wiki file i/o
06:05:28  since Java has those security restrictions
06:05:32  ah, i see
06:08:16  graue: I still haven't decided on the format.. what do you think of what I just added?
06:09:02  works i guess
06:09:17  not very pretty, though :)
06:09:33  you will have to escape < into <
06:09:50  even inside pre?
06:09:56  yeah
06:10:05  how else do you think "" works?
06:10:11  heheh
06:11:44  that might get annoying for authors typing in programs by hand, or pasting them in
06:12:29  most text editors have find and replace
06:13:20  aha.. mediawiki takes care of that for us
06:13:31  hmm, a brainfuck and html polyglot would be fun
06:13:49  except that it's not possible because html has to have < before any >s
06:13:58  
06:14:12  You can put < and > in those, just not -->
06:14:25  that < will be illegal in brainfuck since it goes to cell -1
06:14:29  graue: I might not understand.. I did 
 <<< 
and mediawiki translated the < to < 06:14:39 calamari, cool 06:15:01 what if you do
  
? 06:15:32 works fine 06:15:40 interesting 06:16:07 I guess the only restriction is that the file couldn't contain 06:16:37 I'm not sure that's such a big deal :) 06:16:50 nope 06:17:04 Damn, that first < think is a real toughy XD 06:17:22 If you started with >++ you'd be fine, but that may make it unhappy ... it would probably be illegal HTML, technically. 06:18:56 GregorR: I'll be stripping off the
 and 
before bf sees it 06:20:16 calamari: I was referring to the HTML-BF polyglot 06:21:27 GregorR: aha :) 06:42:05 graue: http://esoteric.voxelperfect.net/wiki/Help:Editing has no help documents.. is this a work in progress? 06:42:49 calamari, how did you get there? 06:43:46 graue: any edit page, click down at the bottom where it says (Editing Help) opens in new window 06:44:00 err, have the parens wrong.. but that's the idea :) 06:45:53 http://esoteric.voxelperfect.net/wiki/Help:Contents also 06:46:04 that's any page click "Help" on the left 06:56:56 -!- CXI has joined. 07:05:57 god what is with all the redundant pages 07:06:27 i made an Esolang:Help, but Help:Editing and Help:Contents should just be the same thing 07:09:28 i redirected the other two now 07:16:07 -!- calamari_ has joined. 07:16:18 re's :) 07:21:13 graue: http://esoteric.voxelperfect.net/wiki/User_talk:Calamari 07:21:13 better, worse? 07:21:13 cool, it works 07:21:29 you can make user subpages 07:21:39 e.g. "User:Calamari/esoshell_tests" 07:21:41 argh, I messed up that link on the help page 07:21:52 oh yeah? I'll have to try that :) 07:22:16 oh god, man, you didn't read the page you were editing! 07:22:32 it clearly states that that section is called "External resource", not "External Links" :) 07:22:40 graue: lol 07:24:46 oops, conflict 07:28:07 btw, can only admins revert pages? or is revert just a cute name for copying & pasting the old page back in? 07:32:13 revert is a cute name for changing a page back by whatever means, yes 07:32:33 however, admins get a convenient link to do this automatically, when looking at a diff 07:32:39 all it does is make it faster for them 07:33:00 -!- calamari has quit (Connection timed out). 07:38:09 hehe, having those file extensions is probably unnecessary :) 07:38:50 maybe a description area would be helpful too 07:39:35 I need to go to bed.. feel free to improve upon the current design 07:40:10 -!- calamari_ has quit ("Leaving"). 07:54:41 -!- graue has left (?). 07:59:59 -!- clog has quit (ended). 08:00:00 -!- clog has joined. 09:15:41 -!- sp3tt has joined. 09:21:37 Is it possible to do division in bf? 09:22:01 i think so 09:22:54 It should be possible using the same code as multiplication... 09:23:00 sp3tt: brainfuck is turing-complete 09:23:02 so yeah, it is :) 09:23:36 just need to know the algorithm... 09:24:45 >+++++[<+++++++++>-] 5 * 9 09:25:25 iteratively subtracting until the number goes down to 0, and counting how many subtraction has been done? 09:25:38 <[--------->>+<-<] 09:26:09 That would divide by nine, but how do you handle situations where there is a remainder? I.e where x % y != 0. 09:26:18 [-[-[-[-[-[-[ 09:26:24 yeah 09:26:38 but it's better to write a general algorithm 09:26:42 to divide X by Y 09:26:47 where X and Y are two numbers on the tape 09:27:06 True. 09:28:11 implementing the algorithm is left as an exercise for the reader. 09:29:05 Google search for brainfuck division turns up German wikipedia. 09:29:45 Heh. I wrote a 5 page PDF about brainfuck (in Swedish) leaving Hello world as an exercise for the reader :) 09:30:32 I have discovered a truly remarkable implementation, which this margin is too small to contain. 09:30:56 it certainly doesn't sound hard. just keep subtracting. 09:31:25 or store your numbers as rationals :) 09:31:35 then division is the same as multiplication 09:32:24 One could write a nested loop, subtracting one until the cell contains 0. 09:32:56 When the loop has subtracted one Y times, add one to a third cell. 09:33:20 And when the loop is finished, calculate the remainder in some way. 09:34:18 the remainder will just sit there 09:34:24 in whatever cell you were using for subtraction 09:46:03 That would require a check to see if y > x 10:11:55 -!- starling has joined. 10:12:39 -!- starling has quit ("pop"). 10:39:17 -!- kipple has joined. 11:08:08 moin 11:24:33 hola 11:32:36 -!- sp3tt has quit (Read error: 104 (Connection reset by peer)). 11:58:11 -!- Keymaker has joined. 11:58:21 rgrg 12:02:59 is that finnish for "hello"? 12:03:58 No, that would be "hei" or something. 12:04:14 "tervehdys", perhaps, although that's closer to 'greetings'. 12:04:39 you say "hei" in Finland as well? 12:04:54 Uh, yes. 12:05:19 In Norway too 12:06:33 It is an useful greeting when mingling with swedish-speaking folks, since their "hej" is pronounced quite similarly. 12:09:35 Away to eat now. -> 12:14:16 ah. hei kipple! 12:14:35 hei 12:14:39 heh 12:15:16 i found interesting site; http://freesound.iua.upf.edu/ 12:15:20 it has allkinds of sound samples 12:15:29 well, that was a nice small Finnish/Norgwegian polyglot conversation :) 12:16:22 haha 12:30:02 Keymaker: nice link 12:30:21 very nice, Keymaker! reminds me of the free images site... http://www.openclipart.org/ 12:31:18 thanks pgimeno! I like 12:38:22 np, enjoy the world of free resources :) 12:38:57 nice 12:39:21 :) there's good machine sounds etc on that page.. that's what i was looking for and finally found a nice source :) 12:39:33 i'll try to get something done with some samples 13:03:45 Keymaker: what kind of software do you use for making music 13:08:32 i use buzz tracker 13:08:37 it's really cool imho 13:08:40 totally freeware 13:09:06 the only bad thing is that there is so much stuff that i don't know what to do 13:09:26 it's filled with allkinds of things and options 13:09:40 and audacity for sample stuff 14:07:43 -!- puzzlet has quit (Read error: 104 (Connection reset by peer)). 14:10:14 -!- puzzlet has joined. 14:16:24 -!- puzzlet has quit (Read error: 104 (Connection reset by peer)). 14:39:23 -!- puzzlet has joined. 14:51:51 ok that's enough musicing for today. 14:52:04 i lose my nerver 14:52:10 *nevers 14:52:13 fck 14:52:18 *nervers 14:52:21 *nerves 14:52:28 can't tpye 14:52:37 too nevrous? :) 14:52:37 bad keyboard? 14:52:43 :) 14:52:52 yes 14:53:06 the keyboard's fine 14:53:34 i'll go to eat. then i'll switch to linux. then me comes back. 14:53:40 -!- Keymaker has quit ("I've seen this déjà vu before.."). 14:57:50 -!- Keymaker has joined. 14:58:26 rgh. so it is true: if you eat too much candy before the actual food you don't feel like eating the actual food 14:59:32 you finished eating in 5 minutes? 14:59:46 no. i brought the dinner here again :) 15:01:51 i'll listen some prodigy. i hope i could make their kind of music a bit.. it's so crazy :) 15:11:38 i added bf-hacks to esowiki brainfuck links 15:11:46 hopefully nobody minds 15:27:56 i added two small sample programs to thue oage 15:27:59 *page 15:28:08 they should be correct, although i didn't test 15:43:38 you forgot to log in before editing... :) 15:44:07 aaaaaaaaargh 15:44:16 frrrrrgh 15:45:02 maybe the wiki should be editable for users only? 15:45:35 oops, iirc 'editable' means something that can be eaten :) 15:45:50 or perhaps not 15:45:52 no, that's edible 15:45:55 yes 15:46:01 just remembered that 15:46:08 i wonder what i'm thinking today 15:46:13 i've been all crazy 15:46:15 :) 15:46:26 well, too bad the wiki isn't edible 15:47:02 only the chef programs 15:47:11 :) 15:48:56 i'll try to think more about the snack language i was planning 15:49:00 * Keymaker thinks 16:03:14 -!- malaprop has joined. 16:10:20 yes! 16:11:12 i think i got some idea 16:11:12 time to write good ol' python 16:15:05 is 'snack' good name? any other idea for a language that deletes it's own code? 16:15:27 Keymaker: SourceSafe 16:15:35 :D 16:15:55 or well, it doesn't delete the actual source from hard drive 16:15:58 (too bad!) 16:16:04 but from memory 16:46:58 -!- cpressey has quit (brown.freenode.net irc.freenode.net). 16:48:03 -!- cpressey has joined. 16:51:04 -!- cpressey has quit (brown.freenode.net irc.freenode.net). 16:52:35 -!- cpressey has joined. 17:01:07 question: 17:01:31 if stack is empty, should popping return error or zero/empty/do nothing? 17:02:12 Pretty arbitrary. I've seen both commonly. 17:02:17 yeah 17:02:55 do something completely different! 17:03:16 empty stack returns random value? 17:03:22 hehe 17:03:30 that could be nice 17:03:39 or start popping the source code :) 17:03:42 would add some random flavour to the language 17:03:51 well source is popped all the time ;) 17:03:59 print 99bob 17:04:04 heh 17:04:16 then that could be written with one instruction.. 17:04:24 random could be nice 17:04:28 yeah 17:04:37 if there is another way of checking if the stack is empty 17:05:04 not yet 17:05:17 i'm still planning while writing the interpreter 17:05:45 maybe you could have an boolean operator that checks if a number is 'random' :D 17:05:52 heh 17:06:22 btw; would reversible stack be okay for two stacks? 17:06:26 like there is one stack 17:06:36 but instruction '/' could reverse it 17:06:50 and that way the other side of the stack could be popped and pushed etc.. 17:07:05 that would be a nice instruction 17:07:10 yes 17:10:12 interesting contest: http://www.brainhz.com/underhanded/ 17:10:26 (might be slashdotted any moment now) 17:11:19 hehe 17:55:27 kipple: Yes, is now on Slashdot. 17:55:48 I know, that's where I found it 17:59:18 ah, I read your comment to say it was yours or a friends and you were waiting for /. to post a story on it 18:00:23 ah. No. I was waiting for the server to go down from the slashdot effect. Which it hasn't :) 18:03:59 malaprop 18:04:06 how to reverse string in python? 18:06:49 "foo"[::-1] 18:07:08 So you slice the whole thing with a negative step, basically. 18:07:17 ah cheers 18:07:19 works 18:11:45 snack is progressing! 18:14:40 any code examples? 18:15:21 mmm. Python looks cool. Maybe I'll use that for my next esolang 18:16:25 not yet 18:16:29 hopefully later tonight 18:16:31 and yeah 18:16:43 python is my favourite "real" language thesedays 18:16:44 kipple: Python rules. :) 18:16:50 i found it out few days ago 18:16:54 :) 18:17:18 in python strings and stacks and stuff like that is so easy that it's idea for esolang interpreter writing 18:17:24 *ideal 18:17:44 Keymaker: Heh, have you used list comprehensions at all? They're my favorite new idiom. 18:17:55 hmm no i don't think so 18:17:57 what are those? 18:18:22 Say you have a list full of objects that you want to do a common operation on. Instead of writing 18:18:28 for x in list: 18:18:35 x.foo() 18:18:38 you can write: 18:18:45 [x.foo() for x in list] 18:18:51 :) 18:19:06 which gets really handy when you do stuff like "\n".join([x.toXML() for x in list]) 18:19:11 yeah 18:20:17 i selected to this language that popping empty stack returns nothing 18:20:32 and probably make the random feature for memory stack 18:20:42 this language has two stacks 18:20:50 oh, conditionals are also handy: [x.foo() for x in list if x.bar > 2] 18:21:00 :) 18:48:57 -!- comet_11 has joined. 18:50:01 -!- CXI has quit (Read error: 104 (Connection reset by peer)). 18:56:44 -!- graue has joined. 19:00:03 phew! finished the first part of the Malbolge article 19:00:11 cool! 19:00:14 is it up? 19:00:57 yeah 19:01:05 http://www.esolangs.org/wiki/Malbolge 19:01:22 cool, i'll read it now! 19:01:35 it's just a language description at the moment 19:01:54 ok 19:07:05 good work 19:07:20 thanks 19:07:41 is it easy enough to understand? 19:07:52 yeah, i guess 19:08:01 all but the code samples :) 19:08:10 hehe, indeed 19:09:26 even 'reading' the normalized version requires external help (a trace is helpful) 19:09:34 heh 19:10:26 so, Keymaker, when is the Malbolge quine done? 19:10:32 uhhh 19:10:40 :) 19:10:53 thanks heaven i haven't even thought that 19:11:26 hehehe 19:11:39 (nor digital root calculator!) 19:11:41 * pgimeno considers about offering a prize 19:11:51 http://esoteric.voxelperfect.net/db/latest.sql.bz2 19:11:52 it should now update on sundays at about 00:01 UTC, maybe a little later 19:12:01 so can it be announced to the mailing list? 19:12:23 I'd guees so. Mention that I'm doing backups. 19:12:56 Keymaker: you may want to add the digital root program to http://www.esolangs.org/wiki/Popular_problem 19:12:59 I'll set up a cron job as well 19:13:00 oh, and it's .gz, not .bz2 19:13:07 that would be cool pgimeno 19:13:17 although dunno how popular that is 19:13:23 but it's worth being popular ;) 19:13:25 malaprop: well, I managed to download the .bz2 without problems 19:13:35 maybe an apache caching issue or something 19:13:53 i'll add it 19:13:58 huh, and now I can get it 19:14:21 graue: which of the archives is the one that gets updated? 19:16:56 the null program is not a quine in malbolge: it crashes the reference interpreter due to a(nother) bug 19:17:17 -!- slobo has joined. 19:17:38 hi slobo 19:19:10 that nick sounds reminiscent of a not very fast language 19:20:42 hi 19:20:44 ? 19:21:12 hi 19:21:45 http://en.wikipedia.org/wiki/SLOBOL_programming_language 19:22:57 lol, didn't know this :) 19:23:41 :) 19:25:28 brb, taking down one bottle of beer from the wall 19:26:08 -!- slobo has left (?). 19:27:00 :) 19:27:05 how many left? 19:27:49 too few 19:28:10 "go to store and buy some more" 19:28:20 :) 19:29:44 the counter is still in 4 19:29:59 ok 19:38:21 -!- calamari has joined. 19:38:34 hi 19:38:45 hi 19:38:55 ok here it is: http://www.esolangs.org/wiki/Digital_root 19:41:18 anyway, if anyone wants to try and implement the Song with real hardware (or should I say liquid-ware?), here is the place to do it: http://www.mommsen-eck.de/ 19:41:45 you wont have to drink the same kind twice :) 19:41:58 :) 19:42:35 though you might get some run-time errors, I think... 19:42:43 i have a feeling any hardware couldn't get past 50 bottles before serious malfunction 19:43:02 or well, past 20 19:43:12 well, I think the way to do it would be with parallell processing 19:43:21 :) 19:44:05 ahh, didigtal root is the division by 3 test 19:44:19 hm? 19:44:40 that's the way you can tell if a number is divisible by 3 19:44:50 (besides actually doing the division) 19:44:52 ah 19:44:59 i didn't know that 19:45:02 cool 19:45:03 so if it comes out to 3, 6, or 9, it's divisible 19:45:09 yeah 19:48:27 I should add a page to the bf giving algorithms, like division for sp3tt 19:48:41 that could be nice 19:49:14 N.B. the digital root is also a test for divisibility by 9 (if it comes out to 9) 19:50:31 pgimeno: cool, didn't know that one :) 19:50:41 does it work for 6 as well? 19:50:47 nope 19:51:00 for 6, check that it's even and it's divisible by 3 19:51:22 right, because 2*3=6 19:51:30 yup 19:51:37 so now we know the /18 rule :) 19:51:44 sure :) 19:52:58 also, if a number's last two digits can be divided by 4, then it's divisible by 4; if it's also divisible by 3, then it's divisible by 4*3=12 19:53:42 pgimeno: I don't think that works for 144. 19:53:51 oh, whole number div 3? ya, ok 19:54:21 144=4*4*9, quite more complex 19:54:40 (requires that the last four digits can be divided by 16) 19:58:08 this regexp tests divisibility by 4 (if I've made no mistake): ^[0-9]*([13579][26]|[02468]?[048])$ 20:01:59 no, it does not work 20:03:36 ^([0-9]*[13579][26]|[0-9]*[02468][048]|[048])$ should work (there was a problem with the ? above) 20:08:46 would these instructions be good: 20:09:10 'i' to increase memory stack's top value by 1 20:09:28 'I' (big 'i') to increase memory stack's top value by 10 20:09:47 and 'd' and 'D' to decrease by 1 and 10 20:10:19 but i wouldn't like to use letters 20:10:27 better think something else.. 20:11:05 or should i use the befunge way? polish notation (was it called that)? 20:11:54 like 99* would push 9 to stack and then 9 to other stack and then pop them and multiply them and then push the result 20:12:05 Keymaker: ya, that's rpn 20:16:54 grhhh. i just use the gooood ol' + and - stright from brainfuck :) 20:17:03 nobody needs more than that 20:21:26 hmm 20:21:29 what should i do: 20:21:36 Keymaker: How about have integer literals repeat? So + adds 1 to top of stack, and +9 adds ten. 20:21:48 that could be nice idea 20:22:03 but i decided that using the "loop" system i have is easy enough :) 20:22:42 i was about to ask that i probably should use good ol' byte as memory 'cell' size? 20:24:13 i hate bytes 20:24:18 be original 20:24:21 use base 9 or sometihng 20:24:25 hmm 20:24:28 Be a man, use unicode. 20:24:34 NOOOOOOOOOOOOOOOOO 20:24:37 and yeah 20:24:40 :) 20:24:42 puzzlet will kill you if you don't use unicode 20:24:55 do you really want to be mauled by a mob of angry koreans? 20:24:58 is there still no language using balanced trinary? 20:25:12 don't make me use bits.. 20:25:18 pgimeno: that would be surprising 20:25:28 pgimeno: wasn't there an actual computer using balanced trinary 20:25:38 no idea 20:25:58 is there? 20:26:14 * pgimeno googles 20:26:52 well, there was a ternary computer 20:27:00 i have no idea if it was balanced ternary or some other kind 20:27:05 it was made in russia 20:27:16 iskra or something? 20:27:20 :) 20:27:35 no, probably something else 20:28:06 http://www.computer-museum.ru/english/setun.htm 20:28:11 yeah 20:28:27 wow 20:28:35 indeed 20:28:38 yeah 20:28:40 never heard of this 20:28:55 very little actual detail in that article 20:29:25 maybe it's some soviet secret 20:29:27 i wonder why there aren't more ternary machines 20:29:44 the article seems to list a bunch of unilateral advantages 20:34:00 does setun use balanced ternary? I haven't seen that 20:36:15 i'll take a small break from developing esolang -- and go to program in thue :) 20:36:31 i probably come back later 20:36:37 -!- Keymaker has left (?). 21:13:14 http://www.esolangs.org/wiki/Brainfuck_algorithms 21:15:11 argh.. I wasn't logged in.. 21:15:41 it seems to random forget I'm logged in.. I blame my browser 21:24:20 there's a timeout 21:24:52 if you refresh any page you reload the timer 21:25:57 can that be disabled? 21:26:41 brb 21:26:43 -!- calamari has quit ("Leaving"). 21:39:00 -!- calamari has joined. 21:39:01 re's 21:40:13 calamari: I don't know if that can be disabled; I learned the trick after noticing the disconnections 21:40:45 I've just read your page; very nice 21:41:09 it's good to have 'stock' algorithms instead of reinventing the wheel each time 21:42:23 one comment though 21:43:24 I've noticed that the PRNG works modulo 65536, but LCGs modulo a power of 2 suffer from a "nonrandomness disease" 21:44:36 in the best case, the lowest bit just toggles from 0 to 1 on each iteration, and the next one just cycles like this: 0, 0, 1, 1 21:45:29 (sorry for the ping, I wanted to make sure you weren't disconnected) 21:46:20 the alternative is to use a prime modulus, and 65537 is just nice because it allows for period 65536 21:46:45 it will complicate the algorithm, though 21:48:29 A = 75, B = 74 make V always < 65536 (that's the PRNG used in the Speccy, incidentally) 21:49:41 (sorry if I'm being a bit picky here, PRNGs are an area of my interest) 21:51:26 pgimeno: I used the numbers from the book listed.. they investigated many different combinations of numbers to come up with those 21:51:53 modulo-2^n LCGs are quite common, though, aren't they? Knuth uses a modulo-2^35 one. 21:52:23 yeah, but e.g. the low bit of the high byte has period 256 21:52:25 pgimeno: I'd love to see a better solution (especially if it's simpler!) :) 21:52:48 (in the period-65536 generator I mean) 21:53:03 calamari: no, it won't be simpler :) 21:54:05 fizzie: Knuth also warns against using the low bits in LCGs modulo powers of 2; he recommends using multiplication to get a number in a given range 21:54:10 I'm still working on putting up my array code, but it will take longer because I need to make sure it's right :) 21:54:39 array code is always so complicated 21:55:36 That's the usual rand(3) manpage warning. 21:55:59 that problem disappears with a prime modulus LCG 21:57:24 (though maximum period for prime M is M-1, not M) 21:58:54 (Hmf, glibc's rand() apprently isn't a LCG.) 22:00:06 I've learnt to never trust standard library's PRNGs anymore :) 22:01:41 that way you can make reentrant generators, predictable results, better period guarantees... 22:02:23 and of course better randomness guarantees 22:02:39 do you know Kyodai Mahjongg? 22:03:27 in that game there are lots of board numbers that generate exactly the same board 22:04:34 just because the period is insufficient and the generation method is a RN hog 22:06:50 calamari: maybe the book authors just didn't consider a modulus other than 65536 22:07:04 perhaps 22:07:15 it's been a long time since I coded that up 22:07:42 it seemed to work fine.. I checked it out in basic first to see what kinds of numbers were produced 22:08:15 and you didn't notice that they were alternatively odd/even? :) 22:08:25 they weren't 22:08:48 well, did you print the values of V? 22:09:09 if you're assuming that the produced random # is16-bits wide, thats an error.. I'm only using 8 bits of it 22:09:35 oh ok. that's the high byte then, right? 22:09:41 I don't recall 22:10:02 looks like it (from the bf) 22:10:16 it must be, otherwise it would be odd/even 22:10:56 feel free to post an improved algorithm.. then everyone can benefit 22:11:10 -!- starling has joined. 22:12:03 might do, if I clean my to-do list a bit first :) 22:13:09 hehe 22:13:15 there, I clarified the rng a bit 22:13:29 now it says 0-255 and hight byte 22:13:40 nice 22:14:03 ok, back to arrays.. afk :) 22:14:08 :) 22:16:35 I know this is probably the wrong place to ask... 22:17:01 Esoteric certainly, but... maybe not in the brainfsck style. 22:17:50 Are the perl and c malbolge interpreters equivalent? 22:18:53 Is there a language out there that doesn't treat text special unless explicitly marked as such? 22:19:03 special? 22:19:13 Yeah, like "as a variable" or "as a keyword" or something. 22:19:43 The only language I can think of really (or not really) is perl's print < PHP requires a $ in front of all variables; Perl requires $ in front of scalars and @ for hashes. 22:20:57 But you can't have unquoted text that isn't meaningful, at least in Perl. The compiler won't know what to do with 'em. Thus the < ahhh 22:21:14 brainfuck 22:21:42 Nah, all of brainfuck's 5 letters are treated special. :) 22:21:53 Fine then: cat 22:22:18 Can't explicitly mark text as special with cat... 22:22:42 Ah, think I got it: Python's docstrings. 22:23:12 docstrings, are those parsed at all? 22:23:34 Look at doctest, ya. 22:23:45 Alternately, Knuth's literate programming. 22:24:09 * starling nods. 22:26:33 Are the perl and c malbolge interpreters equivalent? <- I don't really know; the C interpreter has some caveats 22:27:13 but in general you can expect that programs with characters in the printable ASCII range will work the same 22:27:24 I've written a Python one (and a debugger) 22:31:50 starling: even Perl (or sh) makes the EOT string special 22:32:10 or do you mean "user decidable"? 22:32:56 Well, user decidable I suppose. I suppose it's possible to make the end of file to act as EOT in some cases. 22:33:26 sh is one 22:34:06 It's just I'm trying to write a screenplay, and I have to invent my own language for it. Wanted some functionality, without worrying about every word possibly being variable expanded. 22:34:38 The only extant formats I can find are all 'output' formats, with margin lengths and font and such. 22:36:10 Python docstrings don't fit there very well, if I understand the problem correctly 22:36:38 don't C comments fit? 22:36:41 Yeah, perl's < or C #if 0 ... #endif ? 22:37:18 No, because sometimes I do need to have stuff evaluated, like to mark-up or do logic. 22:38:35 and doesn't */ evaluate /* help? 22:39:05 Oh... Yeah that... might actually work. 22:39:46 I suppose it's also necessary to be able to juggle blocks of text around as atoms. Hmm... 22:39:52 it's kind of like when in PHP you write: 22:40:16 maybe php fits your needs 22:40:24 I'm using it as a preprocessor 22:40:46 *nods* I don't know PHP, but it might work good. 22:41:43 php outputs text until it encounters , then it begins outputting text again 22:41:53 -!- Keymaker has joined. 22:41:56 hello 22:42:01 hi Keymaker 22:42:06 hi 22:42:07 Right-o. 22:42:14 good work calamari 22:42:37 not sure what kind of array code you're writing there 22:42:49 but simple array is easy 22:42:49 +++++++++ what value? 22:42:49 > ++++++++++++++++++++++ where? 22:42:49 [ 22:42:49 >>>[>>]+[<<]<- 22:42:49 ] 22:42:51 < 22:42:53 [ 22:42:55 > >>>[>>]<+<[<<] <<- 22:42:57 ] 22:43:23 that code moves the "what value?" value to "where?" memory place 22:43:41 each location uses two bytes; one for movement and one for storing 22:44:05 this is, for byte-implementation 22:44:26 but the same code would work even if the cell size is more than byte 22:44:39 (on those implementations that i don't prefer) 22:46:09 keymaker: I'm doing x(y)=z and x = y(z) 22:46:32 But, you could add that as a simiplified case :) 22:46:39 ok 22:46:58 what kind of array is this your new array? 22:47:07 is there any size limit? 22:47:49 as well, your random code is clever 22:47:52 size limit depends on cell size 22:47:56 never heard of that 22:48:00 ok 22:48:01 keymaker: thanks :) 22:48:05 :) 22:48:15 oh i mean like how long the array is 22:48:22 yeah that's what I mean too 22:48:23 like can you set x(4999999) = 3 22:48:39 yes, if your cells can hold the value 4999999 22:49:07 ok.. so the max is with 1 byte-implementation x(255)? 22:49:11 yes 22:49:14 'ok 22:49:24 my code basically does that 22:49:33 or well, it does that 22:49:34 :) 22:49:42 it wouldn't be hard to add 22:49:46 it to get the value 22:49:58 I've saved my changes 22:50:03 ? 22:50:14 changes? 22:50:18 could you add your sections and save changes so I can work in my little corner without a conflict 22:50:27 sure 22:50:54 do you want me to add my stuff to esowiki? 22:50:55 what will it be, x = y(_constant), x(_constant_)=y ? 22:51:09 my code? 22:51:14 also, be sure to specify where the pointer ends up 22:51:20 yes 22:51:44 see the one array code I put for an example of what I mean 22:51:46 i'll do this: i'll write the stuff on txt 22:51:58 and later, for example tomorrow, add it when you're edited the wiki 22:52:05 okay 22:52:06 or something like that 22:52:11 i have no reason to hurry :) 22:52:14 brb 22:52:16 -!- malaprop has quit ("leaving"). 22:52:29 -!- malaprop has joined. 22:52:41 if i do detailed work i may add it to my site as well 22:53:22 but what i could do is to convert some of those algorithms of your to non-wrapping implementation ;) 22:53:24 I think I'll write a Malbolge quine 22:53:31 :) 22:53:33 go ahead 22:54:30 what can I offer if you manage to do that? hmm... 22:55:10 99 bottles of beer? 22:55:12 pgimeno: more bf algorithms :) 22:55:20 :) 22:55:26 yeah, that makes sense, Keymaker 22:56:00 malaprop: if you write a Malbolge quine I'll reward you with 99 bottles of beer 22:57:26 malaprop: are you really interested in Malbolge? I want to write sections about practical Malbolge coding 22:58:04 My interest in Malbolge is not deep. 22:58:18 ok 22:58:31 calamari: reversing data would be nice there as well. we could probably use that 50-byte entry of bfcc #1 if we asked the author's (bertram) permission. 22:58:51 I'm going to go think about this on the train to visit some friends; I'll be AFK the next 24hish. 22:59:06 :) 22:59:26 have you read Lou Scheffer's article? it's a good introduction 23:00:17 when his ideas are put into practice other issues surface though 23:00:42 bbl 23:02:33 -!- starling has left (?). 23:04:55 keymaker: ok.. array code should be up if you want to add things :) 23:06:00 ok 23:07:41 here should be code that 'returns' NOT(x) 23:07:42 +++++++++++++++++++++++++++ THIS IS X 23:07:42 [>+>+<<-]>>[<<+>>-] 23:07:42 +++++>>> 23:07:42 +++++[<+++++[<+++++>-]>-]<< 23:07:42 [<++>-]<< 23:07:44 [>-<-]>[<+>-]<< 23:07:57 the first cell is x 23:08:06 and the second cell will get the value not(x) 23:08:19 the original x will remain in the first cell 23:09:16 why not put it in the wiki rather than paste it here? :) btw, I already have a not function listed 23:09:46 but isn't that for wrapping version? 23:09:54 yeah.. this is non-wrapping? cool 23:09:57 yes 23:10:01 that's why i wrote this 23:10:02 :p 23:10:24 i'll add it there..? 23:10:31 if it's possible to normalize it (use variable names instead of > and <, please do so 23:10:50 that way it becomes much more reuseable 23:11:06 hmm.. sorry, i don't know how to convert to those :\ 23:11:18 that's okay.. I'll try to do it 23:11:24 good :) 23:11:28 they confuse me too much 23:11:45 here's the memory layout (if i remember it correctly): 23:11:50 oh wait 23:11:58 it's no use, since it change during execution 23:12:38 that's the probelm with bf algorithms, isn't it.. no documentation, and can't remember how it works :) 23:13:31 makes me glad that I was able to preserve mine somewhat with the variable naming format 23:13:34 hehe. but here is what it does: take copy of x, make one cell 255, decrease 255 by that copy x's value, then move not(x) to second cell 23:13:57 heh 23:18:02 so whats the shortest way to make 255? 16*16-1? 23:18:54 dunno 23:19:00 i used 5*5*5*2 23:19:11 +5 23:19:12 :) 23:22:19 but notice on 1-byte, non-wrapping implementation you can NOT do 16*16 :) 23:22:23 how's this: http://www.esolangs.org/wiki/Brainfuck_algorithms 23:22:31 aha 23:22:36 that is true 23:22:49 so I need to fix it again :) 23:23:17 the 5*5*5*2+5 way is quite good imho 23:23:29 17*15 23:24:11 that's easy, but long :) 23:24:11 except that neither of us seem to understand it :) 23:24:43 can you show me just the code where you set a cell to 255? 23:24:51 ok 23:24:57 +++++>>> 23:24:58 +++++[<+++++[<+++++>-]>-]<< 23:25:04 first place 5 23:25:12 go three right 23:25:19 thanks 23:25:28 and so on :) 23:26:03 probably best would be if you'd just convert my original code to that tutorial form :) 23:26:50 there is what I get: 23:26:53 >[-]+++++++++++++++[<+++++++++++++++++>-] 23:26:53 [-]+++++>[-]>[-]>[-]+++++[<+++++[<+++++>-]>-]<< 23:27:07 your code (when properly zeroed) is actually a bit longer 23:27:22 maybe some of the [-] can be skipped? 23:27:51 actually wait, I missed on on mine 23:28:02 [-]>[-]+++++++++++++++[<+++++++++++++++++>-] 23:28:07 :) 23:28:20 still shorter tho :) 23:30:23 your code leaves cells with values on the memory 23:30:39 adn on which cell the x should be? 23:31:12 I don't understand your question 23:31:15 oh wiat 23:31:22 nothing notghin nothing!! 23:31:31 i just ran the two lines you posted 23:31:39 and thought that that isn't working at all :D 23:31:45 now i see it's comparing 23:32:14 yes, your way is shorter if cells must be cleared first 23:32:43 algorithms page is probably assuming the codes can be run at any time? 23:32:46 yeah 23:32:51 ok 23:33:04 is neg = not + 1 going to wrap ? 23:33:17 no idea 23:33:30 ie neg(10)=-10, not(10)=-11, so -11+1 = -10 23:33:49 no idea still! 23:33:54 hehe 23:33:58 :) 23:34:36 ahh lets see, not(0)=255, 255+1=0.. oops 23:34:58 I could make 0 a special case 23:35:04 ? 23:35:08 i can't understand this at all 23:35:20 what does "x = -x" do? 23:35:47 in values that can't be negative? 23:36:08 good question.. mnaybe it makes no sense to even bother 23:36:22 it's on the esowiki.. 23:36:39 that's because it works well when cell wrapping is allowed 23:36:42 255 = -1 23:37:06 i don't think it's really useful, sorry :) 23:37:12 mainly because there is no sense :) 23:37:12 so if x = 1, the code x=-x gives -1 23:37:19 yes 23:37:29 you've never used -x in a program you wrote? 23:37:33 no 23:37:46 well, sometimes in math you need it :) 23:38:07 but assuming i have brainfuck implementation, 1-byte and non-wrapping 23:38:18 then you don't need it 23:38:21 and i want -(33) 23:38:25 but non-wrapping isn't a given 23:38:48 a lot of bf programmers (including myself) are okay with wrapping 23:39:02 :] 23:39:14 so let's just leave the non-wrapping version off, because you're right, it makes no sense 23:39:21 ok :) 23:39:25 agree! 23:39:50 heheh 23:40:05 btw, is the line between wrapping and non-wrapping version of not(x) necessary? 23:40:10 it makes reading hard 23:40:13 I should rewrite == and != to use 1 = true instead of 255 23:40:28 keymaker: nope, that must be an accident on my part 23:40:35 ok :) 23:40:39 i can write other of them 23:40:47 which one do you want == or != ? 23:41:04 do you understand the code? :) 23:41:15 not esowiki code 23:41:19 but pure brainfuck, yes 23:41:23 okay :) 23:41:30 I can do both, it won't take long 23:41:37 well, ok then 23:44:23 what 'x = x and y (boolean)' does? 23:44:44 okay done 23:44:50 ok 23:44:50 x = x && y 23:44:54 for the record, according to http://www.iwriteiam.nl/Ha_bf_numb.html you need at least 30 instructions for 255 23:45:49 ok 23:46:05 i mean it does something with bits? 23:46:11 (&&) 23:46:45 AND 'gate'? 23:47:29 keymaker: if you're familiar with c, it is the && operator 23:47:37 i'm not 23:48:06 keymaker: examples: 1 == 2 returns 0, 5 == 5 returns 1 23:48:23 ah 23:48:26 i'm stupid 23:48:30 this is useful for things like if() 23:48:32 i was thinking at byte level 23:48:33 yes 23:48:34 this 23:48:37 00110 23:48:41 10010 23:48:46 00010 23:48:48 :) 23:48:50 ahh, yeah, that's bitwise 23:48:54 i mean bit level 23:49:14 I've writeen those, too.. I 'd forgotten ! :) 23:49:36 smallfuck comes handy at those :) 23:49:46 :) 23:49:49 indeed 23:49:52 yeah, I'd bet it does 23:50:07 interesting how it can be more powerful and less at the same time 23:50:15 :) 23:50:49 i should write some smallfuck program (using some i/o extension) 23:51:52 Boolfuck may be what you're looking for 23:51:54 naturally without using any bf-->sf stuff 23:53:16 bitchanger is smaller, but not symmetric 23:53:39 so you don't really win anything.. just less symbols 23:53:44 :) 23:53:48 how did you invent it? 23:53:59 keymaker: driving down the freeway I came up with the answer :) 23:54:30 heh, the eureka effect 23:54:33 I didn't know about any other bit bf's 23:54:58 lol 23:55:00 my goal was to simplify bf so that it could be wired with transistors 23:55:10 :) 23:55:17 didn't happen, of course 23:57:27 with TTL circuits, I hope 23:58:05 nm 23:58:15 rgh. 23:58:23 well, seems i didn't go night photographin' 23:58:35 better continue being here, then 23:59:25 gotta go tomorrow, or going crazy 23:59:45 anyways, i'll switch to linux once again, will be back soon. 23:59:47 -!- Keymaker has quit ("I've seen this déjà vu before.."). 2005-06-12: 00:02:30 -!- Keymaker has joined. 00:02:43 So ................... 00:02:47 ? 00:03:36 I wanted to release DN 0.5 today ... 00:03:39 But I don't think I can ... 00:03:42 I can't find this damn bug :'( 00:03:46 :( 00:03:56 what kind o bug? 00:04:22 How much detail do I want to describe this in ... 00:04:37 When one side sends a direct connect request, it then stops receiving input. 00:04:40 For some inexplicable reason. 00:04:47 hmm 00:05:10 hey, i know: "there is something wrong!" 00:05:22 :P 00:05:33 I'm considering disabling DCR for this version, and fixing it later. 00:05:33 no idea, naturally 00:17:51 here's a snack code to print 'A' 00:17:52 !+?:::::::"?++++++++"< 00:19:43 here are the instructions so far: " ! + - = : < > ? # 00:19:58 and probably '!' for output 00:20:02 input is missing 00:20:17 '/' is there also 00:22:13 so, 12 instructions total 00:23:56 no input? 00:24:15 not yet 00:24:26 it will be there, probably character @ 00:26:48 actually the 'A' printing program would be two instructions longer in brainfuck :) 00:26:49 ++++++++[>++++++++<-]>+. 00:27:06 and probably snack code can be squeezed. i'll try 00:29:17 ! is for output? and it's the first instruction in the example? 00:29:37 last 00:29:37 do you run backwards? 00:29:40 yes 00:29:45 the program will be put into stack 00:29:49 aha 00:29:52 and it will be eaten from there 00:30:01 program will be stopped when no instructions left 00:32:22 keymaker: any gems for x = (y >= z)? I have code, but it's very long 00:32:40 nope 00:32:59 i guess i couldn't make very short non-wrapping code either 00:33:43 I can't think of a non-wrapping way to find the cell size 00:33:56 i.e... what is the maximum cell value 00:34:09 it can't be found 00:34:15 the maximum 00:34:15 yeah, I don't think it can 00:34:21 only wrapping allows it 00:35:10 but the good thing is one doesn't really need to know the maximum value. as long as the interpreter has bytes 00:35:15 that means wrapping is more powerful.. for example the wrapping version of not works for all cell sizes 00:35:41 but one shouldn't use other sizes!!!!!!!!!!!!!! 00:35:49 8) 00:35:53 pi16.b disagrees :) 00:36:07 well, that program doesn't know anything 00:36:13 :p 00:36:33 bfasm disagrees then :) 00:36:48 maybe it needs some rewriting ;) 00:36:55 yeah, it does 00:36:58 heh 00:37:14 seriously, i don't mind if people use wrapping version 00:37:21 but i'm just defending non-wrapping 00:37:48 i mean i'm going to code my programs with non-wrapping 1-byte implementation 00:38:34 the original distribution implies wrapping :) 00:38:40 i know 00:38:44 1 byte = 8bits .. but could you do non-wrapping with 1 bit? 00:39:04 lol 00:39:05 yes 00:39:24 + and - are fine :) 00:40:58 yep, it still works.. cool 00:41:15 and besides, non-wrapping is less implementation dependent 00:41:18 what works? 00:41:27 maker: what you said 00:41:33 + and - ? 00:41:36 yeah 00:41:40 of course it works! :D 00:44:06 how do you do non-wrapping subtraction? .. lets say 3 - 5 ? 00:44:32 probably first check which one is bigger 00:44:43 and then probably.. 00:44:47 (wait) 00:44:59 would you have a cell that specifies the sign ? 00:45:15 dunno 00:45:21 never done that 00:45:47 if you come up with something, that could be used for x = -x :) 00:45:57 ok 00:46:20 that'd be pretty simple an operation now... sign = 1 - sign.. something like that :) 00:56:16 ouch. my knees hurt 00:56:58 it probably has nothing to do with 14 hours of sitting :) 00:57:12 probably not.. 00:58:10 I end up sitting different ways throughout the day without even noticing the changes.. other people comment :) 00:58:19 :) 01:00:53 I hate all of my friends. 01:01:07 :) 01:02:45 I don't have any friends that I don't hate 01:03:08 graue: is the converse true? 01:03:21 You are all my sworn enemies ... and I love ya', every one. 01:03:50 :) 01:03:57 calamari, what would that be? I'm confused 01:04:41 no, "if I hate someone, then he is my friend" is not true 01:05:33 http://esoteric.voxelperfect.net/db/latest.sql.bz2 01:05:33 it should now update on sundays at about 00:01 UTC, maybe a little later 01:05:33 so can it be announced to the mailing list? 01:05:54 sure i guess 01:05:59 okay 01:06:11 what about the uploaded files? 01:06:35 I'd like to upload a Piet program 01:06:43 what announced on the mailing list? 01:06:55 Keymaker: the database backup 01:07:00 ok 01:08:31 hey, what if you have bit-sized cells, but incrementing 1 or decrementing 0 is an error that crashes your program? 01:08:37 that would be strange to deal with 01:09:18 :) 01:09:40 graue, please, could you set up a backup of the wiki uploads? 01:11:21 graue: that's wrapping.. it's an error, lol 01:11:49 graue: also can you alow me to upload files? 01:14:33 pgimeno, when there are too many to back them up manually, then yes 01:14:39 calamari, you should be allowed already 01:15:21 hum, what happens in MediaWiki when a file is missing? 01:16:27 I mean, if the file is not present in the uploads dir but the database indicates that it's there 01:16:45 can it be re-uploaded? 01:17:52 if not, people interested in mirroring will need to know what directories to put the mediawiki files in 01:18:30 IIRC the dir name is made by looking at the first characters of a hash of the file's name 01:20:19 graue: ok thanks 01:37:12 well. time to go.. 01:37:31 see you earlier/later today 01:37:31 nite 01:37:31 -!- Keymaker has left (?). 01:40:33 -!- calamari_ has joined. 01:45:53 -!- graue has left (?). 01:57:28 -!- calamari has quit (Read error: 110 (Connection timed out)). 02:00:14 bbl, phone 02:00:16 -!- calamari_ has quit ("Leaving"). 03:45:45 isn't this a correct nonwrapping "not x"?: temp0[-]x[temp0+x[-]]+temp0[-x-temp0] 04:04:08 -!- kipple has quit (Read error: 110 (Connection timed out)). 05:23:56 -!- calamari_ has joined. 05:23:58 hi 06:16:54 -!- GregorR-L has joined. 06:55:48 is any language that restricts memory to a finite amount a finite-state automaton? 06:56:59 trying to categorize one of my languages, and it would be turing complete, except ultimately there is a maximum amount of memory.. although that maximum amount is exceptionally large 06:59:52 256^26 bytes.. 3.74x10^50 terabytes 07:01:26 wow, that's a lot of memory.. hehe :) 07:17:48 -!- calamari_ has quit ("Leaving"). 07:59:59 -!- clog has quit (ended). 08:00:00 -!- clog has joined. 09:48:34 -!- GregorR-L has quit (Read error: 110 (Connection timed out)). 10:05:21 -!- J|x has joined. 10:07:18 moin 10:07:31 -!- J|x has changed nick to jix. 10:12:46 anyone here ? 10:14:39 nope 10:15:15 ok 10:17:13 jix: may i help you? 10:19:05 -!- sp3tt has joined. 10:19:45 nobody's here 10:19:48 nobody's ever here 10:19:51 this channel is EDAD! 10:23:50 is it? 10:24:03 yeah 10:24:04 EDAD 10:26:47 before i went to france i just done my XUML interpreter(4 mins before i had to shutdown my computer).. i'm going to upload it and create a wiki page 11:06:01 Would latin qualify as an esoteric language? lol 12:34:26 -!- J|x has joined. 12:38:05 -!- jix has quit (Nick collision from services.). 12:38:10 -!- J|x has changed nick to jix. 13:09:41 -!- sp3tt_ has joined. 13:16:10 -!- sp3tt has quit (Read error: 60 (Operation timed out)). 13:17:48 -!- comet_11 has quit (Read error: 104 (Connection reset by peer)). 13:18:59 -!- CXI has joined. 13:21:40 -!- kipple has joined. 13:38:12 -!- graue has joined. 14:10:22 -!- Keymaker has joined. 14:10:52 wheee 14:11:16 finally got around taking a look at appearance stuff in this mandrake 14:11:28 now i'm finally feeling comfortable with the appearance 14:11:32 now when i've changed it 14:11:41 the previous looked like s*it 14:14:28 what window manager are you using? 14:15:07 Use evilvm, it's nice. No nonsense about menus or title bars or other unnecessities. 14:15:44 i guess it's kde in case that is window manager. i'm a bit lost about the terminology 14:22:02 i prefer ion 14:22:20 kde is a desktop environment, i'm not sure what window manager it normally uses 14:22:28 ok 14:22:30 no idea 14:30:03 I think they call it Kwin. 14:41:51 i. hate. overflow. stupid non-wrapping cells :p 14:50:29 problem fixed 15:11:37 i wish C had a balanced trinary type 15:11:44 or type checking for enums so i could make my own 15:11:51 question: in which direction langton's ant is going when started? 15:11:59 left righ up or down 15:12:19 i can't find the start direction anywhere grrrrr 15:27:42 i wish i knew :( 15:49:27 well, doesn't matter anymore 16:05:18 chocolated covered langton's ant 16:05:32 mmh.. ants.. 16:18:07 bbl' 16:18:10 -!- Keymaker has left (?). 16:26:21 -!- cpressey_ has joined. 16:26:35 -!- cpressey has quit (brown.freenode.net irc.freenode.net). 16:46:43 -!- Keymaker has joined. 16:46:59 from esowiki: "fixed erroneous fix" 16:47:01 :D 16:47:40 probably means someone fixed stuff, and the noticed there was nothing wrong 16:49:12 Keymaker: my thue digital root program is shorter than yours :p 16:49:25 grrrg 16:49:26 :p 16:49:28 well, no wonder 16:49:33 i'm not very good at thue 16:50:31 (but i should try again :w) 16:55:47 write a digital root program in qdeql 16:55:57 this is just a suggestion, not a command 16:56:10 what is that? 16:56:17 qdeql 17:01:16 an esoteric language of my invention 17:01:21 www.oceanbase.org/graue/qdeql 17:03:35 hmmmm... 17:03:54 hmmmmmmmmmmmmmmmmmmmm indeed.. will take 10x times until i understand anything 17:04:28 -!- tokigun has joined. 17:05:19 hello 17:08:12 hello 17:08:13 ;) 17:13:11 -!- harkeyahh has joined. 17:16:10 -!- tokigun has quit ("leaving"). 17:18:40 I thought this forum was aboutbusiness law 17:18:52 :-/ APL won't help me this time 17:19:12 how did you get that impression?? :D 17:19:22 graue: about qdecl. I'm not familiar with the dequeue and enqueue opearations. 17:19:51 is dequeue to take an element from the end of the queue, and enqueue to insert it at the beginning? 17:26:03 -!- tokigun has joined. 17:26:30 yes 17:27:07 kipple: although i normally consider the "beginning" of the queue to be the part you dequeue from 17:27:34 heh. yes. I agree 17:28:28 -!- harkeyahh has quit (brown.freenode.net irc.freenode.net). 17:28:59 -!- harkeyahh has joined. 18:11:20 -!- {^Raven^} has joined. 18:11:39 <{^Raven^}> Hi everyone 18:12:04 <{^Raven^}> It's nice to be back ;) 18:12:57 Hello. 18:13:54 I like this channel i am coming in now as a regular 18:14:24 <{^Raven^}> I was here 24/7 a while back, it's a nice place 18:15:13 I especially like the marble floors 18:15:24 nice touch 18:23:16 :) 18:23:19 hello raven 18:23:30 <{^Raven^}> hi there Keymaker, long time no see 18:23:34 now: where have you been??! 18:23:38 hi 18:24:16 <{^Raven^}> I went back to work 18:25:06 but but.. how did that stop you accessing this channel? 18:25:16 or did you wokr 24/7 18:25:35 anyways, plenty of interesting has happened. 18:25:58 <{^Raven^}> Umm...very good point there, dunno. 18:26:03 :) 18:26:07 <{^Raven^}> Ooh, plz tell 18:26:22 well, the esowiki that people have been actively updating and makin' is up at 18:26:27 esolangs.org 18:26:39 my brainfuck site http://www.bf-hacks.org/ is up 18:26:56 Yeah brainfuck is awesome 18:27:07 yep 18:27:14 and i made a simple polyglot quine: 18:27:15 http://www.bf-hacks.org/hacks/pgq.b 18:27:52 well, much more.. the logs are filled with interesting discussion now when we've got guys like pgimeno and GregorR here 18:28:03 also, plenty of new esolangs have been made 18:28:27 <{^Raven^}> I'll take a peek at the chat logs later, I've got a lot of catching up to do 18:28:32 but now i must go eat dinner (that i can't this time bring here) 18:28:35 ok 18:28:38 bbl 18:28:41 <{^Raven^}> have fun Keymaker 18:30:04 i'm 11:30 am here and he is eating dinner 18:30:08 lucky bastard 18:33:14 -!- harkeyahh_ has joined. 18:33:52 ChanServ don't talk to me 18:35:42 Keymaker: it seems to be written in c99 ;) 18:40:11 -!- smott has joined. 18:40:35 hello Smott 18:40:42 did you tell ChanServ to stop bugging you? 18:45:19 hi. what? 18:46:15 yeah ChanServ 18:46:21 he always talks to me when i come in 18:46:27 I am sick of it 18:46:36 oh right. one gets used it i suppose 18:46:36 being harassed by a robit 18:47:14 he can't treat me like trailer trash jsut because he lives in a near freezing basment in seattle 18:48:08 well, he's the boss, or so i hear 18:48:58 see thats it repression of the organic race by hunks of metal 18:49:17 we should make a machine that can rival ChanServ and beat him to a pulp 18:50:35 -!- harkeyahh has quit (Read error: 110 (Connection timed out)). 18:50:48 At 20:30, that was a rather late dinner, even. 18:52:20 i know really 18:53:05 does anyone happen to have any code for this language called smallfuck? 18:53:36 no not anymore 18:53:40 it went out of date years ago 18:53:57 you really need to upgrade your machine 18:56:14 typical of me, always years behind the current technology 18:56:46 <{^Raven^}> I'd say check lament's website for it but I cannot find a current one 18:57:03 :-/ Well, we can't all be up-to-date 19:05:49 check the chat logs, lament posted a link to his smallfuck->smetana compiler in the last few days 19:06:15 ok 19:20:23 graue: have you made hello world in qdeql? 19:21:06 yeah, it's in the distribution 19:21:25 hello.qdeql 19:22:02 ok i must look more carefully :) 19:23:30 arh 19:24:30 hey, maybe i should make & do nothing on EOF rather than enqueueing 0 19:24:53 that would make writing some programs more challenging, but then cat could handle binary files 19:25:09 mmmh.. binary.. 19:30:57 bbl 19:31:00 -!- Keymaker has left (?). 19:47:42 <{^Raven^}> Hey peeps...Roll up...Roll up... 19:49:09 <{^Raven^}> It is my pleasure to announce the release of Lost Kingdom (Enhanced Brainfuck Edition) 19:50:33 <{^Raven^}> http://jonripley.com/brainfuck/games/ 19:50:59 <{^Raven^}> Lost Kingdom is a text adventure written in Brainfuck 19:51:32 <{^Raven^}> Probably the first ever piece of interactive fiction ever written in an esoteric programming language 19:52:08 <{^Raven^}> Also one of the largest non-trivial Brainfuck programs ever written 19:52:13 <{^Raven^}> Have fun! 19:52:49 -!- harkeyahh_ has quit ("leafing"). 20:05:19 Holy fuck....... 20:06:49 * GregorR bows down to {^Raven^}, his new god. 20:08:40 -!- lindi- has quit (Read error: 110 (Connection timed out)). 20:09:12 * {^Raven^} is sporting a grin larger than the recommended specifications 20:12:13 ...omg. 20:19:31 you wrote this in BFBASIC, right? 20:29:26 <{^Raven^}> yes...but trust me it was a non-trivial exercide 20:29:54 * {^Raven^} shuffles nervously 20:37:34 it seems like it's impossible to read binary files in brainfuck 20:37:46 if the implementation returns -1 on EOF, you can't read a 255 byte 20:37:53 if the implementation returns 0, you can't read a 0 byte 20:38:11 and if it implements EOF as no change, you get to choose what byte you can't read, but you still can't read a certain byte value! 20:38:54 <{^Raven^}> It will be possible in the future to handle binary files and do a lot more than that with any esolang capable of IO 20:39:36 -!- harkeyahh has joined. 20:39:40 <{^Raven^}> but at the moment it is problematic as you say 20:40:09 it's not a problem in Kipple! 20:40:35 at the moment, you say? is there an official revision on the way? ;) 20:40:48 omfg i forgot how to do a crying emotiocon 20:41:03 there's that EsoAPI thing 20:41:04 :'( 20:41:05 :'( 20:41:23 omfg i forgot how many star wars films there are 5 or 6 :'( 20:41:36 7 :) 20:41:47 yeah, but only 0 of them were any good 20:41:56 do not underestimate the power of the Holiday Special ;) 20:42:05 :'( no there can't be 7 then i am missing 2 films 20:42:27 well, really, there are 6 20:42:34 <{^Raven^}> PESOIX is in development which is a POSIX style layer for any esolang 20:42:45 star wars is the worst trilogy ever :'( 20:43:04 raven: interesting. how will that solve the EOF problem in BF? 20:44:12 the original star wars trilogy are among my favorite movies, but the new trilogy is crap 20:44:24 <{^Raven^}> The official URL for PESOIX is http://catseye.mine.nu:8080/projects/pesoix/doc/pesoix.html but also take a peek at http://jonripley.com/easel/ 20:45:30 <{^Raven^}> PESOIX includes an implementation independant call to test for EOF 20:47:10 looks interesting :) 20:52:45 <{^Raven^}> thanks 20:53:41 -!- sp3tt_ has quit (Read error: 54 (Connection reset by peer)). 21:22:12 <{^Raven^}> is the owner of the soojung blog here? I'd really love to know the English translation of your entry! Thanks for wirting it! 21:28:00 -!- J|x has joined. 21:29:25 -!- jix has quit (Nick collision from services.). 21:29:28 -!- J|x has changed nick to jix. 21:34:16 * {^Raven^} wishes that Keymaker was around earlier 21:45:09 {^Raven^}: you mean http://sapzil.info/soojung/entry.php?id=620 ? 21:45:57 <{^Raven^}> Yes 21:46:28 Yes... I wrote it :) 21:47:01 -!- lindi- has joined. 21:47:04 catseye.mine.nu:8080 doesn't work 21:47:24 <{^Raven^}> Thanks, I have tried to read it via Babelfish but not much luck :( 21:47:39 {^Raven^}: Babelfish... omg :S 21:48:03 it's 5:48 am now... i have to sleep ;) 21:48:12 (GMT+09:00) 21:48:15 <{^Raven^}> nite 21:51:06 -!- tokigun has changed nick to t0k1gun. 21:51:54 -!- t0k1gun has changed nick to tokigun^away. 21:54:42 -!- Keymaker has joined. 21:54:46 'ello 21:55:03 cpressey seems to have done nice job @ esowiki 21:55:08 <{^Raven^}> hi there Keymaker 21:55:10 hi 21:55:36 <{^Raven^}> nice website good to know that you found a new host 21:57:05 new host? 21:57:15 had i one before? :) 21:57:20 oh wait 21:57:21 yeah 21:57:25 school server 21:57:51 yes, bf-hacks is now my place along with koti.mbnet.fi/yiap/ 21:59:01 what means 'non-trivial'? 21:59:07 too lazy to search for a dictionary.. 21:59:49 <{^Raven^}> in programming terms it means really, really difficult aka usually almost impossible 22:00:43 ok 22:00:46 cheers 22:00:52 writing Hello world in brainfuck is trivial. Writing it in Malbolge is not.... 22:01:03 :) 22:01:52 <{^Raven^}> keymaker: you missed my announcement earler :( 22:02:01 ok what it was? 22:02:18 (i was eating birthday cake and reading) 22:03:42 <{^Raven^}> keymaker: http://jonripley.com/brainfuck/games/ (look for Lost Kingdom) 22:04:50 very nice 22:04:53 * Keymaker faints 22:07:18 have you used any text-to-brainfuck generators? 22:07:26 or everything just pure typed brainfuck? 22:11:20 ah, not, but still awesome :) 22:11:33 now i have to try it :) although i suck at text games 22:11:42 <{^Raven^}> it was a lot of hard work 22:12:15 <{^Raven^}> technichally it's two different(ish) games rolled into one, a conversion of the original and a specially enhanced version 22:12:25 <{^Raven^}> have fun tho 22:18:44 nite 22:19:17 nite 22:19:26 <{^Raven^}> nite 22:19:27 -!- jix has quit ("Banned from network"). 23:34:03 anyone got more information about aura?? 23:55:49 figure it out yourself! 23:55:55 (no, no one does) 23:57:59 i developed a new companion to html not a programming language, but close enough 23:58:05 it is the rival of CSS 23:58:10 called TSS 23:58:44 :) 23:58:55 Tiled Style Sheets 1.0 2005-06-13: 00:00:09 LOL 00:00:18 Good ol' arrange->tiled 00:03:19 do brainfuck files have a .bf extension? 00:03:31 Sometimes .b, sometimes .bf 00:03:43 usually .b I think 00:03:52 .bf is also used for befunge 00:03:56 <{^Raven^}> I always use .b as .bf is used by befunge 00:04:18 okay, thanks much 00:05:17 bf is for befunge, use b instead :) 00:05:27 i use b 00:07:07 i hate to think what Befuck and Befreak must use 00:07:59 well, there is no reason to limit extension to 1-3 chars really... 00:08:08 yeah 00:08:34 .befuck 00:08:36 .befreak 00:08:37 :P 00:08:48 Anybody have a SCSI terminator they can pass me through IRC? 00:19:24 I can't seem to fit mine into the floppy drive for DIGITIZING. 00:20:03 It's for scsi-2, with that HD50 connector, if that's ok. 00:21:15 -!- harkeyahh_ has joined. 00:22:37 It's originally from an SGI Indy, and has a value-adding "feature" of not being able to fit to the (inset) scsi connectors of an external Sun HD box. 00:23:09 what are you talking about?! 00:23:43 The SCSI terminator requested few lines ago. 00:25:26 what is it? 00:25:30 I'm very SCSI-inept .... this is old, and I'm not sure how old SCSI-2 is, or whether this is SCSI-2 or SCSI-1 00:26:32 Well... if it has a small-ish (well, small for 50 pins) 50-pin connector, it's probably scsi-2. 00:26:47 It's pretty massive. 00:27:00 This is an olde Apple CD-ROM drive. 00:27:23 Ah, then it's probably the Centronics connector, which is larger. HD50 would look like http://www.cselex.com/images-large/HD50.jpg 00:28:01 Although I guess I'd have some sort of trouble DCC'ing a physical object anyway. 00:28:53 http://www.elara.ie/elara/graphics/Belkin/OR1230000015229.jpg < is this a SCSI terminator? I thought SCSI terminators only had one end ... 00:30:00 Pretty hard to say from the image. Usually they do have only a single connector. 00:30:00 yo 00:30:06 hi 00:30:56 Keymaker: seen my tentative x=not(x)? 00:32:01 could you give it to me as pure brainfuck? 00:32:24 i get confused by those wiki versions that have instructions replaced with text 00:33:07 I'm not saying it _isn't_ a terminator, though. Some seem to have two connectors, assumedly to work as terminators when nothing's connected, but allow adding new devices to the end of the chain temporarily. 00:33:30 assume x is at 0, temp0 is at 1, and D = 0; then: >[-]<[>+<[-]]+>[-<->] 00:34:23 Keymaker: a label means: insert as many > or < as to go to the given label 00:35:15 Or possibly a: "Feed-through SCSI terminator: Use this if you have no more connectors left on your cable to connect a SCSI terminator. You plug the last connector in one side of the SCSI terminator and then plug the other side of the terminator into your last device. Helps keep cable lengths short." 00:35:22 -!- harkeyahh has quit (Read error: 110 (Connection timed out)). 00:37:07 hmm 00:37:29 so x is in cell 0? and this is non-wrapping? 00:37:37 -!- harkeyahh_ has quit (Read error: 145 (Connection timed out)). 00:38:10 I may be mistaken, I haven't tried the code 00:38:17 or should this be 00:38:20 for bits? 00:38:37 like 0 to 1 and 1 to 0? 00:38:41 this means: if x = 0 then x = 1 else x = 0 00:38:51 then it works 00:39:12 yeah, it does that, what you said, yes 00:39:13 isn't that what not(x) does? 00:39:24 or is it bitwise not? 00:39:33 it is bitwise not i assume 00:39:38 oh! 00:39:41 I see 00:39:44 ok 00:39:57 I assumed logical not 00:40:45 <{^Raven^}> for bitwise signed it would be NOT(x)=MAXCELLVALUE-x 00:41:08 yeah 00:41:09 yeah, assuming MAXCELLVALUE is a power of 2 - 1 :) 00:41:28 wait.. i'm confused with these namings 00:42:01 <{^Raven^}> doesn;t matter if cell values wrap 00:42:41 what's difference between bitwise and logical? 00:42:49 does logical return only 0 or 1? 00:43:13 and bitwise does stuff by first slicing values to bits and then doing bit operations and so on? 00:43:18 <{^Raven^}> yeah, logical NOT returns only TRUE or FALSE 00:43:28 ah. then pgimenos code is logical not 00:43:45 (sorry, i got confused with these names) 00:44:11 logical not that works with values bigger than 1, as well 00:44:12 "bitwise" means one bit at a time 00:44:15 ok 00:44:43 <{^Raven^}> you can cheat a bitwise NOT easily in BF 00:45:56 {^Raven^}: btw, this is related to http://www.esolangs.org/wiki/Brainfuck_algorithms 00:46:28 yep 00:47:44 heh, my algorithm matches calamari's one except for the last [-x-temp0] instead of [temp0-x-] 00:48:10 <{^Raven^}> nice page there 00:48:17 yeah 00:48:27 -!- harkeyahh has joined. 00:48:55 sup ChanServ my babeh 00:49:03 almost finished with TSS 00:49:25 had to program the neutralizer in bf 00:51:01 I suck at BF, btw 00:51:26 I had to hack the compiler to get it to work 00:51:28 <{^Raven^}> If I can remember how to program BF: (value)>[-]-<[>-<] sets cell+1 to bitwise NOT cell 00:52:06 {^Raven^} I should upload it so you can take a look at it 00:53:33 {^Raven^} http://pastebin.bafserv.com/412 00:53:47 in the //INSET BF NEUTRALIZER bit 00:54:25 *note it has been hacked to adjsut for some ASCII differences in TSS 00:55:11 <{^Raven^}> or >[-]-<[>-<]>[<+>]< to set cell=NOT(cell); (cell+1) = 0 00:55:46 yeah I would have done it that way but then the page outputs backwards 00:56:21 h/o going to get a manual bbm 01:01:23 <{^Raven^}> logical NOT is a bit harder 01:08:19 hey, here's interesting phrase: "Pile up Z's" 01:08:29 means "Get some sleep" 01:08:40 according to some slang of the fifties page i'm reading 01:08:50 :) 01:09:27 Umm, wouldn't logical not just be bitwise not proceeded by [[-]+] ? 01:09:47 Oh wait ... 01:09:57 Yeah, that's right. 01:10:09 00000000 becomes 11111111 becomes 00000001 01:10:19 00000001 becomes 11111110 --- never mind, I'm dumb. 01:12:45 <{^Raven^}> got as far as >[-]<[>+<[-]]>[<+>]< and >[-]+<[>-] but not luck 01:13:02 <{^Raven^}> keep forgetting the other condition 01:13:08 okay got it 01:13:42 I was reading up i think it will be fine 01:14:12 * {^Raven^} is off to bed before morning happens again 01:14:23 <{^Raven^}> nite all 01:14:27 nite raven 01:14:58 nite 01:15:34 Keymaker did you see the TSS source code? 01:21:19 no 01:22:17 but i must go now 01:22:27 3:26 am and i'm tired :) 01:22:34 'nite 01:22:41 -!- Keymaker has quit ("I've seen this déjà vu before.."). 01:28:37 -!- calamari has joined. 01:28:44 hi 01:28:56 Hoi 01:29:43 <{^Raven^}> hey there 01:30:08 howdy 01:30:09 hi Raven.. you're mentioned on the wiki under BFBASIC :) 01:30:23 <{^Raven^}> am i? cool! must check that out 01:30:33 don't get too excited.. lol 01:30:43 OK, rather than finding a SCSI terminator, I'll ask: Is there any way to install Debian on an olde PowerPC laptop with a disk drive and no networking or CD? :P 01:31:38 null-modem cable perhaps? 01:31:52 It's a Mac. 01:31:56 <{^Raven^}> i released Lost Kingdom to the world today :) but i guess you know that already ;) 01:32:45 <{^Raven^}> anyways i'm off to bed, nite 01:33:12 gregor: doesn't it have some equivalent of a serial port? 01:33:43 kipple: It has a modem ... and a strange port with a little telephone on it XD 01:33:51 (Gregor is not a macintosh expert :P) 01:34:31 A disk drive as in a floppy one? 01:34:31 nite {^Raven^} 01:35:19 fizzie: Yeah. 01:35:20 raven: cool! (goes off to download) 01:35:23 Well, it has an HDD too. 01:35:48 BTW {^Raven^}, though Lost Kingdom is whooping my arse, it's quite awesome. 01:36:15 bah 01:36:26 show us how impressive the source in BFBASIC looks 01:36:51 the way it uses brainfuck is no better than giving us a big .exe file 01:37:09 (I'm not a mac expert either.) I've once installed linux on one x86 laptop much like that one. I used the internal modem in the laptop, connected to another modem on a desktop box (with atx3 they won't insist on a dial tone) running pppd, then did a network install. 01:37:14 and saying "look what i did in machine code!" 01:37:24 For booting you'd probably need a bootable mac floppy. 01:37:40 graue: I think a .class file might be a better comparison. 01:37:55 fizzie: I can boot into the basic installer, I just can't get the packages from anywhere XD 01:38:10 GregorR, same difference 01:38:25 brainfuck is only interesting when it's handwritten 01:39:55 If there's a version that supports the modem and ppp, you could do it the way I did. If you're _really_ patient, you could also write the packages on gazillion floppies, and copy on the HD, and install from there, using the shell included in the installer. 01:40:15 Uh, 'copy on the HDD using the shell', I mean. 01:41:04 you'd only need two floppies, not a gazillion 01:41:33 but you would have to reuse them a gazillion times 01:41:47 Well, yes, gazillion floppyfuls (hee, nice word) of data. 01:42:17 That sounds like more fun than I can possibly describe 8-D 01:42:25 GregorR: yeah, it might not be too hard to convert from bfbasic bf back to bfbasic, since the source for bfbasic is available 01:42:42 It's like watching paint dry, only less interesting. 01:44:26 graue: re: handwritten, I disagree.. it might be a little unsettling to see a larger project in bf, but I think most people would agree that asm doesn't work out the best for huge projects.. bf is like asm in many ways 01:45:44 it just makes sense to use a compiler in large cases 01:50:49 calamari, yeah, but then why use brainfuck? 01:51:31 the reason to use brainfuck is it's challenging and interesting to write in 01:51:50 if you're compiling, why not just compile for your machine? 01:53:06 i wrote a DOS program once using only a hex editor, and that was interesting to have written something in machine code, but i don't compile mammoth C programs to 2 MB binaries and say, hey, look what i wrote in machine code! 01:53:12 the reason for it being interesting is a lie 01:56:15 graue: bf is cross platform.. and it is interesting to me: 1) example of the power of bf, 2) a fun game, 3) using bfbasic, 4) big, etc 01:56:42 hope that helps 01:57:16 graue: and if you have something cool to show off that your wrote in c, I don't think anyone here would mind :) 01:57:17 fair enough, but you gotta admit it ain't nothin' like a program actually written in brainfuck 01:58:01 graue: you wouldn't use bfbasic in a bfgolf tournament.. is that what you're looking for? :) 01:59:01 i wrote this in C, which is cross platform because it runs in wine: http://www.thunderpalace.com/software/blockman/ 01:59:12 i guess everyone here will be astounded at how impressive that is 02:02:18 impressive, most impressive.. obi-wan has taught you well, you have controlled your fear. now release your anger.. only your hatred can destroy me :) 02:02:49 since I know how big a star wars fan you are, I know you'll appreciate that ;) 02:03:45 thank you 02:04:03 -!- harkeyahh has quit (Read error: 110 (Connection timed out)). 02:05:05 graue: "BLOCKMAN.LVL is nonexistent or corrupt" 02:05:26 the file is there.. 02:06:12 not trying to run it from the zip or anything 02:06:47 hmm.. works from the command line 02:07:05 wonder where the bug is.. gnome, wine, or ubuntu? 02:11:17 graue: somehow I get the feeling the game is abandoned, but if not, the game would benefit from a menu, for restart, quit, and easy access to help 02:12:00 well, it was only a version 0.07 02:16:59 *nod*, doesn't change my suggestion any :) 02:23:35 -!- harkeyahh has joined. 03:13:32 -!- graue has left (?). 03:17:05 -!- harkeyahh has quit ("Chatzilla 0.9.68.5 [Firefox 1.0.4/20050511]"). 03:20:01 -!- wooby has joined. 03:32:54 -!- kipple has quit (Read error: 110 (Connection timed out)). 03:33:37 -!- smott_ has joined. 03:36:36 -!- smott has quit (Read error: 110 (Connection timed out)). 03:59:25 -!- wooby has quit. 04:18:04 -!- calamari has quit (Read error: 110 (Connection timed out)). 04:24:45 -!- calamari has joined. 04:29:15 -!- GregorR has quit (Success). 04:55:15 -!- malaprop has quit ("sleep"). 05:27:51 -!- graue has joined. 05:27:59 -!- graue has quit (Client Quit). 05:34:37 argh.. my esoshell hacks for printed backspaces don't seem to be working right 05:34:51 gotta give up for now, homework time 07:01:33 -!- tokigun^away has changed nick to tokigun. 07:55:41 -!- calamari has quit ("Leaving"). 07:59:59 -!- clog has quit (ended). 08:00:00 -!- clog has joined. 10:25:37 -!- kipple has joined. 11:13:09 -!- Keymaker has joined. 11:13:32 hmmm. grrhhh. i had some question in mind just second ago 11:13:35 .. 11:16:40 yes.. what's difference between random and undefined? 11:18:32 undefined can be anything, while random implies a certain distribution of values 11:19:21 ah 11:20:10 at least that's how I see it. there are probably people here who can put it more formally 11:20:34 :) 11:20:52 as well, if anyone has any information about aura, tell me 11:21:30 I've looked at the interpreter source. is there any web site? 11:21:50 can't find 11:33:57 I'd say the precise meanings of 'random' and 'undefined' depend on the context in which they are used. In the C specs for example, the term undefined is well-defined. 11:34:01 ("behavior, upon use of a nonportable or erroneous program construct, of erroneous data, or of indeterminately valued objects, for which this International Standard imposes no requirements") 11:48:19 bbl. 11:48:21 -!- Keymaker has quit ("I've seen this déjà vu before.."). 12:14:01 <{^Raven^}> mornin peeps 13:00:39 -!- tokigun has quit ("Chatzilla 0.9.68.5 [Firefox 1.0.3/20050414]"). 13:12:08 -!- jix has joined. 13:12:34 moin 13:13:31 -!- sp3tt has joined. 13:42:59 -!- malaprop has joined. 15:31:47 -!- Falling has joined. 15:33:34 -!- Falling has left (?). 15:46:17 -!- tokigun has joined. 16:14:41 -!- jix has quit ("Banned from network"). 16:46:15 -!- jix has joined. 16:46:45 back 17:14:18 <{^Raven^}> hullo 17:29:48 -!- harkeyahh has joined. 17:30:23 ChanServ my babeh 17:53:26 -!- calamari_ has joined. 17:53:32 hi 17:53:44 <{^Raven^}> hi there 17:55:33 hi raven, just sent you a mail :) can't work on it right now tho 17:56:47 <{^Raven^}> me either, i have a cross compiler to port to C and a load of other programs to write 17:57:51 <{^Raven^}> I have some ideas for writing better brainfuck virtual machines that I need to write up 17:58:35 * {^Raven^} prefers the term virtual-machine to interpreter any day 18:01:15 Doesn't "virtual machine" include the idea of sandboxing? 18:03:15 <{^Raven^}> It can do, it depends ultimately on the functionality you are trying to achieve 18:03:56 The machine isn't virtual if it's stepping all over your real machine, tho. 18:04:55 <{^Raven^}> IMHO any current interpreter that allows a program to wander into arbitary workspace is horrificly broken 18:05:09 malaprop: would you consider Java a virtual machine, even though it ties in to all sorts of low level stuff? 18:07:42 18:07:46 oops :) 18:12:38 Java the language? No, it's a language. JVM, yes, as a browser applet is sandoboxed. 18:14:17 <{^Raven^}> *depending on the security settings active at the time. A JVM with appropriate permissions can access the underlying OS 18:25:52 well, I don't think there is a definition of virtual machine that everbody would agree on 18:28:00 I don't see any definitions on Wikipedia that don't include some kind of sandboxing. Where do y'all see it defined without? 18:30:10 -!- graue has joined. 18:30:56 but what is sandboxing? brainfuck interpreters isolates the programs from the computer, and does not allow arbitrary memory and file access 18:32:36 bf is isolated because there's no implementation of file IO. It'd be a VM if bf had IO and it was to a fake filesystem only. 18:32:44 <{^Raven^}> malaprop: google for - define:virtual machine 18:34:20 {^Raven^}: Every definition it returns includes sandboxing. Heck, one simply says "A machine which is implemented in software." 18:38:14 Doesn't "virtual machine" include the idea of sandboxing? <--- my answer would be yes 18:38:25 <{^Raven^}> malaprop: At the lowest level a VM is a bytecode interpreter. A brainfuck interpreter interprets brainfuck bytecode. But I think we'll have to agree to disagree on this one. 18:39:22 i don't see how a brainfuck interpreter fails to be a machine implemented in software 18:39:38 I won't agree to disagree. You're using a term (VM) in place of the proper one (interpreter). 18:39:51 well on some level everything's just a virtual turing machine 18:39:53 graue: It doesn't include virtual disks, screens, anything. 18:40:33 machines don't need to have those things to be machines 18:40:42 I'm starting to think that "it's turing complete" is the computer science equivalent of solipsism. 18:41:33 And if we're going to go into boring useless theoretical concerns, nothing is a turing machine because they're finite. 18:42:01 the things we have, that is. 18:46:51 i'll reconnect 18:46:56 -!- tokigun has quit ("Chatzilla 0.9.68.5 [Firefox 1.0.3/20050414]"). 18:47:16 -!- tokigun has joined. 18:47:16 -!- graue has left (?). 18:47:32 -!- tokigun has quit (Client Quit). 18:47:49 -!- tokigun has joined. 18:47:58 back. 18:49:37 <{^Raven^}> hi tokigun 18:49:56 hello ;) 19:17:46 -!- harkeyahh has quit (Client Quit). 19:34:14 -!- Keymaker has joined. 19:34:28 hello 19:36:22 <{^Raven^}> hey 19:36:25 hello 19:36:59 hi 19:42:14 -!- smott_ has changed nick to smott. 20:05:10 -!- harkeyahh has joined. 20:05:29 sup ChanServ 20:08:37 -!- harkeyahh has quit (Client Quit). 20:13:45 brainfuck has a virtual teletype 20:13:53 hm? 20:14:02 what's that? 20:14:05 re malaprop's assertion 20:14:30 < malaprop> graue: It doesn't include virtual disks, screens, anything. 20:14:43 ok 20:14:59 malaprop is a sad sad man 20:15:12 if he thinks a language should provide access to a file system 20:15:24 heh yeah :) 20:20:41 -!- calamari_ has quit ("Leaving"). 20:33:01 -!- harkeyahh has joined. 20:37:13 I didn't say a language should, was pointing out that this one didn't. 20:37:24 :) 20:37:53 It starts simple: first programmers want access to files. Then before you know it they'll want OpenGL. 20:38:05 hehe 20:38:22 where's BFSDL? 20:39:52 What's BFSDL? 20:40:06 I'm familiar with Python's BDFL... 20:40:46 nothing :) it was a joke, SDL libraries for brainfuck :) 20:40:58 ah, heh 20:42:06 Or bfPVM. 20:47:05 Keymaker: SDL for Brainfuck? sounds good :) 20:48:26 You could see if you can port SWIG. 20:48:55 <{^Raven^}> There is EsoAPI and Easel in development as part of he PESOIX specification for esolangs. 20:49:47 <{^Raven^}> EsoAPI allows low level disk access (when running as the main OS) and Easel allows file IO and more 20:54:24 -!- jix has left (?). 20:54:28 -!- jix has joined. 20:59:43 -!- sp3tt has quit (Read error: 104 (Connection reset by peer)). 21:03:50 yeah. and to note: i am not going to do anything :) 21:07:03 hmm. someone search "simpsons" with google.. what add it gives you? 21:09:13 A whole lot of pages about the TV show. 21:09:34 i mean advertise 21:09:52 Got me, blocked. 21:10:00 <{^Raven^}> ebay and a warez site 21:11:03 ok. then the ads aren't same for us 21:12:54 "SEX XXX PORN LIVE SHOWS" was the ad I got. 21:13:46 well me too.. :} 21:40:26 hehe 21:40:34 these simpsons quotes are so funny :D 21:43:29 "My Homer is not a communist! He may be a pig, a liar, a communist but he is not a porn star!" -- grandpa 21:48:23 "I have been shot eight times this year, and as a result, I almost missed work." -- apu 21:51:08 "The Statue of Liberty? Where are we?!" -- milhouse 21:56:30 "McBain to base! Under attack by Commie-Nazis!" 22:01:27 anyways, i'm off to watch some simpsons. then probably go night photographing. so, see you tomorrow :) 22:01:37 -!- Keymaker has left (?). 22:15:48 -!- tokigun has changed nick to tokigun^away. 22:28:42 -!- jix has quit ("Banned from network"). 23:07:56 -!- GregorR has joined. 2005-06-14: 00:40:47 simpsons is on in 20 minutes god i need to watch it 00:40:50 i am so distressed 00:44:19 -!- heatsink has joined. 00:45:59 heatsink is 4am like in the nighttime? 00:46:29 harkeyahh: yes, in most parts of the world 00:46:53 wow, he is really a nighttime munchkin 00:47:03 who? 00:47:10 heatsink you have a pretty name 00:47:17 who did you kill for it? 00:47:29 the guy i am trying to get a job from 00:47:35 are you a bot? 00:47:42 you talk like one. 00:47:59 funny you mention that, because lots of people think I am a bot. 00:48:16 but I don't look like a bot 00:48:25 therefore I am not a bot 00:49:56 Error:#4128 _does not compute_ immediate implosion threshold broken 00:49:58 -!- harkeyahh has quit ("Chatzilla 0.9.68.5 [Firefox 1.0.4/20050511]"). 00:51:09 <{^Raven^}> did harkeyhh pass the turing test? 00:51:35 -!- harkeyahh has joined. 00:51:37 He must not have been written in GregorR's #Esolang. 00:51:51 Hello, ChanServ how are you today? 00:52:06 Fine thank you 00:52:31 No I haven't, and yes I do. 00:55:01 What is going on here? 00:55:21 an affair 00:56:04 apparently Jackson got 10 years to life in Juvenile Hall 00:56:50 * heatsink imagines that harkeyahh looks like a paperclip :3 00:57:11 paperclips are rather useful 00:57:25 I wouldn't mind have such a body 00:57:33 as long as they are not animated 00:57:37 Pliable yet strong 00:57:50 flexible, smooth 00:58:15 <{^Raven^}> can they do anything other than eject CDs/DVDs? 00:58:26 Paperclips are very sexy toys 00:58:40 since they are small, they can go almost anywhere 00:59:55 OMFG, I must leave. 01:00:04 * kipple tries to drive the mental images out of his brain 01:00:47 okay, bye harkeyahh 01:00:59 Sorry, I am not here right now. 01:01:09 LIAR 01:01:32 please refrain from slanderous statements 01:02:19 I am afraid a deity is toching my inappropriately 01:02:44 I'm sure it has seen you naked as well. 01:03:10 that webcam was not supposed to be public! 01:06:03 -!- harkeyahh has changed nick to iamnothere. 01:06:55 <{^Raven^}> nite peeps 01:07:12 * {^Raven^} toddles off to bed 01:08:35 goodngiht {^Raven~} 01:09:56 -!- iamnothere has set topic: Another brainfuck site (http://www.bf-hacks.org/) is open! ~ http://chriscoyne.com/cfdg/ ~ Esolang wiki: http://esolangs.org/wiki/ Please pray for my package to arrive safely in La Puente CA. thnx much!. 01:13:04 {^Rave^} wake up 01:13:23 pray for my package before you sleep 01:13:27 it will give you goodluck 01:14:52 -!- kipple has quit (Remote closed the connection). 01:15:14 heatsink how much is your nick? 01:16:01 I will pay $300 in monthly installments of 00.925 01:16:46 trimonthly $6.50 01:17:06 annually $10 01:17:49 I'll tell you what 01:18:18 heatsink $1500 for annual payments of $00.50 01:19:10 $10,000 for annual payments of $1.00! 01:19:47 I require annual payments of $1.00 plus payment of interest at 8% per year compounded monthly. 01:20:45 $10,000 annual payments of $5 annual interest of .25 01:21:14 interest to be paid in full with the last payment 01:21:37 plus $10,000 for wiring 01:21:53 There is no melloroos for monikers! 01:22:20 don't be a mitch about it! I want your nick! 01:23:06 I have made many acceptable offers and you have declined all of them 01:23:59 7th heaven is the stupidest damn show 02:14:20 -!- iamnothere has quit (Read error: 104 (Connection reset by peer)). 02:45:01 -!- wooby has joined. 02:49:36 -!- harkeyahh has joined. 03:06:17 -!- wooby has quit. 03:07:30 -!- wooby has joined. 03:09:19 -!- harkeyahh has quit (Read error: 110 (Connection timed out)). 03:10:11 -!- GregorR has quit (Remote closed the connection). 03:12:11 -!- GregorR has joined. 03:18:13 -!- calamari has joined. 03:18:21 hi 03:23:35 Hoi 03:25:25 A fine display of conversational skill, that was. 03:26:09 aye 03:26:57 Gettin' ready to release DirectNet Beta0.5 :) 03:27:20 GregorR: url? 03:27:44 http://directnet.sourceforge.net/ 03:28:10 (Not related to esoteric programming ;) ) 03:29:15 Any OSX users who can verify my ability to create workable DMGs? 03:35:16 * calamari tries to figure out how to cvs checkout the gaim plugin 03:35:40 It's in Beta0.5 ;) 03:35:58 And it's in the main directnet branch, you have to --enable-gaim-plugin to configure it. 03:37:38 oic, thanks 03:38:30 Also, it's undocumented and unintuitive since Gaim doesn't exactly provide the faculties for multiple connections >_> 03:38:56 Err, multiple connections by one plugin in an intuitive way. 03:40:15 it's magic :) cvs -z3 -d:pserver:anonymous@cvs.sourceforge.net:/cvsroot/directnet checkout -P directnet 03:45:22 -!- wooby has quit. 03:45:37 Anybody have an HPUX box they want to compile on XD 03:45:44 Or Irix, Solaris, ... 03:45:46 cool.. configure. Wish I knew how to use that for my apps :) 03:46:03 Cygwin? :) 03:46:03 It's quite handy once you get the hang of it. 03:46:07 MingW. 03:46:14 hehe 03:46:26 And I have a crosscompiler for that :) 03:47:04 ./configure: line 20979: cd: /home/calamari/directnet/./src/enc-cyfer/gmp: No such file or directory 03:47:06 (fyi) 03:47:29 Oh, forgot to mention ... 03:47:37 To compile from CVS you have to get GMP and Cyfer... 03:47:43 So first you have to run getcyfer.sh 03:47:54 I'll make that more intuitive ... in ten minutes XD 03:48:03 hehe 03:49:03 Just as soon as I get Beta0.5 up :) 03:59:03 Tada 8-D 04:00:27 hmm, weird.. cvs update didn't do anything 04:00:58 do->update 04:01:20 That was a different tada ;) 04:01:34 That was "Tada, finished releasing Beta0.5" 04:07:59 OK, now that's committed to CVS. 04:08:09 However, their anonymous CVS server sux, so it won't show up for a few hours. 04:08:27 Just go sh getcyfer.sh and aaaaaaaaaall will be well. 04:18:44 -!- harkeyahh has joined. 04:19:01 Hola sen~or 04:19:19 (I really have to stop speaking broken Spanish) 04:36:24 -!- malaprop has quit ("quit"). 04:51:27 -!- harkeyahh has quit ("Chatzilla 0.9.68.5 [Firefox 1.0.4/20050511]"). 05:33:05 -!- heatsink has quit ("Leaving"). 06:03:51 -!- lindi- has quit (brown.freenode.net irc.freenode.net). 06:03:53 -!- tokigun^away has quit (brown.freenode.net irc.freenode.net). 06:04:21 -!- tokigun^away has joined. 06:04:21 -!- lindi- has joined. 06:17:36 -!- GregorR-L has joined. 06:57:01 -!- tokigun^away has changed nick to tokigun. 07:08:33 "You snagged a perfect girlfriend. Amy's rich, she probably has other characteristics ..." 07:11:01 o_O 07:11:26 Futurama = good show XD 07:13:39 I have an irix box, but it doesn't have a C compiler. :p 07:13:47 Hmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmm 07:13:51 XD 07:14:09 In all technicality, I could probably suffice with libc and some headers. 07:15:37 (I've been intending to hook that Sun HD box (the one I mentioned re that scsi terminator) to it and move /usr on it or something, but for some reason haven't yet.) 07:18:53 I guess I should -> work first. (Can't you use sourceforge's compile farm to try compiling it? There seems to be at least solaris/x86 and solaris/sparc.) 07:20:03 It works fine on Solaris. 07:27:14 -!- calamari has quit (Read error: 110 (Connection timed out)). 07:59:59 -!- clog has quit (ended). 08:00:00 -!- clog has joined. 08:40:29 -!- sp3tt has joined. 08:59:08 -!- GregorR-L has quit (Read error: 110 (Connection timed out)). 10:19:44 <{^Raven^}> reading Korean Babeled into English is extermeley esoteric 10:20:03 <{^Raven^}> I see armies of rabbits invading the woodland :) 10:28:22 Did you read my website? 10:33:12 I wish to do a babelfish bot presentation somewhere in freenode. 10:33:23 if i could fix it to support utf-8 10:40:46 wait, it must be somewhere other than my website. 10:40:54 {^Raven^}: what did you read? 11:05:54 <{^Raven^}> tokigun's blog entry about lost kingdom 11:06:56 <{^Raven^}> comes out very poetic 11:07:04 puzzlet: hmm... i have to add unicode feature to TiniCube ;) 11:08:22 http://dev.tokigun.net/esolang/ i'm making my esolang page. (korean) 11:08:47 -!- tokigun has quit (Remote closed the connection). 11:08:51 tokigun's blog contains translator-unfriendly expressions. 11:09:14 Babelfish is worse though 11:10:04 Take a look at http://puzzlet.org/puzzlet/BabelFish~BabelFishAutomata 11:13:29 <{^Raven^}> eep 11:14:58 <{^Raven^}> but it's all very interesting to read though 11:23:55 ahahaha 11:28:24 a functional babelfish language 11:28:25 that's crazy 12:33:13 * {^Raven^} is lost and confused 13:31:38 -!- malaprop has joined. 14:02:02 -!- wooby has joined. 14:05:22 -!- jix has joined. 14:05:48 moin 14:06:12 hio 14:06:23 GregorR: DMG works fine 14:18:23 ? 14:31:57 of directnet 14:32:01 i'm able to mount it and whatnot 15:36:53 -!- cmeme has quit (Remote closed the connection). 16:06:57 -!- harkeyahh has joined. 16:33:49 -!- CXI has quit (Read error: 104 (Connection reset by peer)). 16:34:11 -!- CXI has joined. 17:03:56 -!- puzzlet has changed nick to puzzlet_utf8. 17:04:37 -!- puzzlet_utf8 has changed nick to puzzlet. 17:38:15 -!- Keymaker has joined. 17:39:06 rh.. me need food. me too hungry x[ 18:00:34 take a chef program and cook it.. 18:00:42 hmm 18:09:09 -!- harkeyahh has quit ("Chatzilla 0.9.68.5 [Firefox 1.0.4/20050511]"). 18:29:09 -!- wooby has quit. 18:41:34 how do i link "Category:StuffHere" in esowiki? 18:59:38 i added small page for stack: http://esolangs.org/wiki/Stack 19:23:43 yo 19:23:55 Keymaker: I don't get what you mean 19:25:03 do you mean that this text is intended for Category:Stack-based? 19:28:22 i meant that first i tried to add there a link to that Category:Stack-based 19:28:24 but couldn't 19:28:37 like "check out stack-based languages" 19:30:14 Keymaker: [[:Category: StuffHere]] 19:30:22 (note the leading colon) 19:33:48 thanks, i'll go to add it 19:56:55 grrh.. it's annoying to read posts (@ google groups) where people talk about brainfuck and don't understand its usefulness and so on.. grrrrrrrh. release the hounds! 19:59:55 At once, your lordship! 20:00:07 :) 20:01:26 anyone knows how to see non-ASCII characters in linux without Xserver? 20:02:24 with framebuffer, I guess 20:02:26 -!- sp3tt has quit ("Chatzilla 0.9.68a [Firefox 1.0.4/20050511]"). 20:02:28 -!- harkeyahh has joined. 20:03:20 puzzlet: you can change fonts for hardware text mode too 20:04:14 lindi-: I guess he means to read Hangul which I'm not sure but is probably > 512 symbols 20:04:53 lol 20:04:57 :D 20:09:15 ah, that is the keyword, framebuffer 20:09:33 i can't help forgetting things 20:48:23 bye 20:48:25 -!- Keymaker has left (?). 20:50:49 how can anybody possibly not understand the usefulness of brainfuck?!? 20:50:56 the most useful language ever!? 20:52:45 I'm tainted to add BF to [[Category:High-level]] 20:54:57 it's just so intuitive 21:02:59 -!- cmeme has joined. 21:03:16 -!- cmeme has quit (Remote closed the connection). 21:04:02 -!- cmeme has joined. 21:28:45 -!- harkeyahh has quit (Read error: 145 (Connection timed out)). 22:18:44 <{^Raven^}> ponders BF optimisation 22:19:09 pgimeno: I assume ORK is already there? 22:19:25 fizzie: Thanks for checking that, good to know :) 22:33:47 -!- jix has quit ("Banned from network"). 22:39:48 i think the list of esoteric languages should include Lisp :) 22:40:22 -!- calamari has joined. 22:54:19 GregorR: yes, thanks to kipple 22:54:41 nite all 22:54:49 cya pgimeno 23:09:24 LOL 23:09:25 Articles in category "Object-oriented paradigm" 23:09:25 There is 1 article in this category. 23:09:25 O 23:09:25 * ORK 23:10:19 hehe 23:10:57 I wonder if there can be an oo tarpit, or if there is one already 23:11:40 OOPS might be one 23:11:53 object oriented particle system 23:12:24 Oh, btw, about Lisp, lament: hear hear)))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))) 23:12:24 )))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))) 23:40:05 is there a Special: page that gives a list of links to pages that haven't been made? 23:41:06 aha.. "wanted pages" 2005-06-15: 00:34:28 -!- kipple has joined. 00:34:39 evenin' 00:34:46 hi kipple 00:35:14 Gregor: there are now 2 articles in the OO category :) 00:39:28 -!- graue has joined. 00:40:44 hi_graue 00:41:52 hi calamari 00:42:33 * calamari notes that the Monobook "wikipedia" skin looks a lot better than 'classic' :) 00:42:42 yeah. I use that one 00:43:21 IMHO it should be the standard skin as it is the one used by wikipedia, and therefore probably most familiar to users 00:44:25 graue: is there a special page like Special:WantedPages that'll show even single links to pages that haven't been made yet? 00:45:25 also, I'm wondering why there is both a Category:languages page and language_list.. can the language_list page go away? 00:46:33 in theory. but not as long as categorization is not complete 00:47:22 would be nice to have some weapons of mass-categorization... 00:48:32 that shouldn't be hard to do.. I can just click each page and add [[Category:Languages]] 00:51:01 actually, what would be better is to leave both pages for now, and only delete items off the language list when a real categorization is complete 00:51:37 then the language_list will finally be empty 00:52:38 the Language list needs to stay 00:53:04 (IMHO, anyway) 00:53:44 the language list is nice because it can contain languages that doesn't have an article yet 00:55:16 wish there was an automatic way to have it be added to the language list.. I've created a few language articles and never updated the list 01:08:38 -!- lindi- has quit (brown.freenode.net irc.freenode.net). 01:09:45 -!- lindi- has joined. 01:13:07 -!- graue has left (?). 01:21:47 I updated the HQ9++ page and the main page (hope nobody minds 8-D) 01:23:07 why should anybody mind? that is the purpose of a wiki after all 01:50:21 GregorR: I've edited your edit :) 01:59:28 bbl 01:59:30 -!- calamari has quit ("Leaving"). 02:02:38 hmm. should TMMLPTEALPAITAFNFAL be categorized as nondeterministic? 02:08:43 on second thought, I think not 02:25:04 -!- kipple has left (?). 02:38:45 -!- calamari has joined. 02:56:03 -!- graue has joined. 03:46:23 -!- wooby has joined. 03:46:51 hio 03:48:31 -!- calamari has quit (Connection timed out). 04:10:58 -!- graue has left (?). 04:42:29 -!- malaprop has quit ("quit"). 05:12:19 -!- calamari has joined. 05:16:54 -!- calamari has left (?). 05:21:59 -!- calamari has joined. 05:22:01 hi 05:35:29 BWAAAAAAAAAAAAAAHAHAHAHA 05:35:30 Hi mean hi. 07:59:59 -!- clog has quit (ended). 08:00:00 -!- clog has joined. 08:31:21 -!- calamari has quit ("Leaving"). 08:55:10 -!- comet_11 has joined. 08:55:17 -!- CXI has quit (Read error: 54 (Connection reset by peer)). 08:55:46 -!- comet_11 has changed nick to CXI. 09:43:36 -!- CXI has quit (Read error: 104 (Connection reset by peer)). 10:02:03 -!- CXI has joined. 10:08:33 -!- CXI has quit ("If you're reading this, it's probably x-chat's fault."). 10:08:43 -!- CXI has joined. 12:03:04 -!- J|x has joined. 12:13:09 -!- J|x has changed nick to jix. 12:18:14 <{^Raven^}> morning peeps 12:20:35 moin 12:22:58 <{^Raven^}> have had some really good ideas for BFBASIC but don't have the necessary Java skill to program em :( 12:24:49 -!- kipple has joined. 12:25:41 <{^Raven^}> hi 12:25:59 hello 12:34:42 -!- J|x has joined. 12:35:20 -!- jix has quit (Nick collision from services.). 12:35:22 -!- J|x has changed nick to jix. 13:00:02 -!- {^Raven^} has changed nick to Penance. 13:00:23 -!- Penance has changed nick to {^Raven^}. 13:22:26 -!- malaprop has joined. 15:29:59 -!- smott has left (?). 15:33:47 -!- tokigun has joined. 15:58:24 -!- Keymaker has joined. 15:58:46 'ello 15:59:04 raven: who says it must be done in java? 16:01:17 i need cola 16:01:28 * Keymaker thinks about going to store 16:01:41 * Keymaker decides not to go yet 16:02:52 <{^Raven^}> Keymaker: BFBASIC is written in Java so alterations to it need to be in Java too 16:03:03 yes, i know that 16:03:44 what kind of features they are? 16:04:33 <{^Raven^}> so far I have SELECT CASE/WHEN/OTHERWISE/END SELECT worked out 16:04:54 {^Raven^}: any url to BFBASIC sources? 16:05:02 <{^Raven^}> CASE is nestable. FOR ... STEP for +ve/-ve steps 16:05:17 ok 16:05:23 <{^Raven^}> Code libraries and source split over multiple files 16:05:31 <{^Raven^}> Named functions and procedures 16:05:57 <{^Raven^}> and string support which is so badly needed 16:07:25 <{^Raven^}> lindi-: http://sourceforge.net/projects/brainfuck/ the source is in the CVS 16:07:41 -!- wooby has quit. 16:08:02 i tried http://lilly.csoft.net/~jeffryj/compilers/bfbasic/bfbasic.zip -- that is older? 16:08:36 <{^Raven^}> Calamari's page ^^ has 1.30 and 1.40 is on sourceforge 16:08:47 ok 16:09:17 <{^Raven^}> I just think that it sucks that I could add all these if it was in a language I was more familiar with 16:10:10 <{^Raven^}> named functions and procedures will be able to have parameters too ;) 16:10:38 <{^Raven^}> it will mean that libraries of useful BFBASIC routines could be written and INCLUDEd in user code 16:49:15 hmm 16:57:11 <{^Raven^}> Keymaker: hmm? 16:57:49 hm. 16:58:10 that is, i can't find how you can check if file exists (in python) 16:59:15 as well, i'm hungry and thirsty 17:00:04 <{^Raven^}> keymaker: http://diveintopython.org/file_handling/ seems to have some info on that 17:00:54 Keymaker: how about this: 17:00:56 try: 17:01:04 file = open('file.txt') 17:01:10 # do stuff with file 17:01:13 except: 17:01:17 #print error 17:01:33 ok 17:01:47 should catch IOError and make sure that the errno is 2 just to be specific 17:01:59 ? 17:02:03 what is errno? 17:02:15 an attribute of the exception object 17:02:38 pull up the interpreter and do 'open("foo")' so you can see the exact exception that's thrown, then catch only that. 17:04:14 oah 17:04:25 now i see 17:07:17 You just don't want to accidentally catch other exceptions is all. 17:30:57 -!- harkeyahh has joined. 17:31:28 ok, i'll go to store now 17:31:30 bbl 17:44:22 well, i didn't go 18:01:46 -!- kipple has quit ("See you later"). 18:03:15 -!- fizzie has quit (brown.freenode.net irc.freenode.net). 18:05:09 -!- fizzie has joined. 18:05:41 -!- fizzie_ has joined. 18:05:41 -!- fizzie has quit (Read error: 104 (Connection reset by peer)). 18:07:48 -!- kipple has joined. 18:22:05 -!- fizzie_ has changed nick to fizzie. 18:27:03 -!- jix has quit ("This computer has gone to sleep"). 18:43:41 -!- kipple has quit (Remote closed the connection). 18:53:15 hehe, i made up a new esolang 18:53:17 http://koti.mbnet.fi/yiap/stuff/unnecessary.html 19:10:47 Hm, shouldn't the source files exist but be 0b? 19:15:21 No, that would make the source file necessary. 19:15:38 Ah, I see. 19:16:15 <{^Raven^}> But necessary[1] is a different language. [1] Hypothetical sister language to unnecessary 19:20:48 Keymaker: good esolang ;) 19:39:06 -!- jix has joined. 19:44:34 back 19:45:42 hehe, cheers 19:56:47 i have an idea for a graphical (esoteric.. but writeable) language 19:57:00 what kind of? 19:57:50 you arrange your program using elements and conect them using.. wires and it has anonymous functions .. and there are no function names.. just symbols 19:58:08 that'd be cool 20:06:51 wow wow wow wow awesome!!!!!!!!!!!!!!!!!!!!!!! 20:07:17 a game i didn't back then couldn't finish or play properly when i had crappy computer, and then forgot it for years, 20:07:32 and now when reading jurassic park books thought i could try again, 20:07:41 jix: Sounds neat, and a lot like my mental picture of programming. 20:07:44 seems to be editable with cool editors that fnas have made 20:07:54 *fans 20:08:01 bbl 20:08:03 -!- Keymaker has left (?). 20:09:34 jix: aardappel has written a bunch of those, look on his page 20:09:41 well, they do have names iirc 20:10:33 I believe i had made a language very similar to Keymaker's, year ago 20:10:35 *years 20:10:41 Called ZEN 20:11:33 lament: where is aardappel's page? 20:11:34 The coolest part about ZEN was that ZEN programs execute themselves 20:11:51 http://wouter.fov120.com/ 20:12:02 his languages are at http://wouter.fov120.com/proglang/index.html 20:12:20 thanks 20:12:25 lament: i know aardappel and i my brother even knows someone who knows the author of aardappel but my language is different (i think so) 20:12:40 jix: not the language aardappel, the person aardappel 20:12:54 jix: who is probably the person your brother knows :) 20:13:18 i must miss read that.. 20:13:34 he's like, the saint and the founding father of esoteric languages 20:13:38 and cpressey is his prophet 20:13:43 he also used to come here 20:13:46 the language and the person 20:13:48 oh, the cube guy 20:13:54 Wouter van Oortmerssen aka Aardappel 20:13:59 Languages: Aardappel, Bla, E, Fals.... 20:14:12 whoa 20:14:17 he wrote False too? 20:14:34 exactly 20:14:36 that's awesome 20:14:55 yes.. i wouldn't know that my brother knows... if he didn't come in atm i was viewing the false page 20:15:01 CXI: yeah, he's a genius 20:15:46 but usually people just talk about Cube to point that out; not his programming languages 20:16:11 Cube's pretty cool, but I wouldn't call it genius material 20:16:59 well, whom else do you know who wrote something of that scope by himself? 20:17:42 what, a fps? 20:17:52 not necessarily an fps 20:20:29 Cube looks very neat. Wish I wasn't at work, heh. 20:20:35 heh 20:20:38 it's pretty cool 20:20:47 unfortunately the physics engine is basically a giant hack :D 20:20:56 oh? 20:21:17 a friend and I had a look at using it for an fps 20:21:29 but it got pretty difficult when we realised how much of the physics code we'd need to rewrite 20:23:02 it was pretty impressive nonetheless 20:23:30 Why was the physics engine unsuitable for your needs? 20:24:13 we wanted to do more interesting things with it... object motion, friction against different surfaces, variable gravity 20:25:29 the actual engine is sorta... add a bit here, add a bit there, multiply by a number that sounds good, add a bunch of special cases 20:25:42 which works fine for the game itself 20:25:48 Ah, I dig. 20:25:48 but extending it can be hard 20:37:00 -!- Keymaker has joined. 20:37:16 f**k s**t x{ 20:37:26 the cd is lost! 20:37:30 fuckfuck? 20:37:35 "x{"? 20:37:41 emoticon 20:37:47 <{^Raven^}> X( = angry 20:37:47 the cd of which game? 20:37:54 ah, thought it was just a really short swear you censored 20:37:58 jurassic park trespasser 20:38:05 fck 20:38:10 only cd i have lost 20:38:20 and i was sure i had seen it lately 20:38:24 really annoying 20:38:35 just when i was about to play it 20:38:48 and just when i found out that there are level editors and stuff for it thesedays 20:38:59 just ten minutes ago i found that out 20:39:02 I can't find a whole lot of my CDs :( 20:39:04 and can't find that cd 20:39:05 :( 20:39:10 now i have to buy it again 20:39:15 RGGGGGGGGGHHHHHHHHHHH!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! 20:39:15 specifically, my Whitlams CD and my copy of Freespace 20:39:17 download it? 20:39:22 i can't 20:39:38 CXI: how many CDs do you have? :S 20:39:44 a zillion 20:39:49 oh. 20:40:06 (be warned that number may not be exact) 20:40:15 :) 20:40:21 it's really annoying 20:40:37 if i could download and so on, i would probably do that, since i've bought the game before 20:40:42 CXI: If you want another copy of Freespace, ask me in a couple days when I'm home and I'll see if I have it to rip for you. 20:41:21 well, at least i have two of those nice game boxes featuring a velociraptor 20:41:46 oh, and probably i can't find it anywhere since it's probably 5 years old game 20:41:49 * Keymaker dies 20:41:59 * {^Raven^} only ever uses the original disk as the backup and a copy of it for playing 20:42:13 that'd be clever, I should do that instead 20:42:17 14:43:03 * {^Raven^} only ever uses the original disk as the backup and a copy 20:42:24 oops, pardon 20:42:51 there's this pattern 20:43:00 every time I delete a game off my hard drive the original CD goes missing 20:43:24 <{^Raven^}> most publishers offer replacement CDs for a small charge 20:44:51 i'm so annoyed. i'll go hunting the game tomorrow. let's hope some small pc store still has copy (for extra low price) 21:37:36 -!- wooby has joined. 21:54:04 -!- wooby has quit. 22:30:22 -!- jix has quit ("Banned from network"). 22:30:40 -!- CXI has quit (Read error: 104 (Connection reset by peer)). 22:30:41 -!- comet_11 has joined. 22:33:13 -!- comet_11 has changed nick to CXI. 23:16:50 -!- harkeyahh has quit (Read error: 60 (Operation timed out)). 23:23:16 -!- harkeyahh has joined. 2005-06-16: 00:12:32 <{^Raven^}> g'night peeps 00:45:00 nite 00:45:10 wow. clock is already 3 am 00:45:26 time has gone fast when i have been studying jurassic park trespasser 00:46:35 Keymaker: i have already made a language that does nothing 00:47:26 i can perhaps find it given the esolang archive 00:47:29 or perhaps not 00:50:47 hee, found my original post suggesting to place the irc channel on freenode :) 00:54:01 hmm, cant find it 00:54:10 -!- harkeyahh has quit ("Chatzilla 0.9.68.5 [Firefox 1.0.4/20050511]"). 00:55:03 -!- kipple has joined. 00:57:39 -!- calamari_ has joined. 00:57:41 hi 00:58:48 ho 00:59:22 cpressey_: ha 00:59:23 sorry lament, i didn't know that 00:59:40 cpressey_: theres a mail by you to esolang from 2001 00:59:52 cpressey_: about turing-complete vs. "useful" 01:00:29 cpressey_: and you propose to differentiate useful languages by building a "controlled oscillator" in them 01:00:40 http://esoteric.sange.fi/archive/2001-q3 01:01:23 Keymaker: I've been wanting to rewrite a lot of that bfbasic code, but I kept it the way it was so that Jon could write his game.. didn't want to break it and not be able to get it back together before spring break ended :) 01:01:37 lament: yes, i remember that 01:01:56 (why do i have a tail all of a sudden...?) 01:02:00 keymaker: right now all the statements and operators are in a big messy blob.. crappy code basically.. hard to understand and extend 01:02:27 -!- cpressey_ has changed nick to cpressey. 01:02:54 cpressey: convergent evolution 01:03:14 Keymaker: that's okay, i think it's because i never published it... 01:03:55 Keymaker: anyway it was called ZEN, null program was the only one, iti did nothing, and thus ZEN programs executed without any need for a physical computer... 01:03:57 * calamari_ wonders why there isn't a Chris Pressey page yet.. too prestigious? 01:04:41 might need a table of contents :) 01:04:48 Keymaker: i.e. not only each program was a quine, but also a (self'executing) ZEN interpreter 01:06:47 calamari: ok 01:07:07 lament: ok 01:08:14 * lament dies, temporarily 01:08:17 btw, is every Unnecessary program a Unnecessary interpreter too? 01:08:17 * calamari_ just sent everyone an Unnecessary program.. hope you enjoy 01:08:29 hey, good work calamari! 01:08:32 :) 01:08:54 thanks.. nice language there :) 01:09:00 heh, thanks 01:09:40 keymaker: are you familiar with flex/bison/yacc, etc ? 01:09:48 nope 01:09:57 neither am I... unfortunately 01:10:07 why should you be? 01:10:08 I suspect they would be the best way to redo bfbasic 01:10:13 ah 01:10:23 what about this python..? 01:10:33 it would take care of all the parsing ,which is where the big mess comes in 01:10:41 python is cool, I guess... 01:10:46 but Java is better! :) 01:10:51 nooo! 01:11:19 I'm getting more comfortable in python, but I still don't like it nearly as much as Java 01:11:53 something about it just seems tacked together and fragile 01:12:17 hmm 01:14:36 I also like Java's library much more than python's 01:14:59 although python does have lots of nifty string stuff.. that makes it bearable :) 01:15:13 yes 01:15:26 because of that i was suggesting it 01:16:20 I suggest that we stick with the current code for now.. although ugly, it does work (except for the bugs).. so once we get the bugs fixed we can port it or whatever 01:16:42 the bugs seem to be centralized in the array code 01:17:12 I've been meaning to plug it into a bf debugger and check it out.. see if it does what I think it does, etc 01:17:16 Java eh... 01:17:25 My only problem with Java is that it sucks horribly in every way. 01:17:30 Other than that, it's good. 01:17:48 :) 01:18:22 * GregorR pets C. 01:18:28 Ahh, my good friend ... 01:18:29 calamari once thought as you do.. you don't know the POWER of the Java side :) 01:18:54 I must obey my master 01:19:03 Java is too far Object Oriented. Object Orientation is good for certain things, but unlike they hype says, it is NOT good for everything, or even most things. 01:19:23 There are several tasks for which OO is perfect. And for those, I use C++ so I can drop out of OO when necessary. 01:19:23 * cpressey runs to get the popcorn 01:19:25 you can do functional programming in Java if you'd like 01:19:40 just declare your methods statci 01:19:43 But anyway, I just got off work, so now I am to leave :P 01:19:44 err imperative 01:19:47 mmh.. popcorn.. 01:20:02 hehe 01:20:15 cya gregor, have fun using c.. I'll toss you some free()'s :) 01:20:34 perhaps ORK would be good for this project? 01:20:58 perhaps we should just cut out all this fancy stuff and write it in bf 01:21:32 yes 01:21:44 I would like to bootstrap it someday.. but we're not far along enough yet 01:21:50 hehe 01:22:00 i was just going to say that :) 01:22:00 hey! I got bfasm bootstrapped 01:22:16 that's cool 01:22:17 hm, you might be able to do functional programming in java... but you'd have to use objects to handle anonymous functions, i think... 01:22:38 calamari_: re bfasm: right on! 01:22:45 bootstraps R kewl 01:22:51 yeah 01:23:03 cpressey: thanks.. I can't believe my wife put up with me doing it.. I was glued to the computer for days.. couldn't quit :) 01:23:12 hehe 01:23:43 have you even uploaded it anywhere? 01:23:48 the bootstrap? 01:23:50 yeah, it's on my webpage 01:24:03 ah. i need to check 01:24:03 its in the bfasm zip 01:24:05 it out 01:24:05 ok 01:24:08 the c file is actually the one in extras 01:24:21 yeah, I don;t think I released it before the bootstrap was done 01:24:32 it's been a while tho 01:25:13 I need to redo some of the stuff.. bfbasic has made improvements to some of the bf code 01:25:45 well anyhow.. I need to go home.. cya all later on 01:26:02 -!- calamari_ has quit ("<=K"). 01:26:23 bye 01:26:39 wow. that bfasm.b sure is neat.. :) 01:26:50 anyways, i need to go to. it's 3:30 am. 01:26:55 -!- Keymaker has quit ("I've seen this déjà vu before.."). 02:37:48 -!- calamari has joined. 02:38:24 hi 02:39:28 <{^Raven^}> hullo 02:41:29 hi raven.. hows the island? 02:42:05 <{^Raven^}> pretty good, 02:42:51 <{^Raven^}> there was a minor riot in town earlier with the G8 summit peeps but nothing too bad 02:43:16 <{^Raven^}> hows you? 02:46:18 <{^Raven^}> i've been pondering BFBASIC enhancements but am not sure of the current state of play 02:47:57 <{^Raven^}> have got some good ideas about how to implement strings 03:00:20 raven: I'm fine.. a little tired :) 03:00:52 good ideas about strings.. cool. Are they basic-like or c-like? 03:01:03 in other words.. garbage collection 03:02:23 <{^Raven^}> C like with a fixed maximum length set on initialisation. 03:03:10 <{^Raven^}> current idea is that a string can be treated internally as a numeric array 03:03:17 of course 03:03:32 the nice thing is that it doesn't need to be null terminated 03:03:41 <{^Raven^}> with all string handling operations being treated internally as array transformations 03:04:16 <{^Raven^}> yeah, they can be but there is no value in [<] or [>] due to how array elements are stored in memory 03:04:49 no I'm saying it doesn't need to be null terminated 03:05:16 It would be easiest to navigate around strings if they were double-null-terminated... 03:05:17 or are you suggesting something different than a numeric array? 03:05:43 <{^Raven^}> no, just a rehular numeric array 03:05:58 if you want the string to be immutable, then you don't even need to skip cells 03:06:04 then you could null terminate it 03:06:56 what about a bunch of immutable strings and a malloc? 03:07:15 <{^Raven^}> haven't thought about that 03:07:19 then you could imitate variable length strings 03:08:00 it'd be similar to current array code, but each "cell" would have a width value 03:08:08 Whoops, I just bought another year on codu.org when I already had XD 03:08:18 Now I'm good through '07 though, so no prob :P 03:08:59 hm.. now that I think of it.. that wouldn't really work 03:09:20 well it could, I guess with null termination 03:09:36 <{^Raven^}> it seems that it will be more effiecent to define a string as a fixed sized array 03:09:37 it'd be an interesting challenge 03:09:47 yeah, it would be.. 03:10:21 <{^Raven^}> string constants could be handled internally by the interpreter and inlined into the compiled code 03:10:27 but say you did something like A$=B$+C$.. it would take B$ and C$, determinae a new length for A$, and copy B$ and C$ into the space 03:10:29 <{^Raven^}> but I am not sure about their value 03:11:25 <{^Raven^}> you would need to initialise A$ somewhere also specifying the maximum length of A$ 03:11:53 yeah, it'd be right with the variable 03:12:05 -!- kipple has left (?). 03:13:08 <{^Raven^}> lots of string operations seem to be fairly simple 03:13:24 currently I think it's var B A element 0 element 0, etc.. so it'd be something like: maxlength, length, 0, elements, 0 03:13:41 probably needs a bit of tweaking .. need to map it out on paper 03:14:37 there wouldn't really be a free(), strings would just persist and grow, or be overwritten 03:15:20 <{^Raven^}> i am not sure how to make such a heap work in brainfuck 03:15:29 you don't need one 03:15:31 <{^Raven^}> hence the fixed allocations 03:15:47 there'd just be a "temporary" string that is used 03:16:29 for example, in A$=B$+C$, it doesn't know about A$ yet, because of the parsing order.. to it's actually like TEMP$=B$+C$ 03:16:39 then A$=TEMP$ 03:16:57 -!- harkeyahh has joined. 03:17:19 only problem with this scheme is that things like MID$ wouldn't work 03:17:29 that's probably not great 03:17:51 <{^Raven^}> not at all. MID$ is fairly simple 03:17:56 well MID$ would work if the exact offset was given, but otherwise, nope 03:18:13 <{^Raven^}> should still be able to work 03:18:24 for example if it's a constant that can hardcode some >>>>'is the file, you're all set 03:18:40 <{^Raven^}> MID$ can be decomposed into a FOR...NEXT loop 03:18:43 but if you're saying MID$(A$,X,Y), you're stuck 03:19:07 because it has no way to get to element X on its own 03:19:27 that would require using regular arrays with 2 elements per character 03:19:28 <{^Raven^}> no, FOR temp = X TO Y:do something with _strA(temp):NEXT 03:19:35 calamari, {^Raven^} is always right, get over yourself. 03:19:41 harkeyahh: hahaha 03:19:56 talking about VB? 03:20:17 <{^Raven^}> rofl 03:20:36 Hmmmmmmm, implementing VB in BF. 03:20:39 Now that sounds like fun. 03:20:45 Almost as fun as self testicular mutilation. 03:21:02 self testicular gesticulation bahaha 03:21:29 I feel sorry for vb.. it started out great, especially vb-dos 03:21:39 <{^Raven^}> DIM A$(40) becomes DIM _strA(42):_strA(0)=40 (maxlen):_strA(1)=0 (current length) 03:22:04 self testicular mastication my ass calamari 03:22:11 <{^Raven^}> the string itself is stored in _strA(2)..._strA(42) 03:22:20 raven: what I'm trying to say is that you can't access individual array elements because you have no way to get to them.. the first [>] goes straight to the end of the string 03:22:43 harkeyahh: umm.. I didn't say that ;) 03:23:19 it was hypothetically implied calamari 03:23:31 for your convenience 03:23:33 raven: unless you'd like to use regular array code, in which case this whole malloc scheme becomes irrelevant :) 03:23:52 please come again calamari, and bring some fish with you 03:24:02 harkeyahh: are you high? 03:24:13 no i'm actually below sea level 03:24:18 hhahaha 03:24:32 <{^Raven^}> calamari: my current my entire idea is based on using regular array code. Just because I know that in concept it should work 03:25:12 raven: yeah..probably best 03:25:43 raven: might be able to make the strings mutable with that.. but maybe it's too much work 03:26:06 just having the basics would be great :) 03:26:19 <{^Raven^}> calamari: that all depends on what the impact code size/efficiency is 03:27:58 <{^Raven^}> calamari: it should give us at least INPUT PRINT ASC LEFT$ MID$ RIGHT$ INKEY$ 03:28:07 it'd be just like regular array operatings, as you say.. but there'd be a lot of them 03:28:29 SPACE$ and STRING$ are nice too 03:28:37 as well as ASC 03:28:44 <{^Raven^}> that's my only concern is the large amount of code that will be generated, but I am not sure that there is any way to avoid that 03:28:45 oops, didn't see it hiding in there :) 03:29:04 <{^Raven^}> ASC A$ becomes _strA(2) 03:29:27 <{^Raven^}> (if length in _strA(1) is not NULL) 03:29:45 well, if we examine the array clode closely (which I think we'll need to to find the existing bugs), we could probably code bf native versions of each of those and save some statements 03:30:18 otheriwse, we'd be building it on top of existing bbfbasic statements.. that could get bloated 03:30:59 <{^Raven^}> yeah, we might need two variants, one for handling MID$(A$,1,2) and another for MID$(A$,X,Y) 03:31:20 <{^Raven^}> the first variant should be possible to code very efficiently 03:32:11 you'd still need a temp variable.. 03:32:17 that's something to think about 03:32:43 hopefully it'd be to the right of all current memory to allow it to grow very large if needed 03:33:20 <{^Raven^}> yes, I think that we could get away with declaring a temp string as large as the largest string 03:34:06 and also.. check out something like A$ = B$ + MID$(C$ + MID$(D$, A, B), X, Y) + E$ 03:34:44 hmm.. I think it can work :) 03:35:00 there isn't really any complex order of operations with strings 03:35:18 one temp variable can handle th entire thing, step by step 03:35:31 neato 03:35:47 <{^Raven^}> yeah. If we need to print a string larger than the temp we can do it on the fly 03:35:58 <{^Raven^}> but only for printing 03:36:10 it'd need to be the rest of memory.. take input for an example of that 03:36:52 unless you wanted to do something like INPUT$(numchars) which would be more responsible 03:37:09 wouldn't want to be known for bring buffer overflows to bf :) 03:38:32 <{^Raven^}> _t1=0:REPEAT:_to=INKEY:_strA(_t1)=_t0:_t1=_t1+1:UNTIL _t0=10 OR _t0=13:_strA(1)=_t1-1 03:39:17 <{^Raven^}> or UNTIL _t0=10 OR _t0=13 OR _t1>=_strA(0) to avoid the overflow 03:39:50 <{^Raven^}> above would be equivalent to INPUT A$ 03:43:15 well, I'm all for the idea of strings in bfbasic, it'll cause some parsing headaches and such of course, but I think we can handle it. the main thing though is fixing the current bugs first 03:43:31 otherwise we're doomed w.r.t. arrays :) 03:46:13 <{^Raven^}> that's the kick in the teeth really, nothing (string related) can be done until then. 03:48:34 <{^Raven^}> I like the stuff that you put on the brainfuck agorithms page on the esowiki 03:48:42 <{^Raven^}> looks familiar ;) 03:50:33 thanks .. we should fact check that array code .. hehehe 03:51:12 still weird, because i did test it while writing it and all seemed fine 03:51:49 need to port my bfadebug to linux 03:53:44 w00t, just got DN b0.6 out, much nicer build system now :) 03:54:02 0.6 already? I'm way behind with my 0.4 03:54:24 0.4 to 0.5 was a huge change, 0.5 to 0.6 had no code changes :P 03:55:02 0.4 to 0.5 was after implementing tons o' features and then letting it languish while I tracked down one nasty bug for a few months >_< 03:56:54 yay, it complained about my lack of gmp 03:57:59 Heheh :P 03:58:16 I assume you just got CVS? 04:02:16 yeah 04:02:31 "cvs update -d" 04:03:19 Is there any reason you haven't downloaded gmp and cyfer/ 04:03:21 *? 04:06:11 what are they? 04:07:09 synaptics says I did have libgmp3 04:17:40 It compiles them in statically because they work a bit funkily in DN. 04:17:47 You have to run getcyfer.sh (like it says) 04:17:50 Then it'll all be happy. 04:17:59 GMP = GNU Muli-Precision library 04:18:03 Cyfer = an encryption library 04:21:06 <{^Raven^}> GregorR: Nice hacker test you've got on your site, gonna have to go test some peeps with that 04:31:01 * GregorR wonders whether A) {^Raven^} wandered off of my site or B) {^Raven^} is mocking my use of a wiki for DN ... 04:31:29 Ahh, the one on the Cyfer page. 04:31:32 I did not write Cyfer. 04:34:52 * {^Raven^} ponders that it's 4:30 am and he should have been asleep hours ago 04:35:16 <{^Raven^}> I chose option A. 04:36:57 * {^Raven^} waves nite to all the esopeeps and toddles off to bed (again) 04:38:06 -!- harkeyahh has quit ("Chatzilla 0.9.68.5 [Firefox 1.0.4/20050511]"). 04:48:42 -!- ChanServ has quit (brown.freenode.net irc.freenode.net). 04:48:42 -!- fizzie has quit (brown.freenode.net irc.freenode.net). 04:49:47 -!- calamari has quit (brown.freenode.net irc.freenode.net). 04:49:48 -!- CXI has quit (brown.freenode.net irc.freenode.net). 04:49:48 -!- tokigun has quit (brown.freenode.net irc.freenode.net). 04:49:48 -!- malaprop has quit (brown.freenode.net irc.freenode.net). 04:49:48 -!- lindi- has quit (brown.freenode.net irc.freenode.net). 04:49:48 -!- {^Raven^} has quit (brown.freenode.net irc.freenode.net). 04:49:48 -!- cpressey has quit (brown.freenode.net irc.freenode.net). 04:49:48 -!- puzzlet has quit (brown.freenode.net irc.freenode.net). 04:49:48 -!- pgimeno has quit (brown.freenode.net irc.freenode.net). 04:49:48 -!- mtve has quit (brown.freenode.net irc.freenode.net). 04:49:48 -!- ZeroOne has quit (brown.freenode.net irc.freenode.net). 04:49:48 -!- cmeme has quit ("Client terminated by server"). 04:50:20 -!- ChanServ has joined. 04:50:20 -!- calamari has joined. 04:50:20 -!- CXI has joined. 04:50:20 -!- fizzie has joined. 04:50:20 -!- tokigun has joined. 04:50:20 -!- malaprop has joined. 04:50:20 -!- lindi- has joined. 04:50:20 -!- {^Raven^} has joined. 04:50:20 -!- cpressey has joined. 04:50:20 -!- puzzlet has joined. 04:50:20 -!- pgimeno has joined. 04:50:20 -!- ZeroOne has joined. 04:50:20 -!- mtve has joined. 04:50:20 -!- irc.freenode.net has set channel mode: +o ChanServ. 04:50:50 -!- cmeme has joined. 04:53:15 hmm 04:58:15 http://gregorr.homelinux.org/scrabble/scrabble.php = libc scrabble values :) 04:59:13 scrabble? 04:59:53 GregorR: you mean English word game? 05:00:29 Except that I'm making it libc :) 05:00:41 ;) 05:00:43 libc scrabble > luser English scrabble 05:01:12 fprintf is worth 7 points 05:01:39 libc scrabble... good! 05:01:49 pthread_mutex_lock is worth 21 XD 05:02:34 i wondered why is there "_" letter ;) 05:02:56 Heheh :) 05:05:54 http://page.tokigun.net/obfuscation/file/2004/md5calc.bf 05:05:59 oops 05:06:35 i have to paste it in other window.. :S 05:26:46 lalala 05:34:21 Grr, how do you change the bgcolor of a td in JS >_< 05:37:54 GregorR: if you hate MSIE, use :hover css psuedo-selector. if not, use this.style.backgroundColor(probably) in inline script. 05:43:01 found my SMETANA interpreter that i don't think I ever published: 05:43:02 (lambda s=__import__('sys'),f=lambda f,l,p,n=lambda l,p:map(int,__import__('re').findall('\d+',l[p])):p>=len(l)and l or len(n(l,p))==3 and f(f,l[:n(l,p)[1]]+[l[n(l,p)[2]]]+l[n(l,p)[1]+1:n(l,p)[2]]+[l[n(l,p)[1]]]+l[n(l,p)[2]+1:],p+1)or f(f,l,n(l,p)[1]):s.stdout.writelines(f(f,file(s.argv[1]).readlines(),0)))() 05:43:47 except it dosen't work 05:44:16 but i remember it working with an older python :( 05:44:19 fuck 05:44:46 oh, i forgot to pass a command-line argument, nvm 05:46:20 lament: do you like obfuscated python? ;) 05:46:44 okay, this interpreter officially doesn't work :( 05:46:56 tokigun: you bet 05:47:15 i think you like this one: http://page.tokigun.net/obfuscation/file/2004/tenma.py 05:47:31 (not very obfuscated however) 05:48:26 pretty 05:49:02 GregorR: sorry for this silly question.. but what do I connect to with directnet? I tried your ip but it did not connect. 05:49:02 it contains interpreter, assembler, disassembler of whitespace. 05:49:45 and what's with all the hex digits.. I assume it's not a Numberix program :) 05:57:31 -!- calamari has quit ("bbl"). 06:19:17 OK, scrabble board = incredibly difficult to parse O_O 06:57:57 http://giki.sourceforge.net/scrabble.php 06:58:07 Still lacking many of the rules of scrabble, but it's basically functional :) 07:09:56 -!- cmeme has quit (Read error: 54 (Connection reset by peer)). 07:10:46 -!- cmeme has joined. 07:11:04 -!- cmeme has quit (Remote closed the connection). 07:11:49 -!- cmeme has joined. 07:59:59 -!- clog has quit (ended). 08:00:00 -!- clog has joined. 08:54:47 -!- puzzlet has quit ("Lost terminal"). 08:59:09 -!- puzzlet has joined. 10:31:31 should this go in wiki somehow? 10:31:32 http://z3.ca/~lament/pictures/flow.gif 10:31:41 probably not :) 11:09:20 -!- kipple has joined. 13:06:34 -!- {^Raven^} has quit (Remote closed the connection). 13:09:26 -!- J|x has joined. 13:10:36 -!- J|x has changed nick to jix. 15:34:55 -!- CXI has quit (Read error: 104 (Connection reset by peer)). 15:36:28 -!- CXI has joined. 15:51:59 -!- CXI has quit (Excess Flood). 15:52:26 -!- CXI has joined. 16:37:27 -!- {^Raven^} has joined. 18:01:29 -!- lament_ has joined. 18:06:52 -!- lament has quit (Read error: 110 (Connection timed out)). 18:34:19 -!- CXI has quit (Connection reset by peer). 18:35:02 -!- CXI has joined. 18:53:39 -!- jix has left (?). 18:58:35 -!- jix has joined. 19:06:05 -!- lament_ has changed nick to lament. 19:47:41 -!- CXI has quit (Read error: 60 (Operation timed out)). 20:06:22 -!- sp3tt has joined. 20:13:29 -!- tokigun has quit (Read error: 104 (Connection reset by peer)). 20:25:53 -!- tokigun has joined. 20:27:50 -!- jix has quit ("Banned from network"). 20:28:11 -!- jix has joined. 20:29:26 -!- calamari has joined. 20:33:59 hey calamari: did you see the article on slashdot today about that javascript shell? 20:34:08 reminded me of Esoshell :) 20:36:04 hi kipple, all 20:36:20 no, let me look .. had /. open just haven't read it yet :) 20:36:39 kipple: JS/UIX? 20:36:42 well the site is off-line (big surprise) 20:36:43 yes 20:36:49 mirrordot link: http://www.mirrordot.org/stories/1c1bf041ca7144dbe4b35249a8db7dff/index.html 20:37:09 kipple: yes /. effect ;) i saw the site months ago. 20:40:24 cool! 20:40:52 whoever wrote this has even less of a life than I do :) 20:43:57 i'm thinking about 99 bottles of beer in Whirl. 20:44:22 it makes my head dizzy... :S 20:45:04 you should not drink the beer until after you're finished programming 20:45:17 uhm http://esolangs.org/wiki/BF_instruction_minimalization i got down to 4 instructions (but thats a .. hack) 20:46:55 hix: what are the 4 instructions? 20:46:58 err jix 20:47:22 kipple: i cannot drink the beer ;) 20:47:29 X U M and L 20:47:58 but U M and L have arguments ( there are still just X U M and L in the code) 20:48:14 X is flip the current bit 20:48:22 U is User and is used for in and output 20:48:28 M is used for moving 20:48:31 and L for looping 20:49:14 Ow. That instruction minimalization hurts my brain even more than standard BF. 20:49:15 hmm 20:49:18 bf instructions don't take arguments :) 20:49:23 yes 20:49:28 it isn't brainfuck 20:49:39 then... what is THE arguments? 20:49:50 X U M and L 20:50:14 ULX moves up or down (i don't know.. have to recheck my specs) 20:50:16 like UX, UM, UL, LX, ....? 20:50:17 how can u be used for both input and output? 20:50:21 uh... MLX moves up or down 20:50:55 U takes a code as argument.. if the cell after evaluating the argument is zero input one output (or the other way around) 20:51:17 after the argument is evaluated the current cell is set to the value of the cell before the evaluation stated 20:51:45 I'm pretty sure what I have for the 5 instructions isn't going to work.. but that's okay :) 20:52:01 and because i didn't wanted to ad () or []{} i used a hack for the arguments 20:52:14 L takes one instruction as argument LL takes 2 LLL take 3... 20:52:50 and if you want an L instruction as argument of L you have to add 2 X instructions 20:53:02 jix: ah... then one instruction "block" (instruction + arguments) ends with X always? 20:53:05 I think I tested almost all the really simple solutions.. the problems were that they were very dependent on what the data was.. 0 would stay 0, but 1 might stay 1, or it might go into an infinite loop, etc 20:53:10 tokigun: no 20:53:23 hmm 20:53:27 calamari: your 8->7 translation is unoptimal 20:54:06 http://www.rpi.edu/~hughes/boof/ here is a shorter one 20:54:09 i didn't understand... have to think about it 20:54:09 jix: the goal wasn't to have 7 instructions 20:54:18 yes but your [ code is sooooo long 20:54:25 jix: I don't care :) 20:54:39 ok 20:54:40 that wasn't the point.. just wanted to dshow that it was bf complete 20:55:08 I quote from the article: " (most likely not optimized)" 20:55:13 i didn't say it isn't bf complete.. i just wanted to inform you that there is a shorter conversion 20:55:34 yeah, I think I saw one on a website.. but I wouldn't be able to use that without permission from the author 20:56:18 i have an idea for 5 instructions 20:57:14 but the memory usage may explode 20:59:44 i'm trying to combine . and , 20:59:55 -!- sp3tt has quit ("Chatzilla 0.9.68a [Firefox 1.0.4/20050511]"). 21:02:41 the only way I can think of to combine . and , would be to have it depnd on which instruction was executed last (or some similar cheating), or having a predefined I/O area, in which case both instructions can be eliminated 21:02:58 no it's just a replacement table 21:03:28 no idea what you meant by that 21:04:17 i removed the . and , instruction and added one which can be represented with the existing ones .. the same thing as you did 21:04:39 so .. would be output output 21:04:52 how do I do input? 21:05:03 wait i'm writing it down atm 21:05:28 note: any number of .'s will still be output :) 21:05:34 yes 21:05:37 of course 21:06:32 the definition of ; is [<.}]<}[<,}]< 21:07:27 and the translation from your 6 instruction set to the new 5 one is: '>' => '>>' , '<' => '<<' , '.' => '}<};' , ',' => '};' 21:07:31 -!- lindi- has quit (Read error: 104 (Connection reset by peer)). 21:08:14 oh wait 21:08:30 '>' doesn't exists 21:08:38 i create a new table 21:11:12 I'm not sure that qualifies either (although maybe my 5 inst solution doesn't either).. in essense you're constructing an if/else that does either one or the other. Feeling like cheating to me, but I dunno 21:11:37 if else .. where? 21:12:41 my reduction can be represented the same as yours .. i don't see a difference 21:12:51 -!- lindi- has joined. 21:13:14 jix: i'm not saying its invalid.. i'm just saying it feels like cheating to me :) 21:13:41 it's like the 8->7 translation 21:13:45 but I'm still checking it out 21:14:45 seems like you'd want [}<}. rather than [<. because otherwise you're always outputting a 0 for on of the bits? 21:14:57 on->one 21:15:40 why do i output 0 for them? 21:16:06 ah wait there is another mistake 21:16:13 well, maybe it's not that simple 21:16:35 ok i need to expand the memory by 3 21:16:50 you'd start with 1, but then it goes left, so you're outputting x 1 x x x x x x 21:17:11 every 2nd bit is a bit only used for the ; instruction 21:17:22 data temp data temp.... 21:17:38 ; doesn't exist.. I use . and , 21:17:49 they are a little different than bool 21:18:02 oh 21:18:03 since they input and output all 8 bits at once 21:18:16 no problem 21:18:30 I think that should actually make it easier :) 21:18:37 then i think i wanted yours.. and i can use the temp bit used in + and - 21:19:04 what bit is the temp bit .. 0 or 8 ? 21:19:13 0 ok 21:19:41 [}<}.<}] 21:20:01 hmm does that work 21:20:15 no will loop forever 21:20:28 no 21:20:37 will destroy the bit 0 of the output byte 21:21:01 if it's 1, it will get 1 x x x x x x x x, then you go left once, then right and flip, so 0 x x x x x x x x, then you exit 21:21:32 I'm using < = < and } = >@ 21:21:38 i too 21:21:45 doesn't [}.<] work ? 21:21:54 urg no 21:22:16 i think it should be [}<}.<<}] 21:22:28 . doesn't move the pointer 21:22:43 write it with > and @ 21:23:02 [>.<@] is [}<}.<<}] 21:23:17 > => }<} < => < and @ => <} 21:23:31 hmm, yeah you're right 21:23:36 but than we have a problem 21:23:51 because @ = <} 21:23:57 no problem, why 21:24:09 we destoryed the input or output bit 21:24:18 that's okay.. just use two 21:24:35 for example (I'll use the easier syntax so I don't mess it up): 21:24:56 ok but we have to rewrite the bf=> 5ins table 21:25:15 >[>.<@]<[>,<@] 21:26:03 }<}[}<}.<<}]<[}<},<<}] 21:26:23 :) 21:26:56 anyone else have an opinion on this? 21:27:06 no one understands us ;) 21:27:17 seems legit to me, according to the rules I laid down in the article 21:27:44 * kipple has no opinion at all about this (except perhaps a headache) 21:27:47 uhm why are you skipping 10 bits in the 8->7 translation? 21:27:57 jix: because I'm unoptimal 21:28:05 yes but can't we reuse that bit 21:28:12 its bit 0 and 9 right ? 21:28:21 daniel is a bf genius 21:28:28 * tokigun also has no opnion but headache 21:28:37 opinion* 21:28:39 I could never get close to the bf optimization he can do 21:29:16 jix: that stuff doesn't matter though.. that's only when translating back to bf 21:30:07 jix: but if I'm understanding you, yeah, the bf translation might need to change.. dunno 21:30:20 yes but i have an idea to make it a bit more optimal (optimal as in we don't have to change the translation ;) 21:30:43 do you have an account on the wiki? 21:30:56 yes 21:30:57 jix 21:31:05 okay, I'll edit, one sec 21:31:39 >>>>>>>>>[<<<<<<<<.>>>>>>>>@]<<<<<<<<<[>,<@] would work without changing the current translation 21:32:08 or }<}}<}}<}}<}}<}}<}}<}}<}}<}[<<<<<<<<.}<}}<}}<}}<}}<}}<}}<}}<}<}]<<<<<<<<<[}<},<<}] 21:32:40 i introduced cfdg at hanirc and some people interested in it. (especially my friend) 21:33:01 hmm is it ok to ad a }<} at the beginning of every translation ? 21:33:22 because than we could use the short ; representation AND the old translation table 21:33:34 calamari: ? 21:34:42 away for 15 min 21:34:49 If you'd like to optimizae the translations, that's cool 21:35:00 doesn't matter much to me, though :) 21:35:34 5:36 am... oops. 21:36:08 i don't want to optimize it.. i just don't want to change it (because thats to much work) 21:36:10 away 21:37:55 I think [}<}.<<}]<[}<},<<}] is better 21:38:24 the leading > wasn't needed, because it's taken care of in the ., translations 21:40:53 away 21:40:57 -!- tokigun has changed nick to tokigun^away. 21:47:50 hmm, what about [.<]<[,<] 0 0(1) gives output and results 0 0 x x x x x x x x, 0 1(0) gives input and results 0 0 x x x x x x x x 21:51:04 cool.. looks good, I'm going with it :) 21:51:18 no that doesn't work 21:51:42 wait 21:51:49 what is your . and , translation 21:52:22 . = [@]>[@]>[@]@; (before } tanslation) 21:52:48 no need for [@] arn't the bits always 0 ? 21:52:49 , = [@]>[@]@>[@]; 21:53:00 jix: depends on what was there 21:53:31 that can't work the. is at position 0 (relative to ; call) and the , at position -1 21:53:54 but i have another idea 21:54:20 jix: huh? 21:54:27 it's fine 21:54:32 [.<]<[,<] 21:54:35 trace it through on paper if you need to 21:54:53 it's a little tricky, sure.. but it works 21:55:09 start with 0 0 1 and the pointer at 1 21:55:35 the pointer is at 2 21:55:50 I meant at the 1.. sorry 21:56:15 than it may work but with . = [@]>[@]>[@]@; and , = [@]>[@]@>[@]; it doesn't 21:58:29 even better would be [.@]<[,<] 21:58:36 does . and , output the current bit+7 or the next bit+7 21:58:46 current bit 21:59:19 actually, nm on [.@] 21:59:34 that messes up the original value, so it couldn't be converted back to . 22:00:13 how do you do the ] is still ] thing at 8->7 ? 22:00:43 what? 22:01:23 on the 8->7 instruction step ] is still ] .. but can't the current bit be zero but the data bits not? 22:02:03 huh? [ only tests a single bit 22:02:12 ] does not test anything 22:02:44 yes but.. take a look at the BF BitChanger table 22:02:55 ] just jumps back to [ 22:03:08 so all the weight of testing the byte is in [ 22:03:18 yes and [ jumps back to after the ] if value is zero 22:03:29 right 22:04:17 lets think of: 0[1 0 0 0 0 0 0 0] the [ part is the data... this will exit the loop with your translation table .. but it shouldn't 22:05:47 did you put this in an interpreter to check? 22:05:59 no 22:06:01 did you ? 22:06:05 nope :P 22:06:40 i think we should use the boolfuck thing.. the boolfuck interpreter is pd .. i assume the documentation too 22:06:41 I should... 22:06:47 I need to get going for now, though 22:06:52 it's been fun :) 22:07:14 hehe sure 22:10:15 -!- calamari has quit ("cya all"). 22:20:44 -!- jix has quit ("Banned from network"). 22:26:27 -!- CXI has joined. 23:05:01 -!- harkeyahh has joined. 23:13:21 -!- CXI has quit (Read error: 104 (Connection reset by peer)). 23:13:43 -!- CXI has joined. 23:35:45 <{^Raven^}> hi y'all 23:35:59 -!- deltab has joined. 23:37:11 we need to get urban to come here as well 23:37:32 hehe 23:37:44 I don't think he's much into esoteric languages these days... 23:38:31 kipple: "programming is like sex, you make one mistake and support it the rest of your life" 23:38:36 he clearly made his mistake :) 23:38:51 haha :D 23:41:58 I don't think he's done too much work supporting it... 23:42:13 yeah, what an asshole 23:42:20 stupid parachute dude 23:42:30 err... huh? 23:47:53 he enjoys skydiving and juggling hard drives, according to Wikipedia 23:48:05 there was a picture of him skydiving on his page 23:48:07 but i can't find it 23:48:09 or the page 23:51:30 google image search for brainfuck gives all the wrong results 23:54:50 I think it gives several interesting results :) 23:54:57 like this: http://my.2000i.de/esolang2002/esolang-teaser.jpg 23:55:25 hahaha wtf is that. 23:55:41 brilliant. 23:56:32 I think it is a poster for a talk about esoteric programming 23:57:00 hmmm 23:57:12 i don't get it 23:57:17 what does this smetana program do? 23:57:26 Step 1. Swap step 1 with step 2 23:57:29 Step 2. Go to step 1 23:58:10 swaps indefinitely? 23:58:18 swaps 2 times then halts 23:58:18 why? 23:58:24 why? 23:58:53 cpressey: yeah, that's what i think it should do 23:59:30 yes. that seems to be right 2005-06-17: 00:00:23 this means my interpreter is broken 00:06:09 hm, that's right, i see the bug now 00:08:35 interesting, my interpreter is completely broken 00:11:34 phew 00:12:14 the interpreter was completely broken, yet the brokenness didn't affect the funcitonality of the smallfuck stuff 00:12:26 i.e. it still works :) 00:13:43 that's an interesting definition of "completely broken" 00:14:56 it was broken for all cases when a swap instruction referenced itself 00:15:03 which apparently the smallfuck stuff never does 00:16:56 and i guess other than smallfuck stuff, there aren't very many smetana programs :( 00:19:09 i think repeatingly running a smetana program might lead to interesting results 00:22:11 simplest case, an on-off switch: 00:22:20 Step 1. Swap step 3 with step 4. 00:22:27 Step 2. Go to step 42 00:22:40 Step 4. (on) 00:22:45 Step 3. (off) 00:22:55 (swap step 3 with step 4 before reading) 00:39:31 * lament performs an act of abominable herecy: adds a print instruction to SMETANA! 00:39:41 heresy 00:40:26 Step 1. Print "Hello world!". 01:20:00 -!- harkeyahh has left (?). 01:22:16 hm 01:22:35 looks like 99 bottles of beer would take more code than there's text in it :( 01:22:42 i.e. the cheapest version is to just use print statements 01:34:15 ha 01:34:29 well, it wouldn't be the first, I think 01:40:14 gotta go. bye 01:40:18 -!- kipple has left (?). 02:11:59 Step 1. Swap step 2 with step 4. 02:12:02 Step 2. Swap step 5 with step 6. 02:12:03 Step 3. Go to step 5. 02:12:03 Step 4. Swap step 5 with step 7. 02:12:03 Step 5. Print "C". 02:12:03 Step 6. Print "B". 02:12:05 Step 7. Print "A". 02:12:08 Step 8. Print "\n". 02:12:10 Step 9. Go to step 1. 02:16:26 could be shortened by a step, of course. 04:30:03 -!- malaprop has quit ("sleep"). 05:34:46 -!- comet_11 has joined. 05:35:18 -!- CXI has quit (Nick collision from services.). 05:35:20 -!- comet_11 has changed nick to CXI. 05:38:04 I improved my libc scrabble game :) 05:38:07 Now it has bonuses :) 06:12:49 -!- GregorR has quit ("Leaving"). 06:14:11 -!- GregorR has joined. 07:22:52 -!- tokigun^away has changed nick to tokigun. 07:59:59 -!- clog has quit (ended). 08:00:00 -!- clog has joined. 08:25:37 -!- sp3tt has joined. 08:29:05 -!- sp3tt has quit (Client Quit). 08:30:02 -!- sp3tt has joined. 08:30:46 -!- sp3tt has left (?). 08:33:00 -!- sp3tt has joined. 08:33:07 -!- sp3tt has left (?). 08:38:49 -!- sp3tt has joined. 08:40:30 -!- sp3tt has quit ("Leaving"). 08:41:04 -!- sp3tt has joined. 08:51:13 -!- tokigun has quit ("Chatzilla 0.9.68.5 [Firefox 1.0.3/20050414]"). 09:47:25 -!- kipple has joined. 10:04:39 -!- tokigun has joined. 10:29:01 lament: lol @ http://z3.ca/~lament/pictures/flow.gif - Hofstadter would probably enjoy it very much 10:29:58 re Urban Müller's old homepage: http://web.archive.org/web/20040903174220/http://ftp.wustl.edu/~umueller/ 10:30:31 re SMETANA print instruction: now the next challenge is 99bob :) 10:33:10 I think that Müller is now working for a company offering a search engine 10:34:31 BTW, according to his homepage Müller spends (spent?) "too much time on IRC" (ircnet) 10:39:25 he's probably one of these: http://tel.search.ch/result.de.html?all=urban+mueller 12:53:05 -!- sp3tt has quit ("BitchX-1.1-final -- just do it."). 13:21:20 -!- CXI has quit ("If you're reading this, it's probably x-chat's fault."). 13:38:01 -!- CXI has joined. 13:44:43 -!- jix has joined. 14:08:51 <{^Raven^}> pgimeno: Urban is number 14 on that list 14:09:23 thanks {^Raven^} 14:12:02 So we're stalking him now? 14:12:32 <{^Raven^}> no, just using publicly available information put online bu Urban himself 15:11:40 I'm sure he put his phone number online so that people could call him and ask things like "so, dude, what should a cell contain after reading EOF?" ;) 15:12:34 -!- malaprop has joined. 15:39:12 <{^Raven^}> kipple: questions like that are answered by reading the original/using the original compiler 15:39:21 <{^Raven^}> it should all be self evident 15:39:46 <{^Raven^}> *the souce code of 15:43:07 -!- Keymaker has joined. 15:43:42 *sighhhhh* 15:53:44 hey, cool 15:53:52 * Keymaker phones müller 15:53:56 -!- jix has left (?). 15:54:00 ok, not really :p 15:54:01 -!- jix has joined. 15:55:36 hm. müller doesn't mention brainfuck on his site.. how that can be possible?! 15:56:15 he has interesting hobbies, though 16:03:27 -!- louis_ has joined. 16:05:58 Keymaker: I don't think he really cares much about it 16:06:25 yeah 16:06:28 :( 16:06:53 must go eat. 16:09:30 Raven: I don't have an Amiga, so I can't use it, and I don't read assembler 16:10:06 the interpreter says -1 though, and that's what I'm sticking with, but I'm not 100% sure the compiler does the same 16:30:21 -!- louis_ has left (?). 16:46:36 Maybe - juuuuust MAYBE (read: certainly) - Urban just doesn't want to go into a job interview and have the interviewer say "Oh ... yeah ... you're the guy who wrote Brainfuck ..." 16:46:51 I mean, esoteric programming is fun and all, but we should respect his right to live it down. 16:47:10 agreed 16:47:30 anyway, I'm categorizing NULL as a Non-textual language. any objections? 16:49:32 Makes sense to me. 16:50:09 so now Piet doesn't need to feel so alone anymore :) 16:58:07 kipple: I agree to you. 17:01:34 hmm 17:01:48 can I add my own Hello, world program in Whirl page? 17:01:55 omg 17:02:00 Whirl -> NULL 17:10:49 :) 17:10:55 go ahead, i'd say 17:10:57 ;) 17:11:30 hmm 17:15:51 rgh. i can do nothing 17:16:41 and it's annoyingly 25 celsius hot here¨ 17:16:45 i hate summer 17:17:35 18°C here 17:17:48 ah.. 17:17:52 but 17-26 is ok for me 17:17:57 d'oh 17:18:10 -!- tokigun has quit (Remote closed the connection). 17:18:27 i'd rather take -17 - -26 :) 17:18:34 brr 17:18:55 too bad the previous winters have been so warm 17:18:57 at least i think so 17:19:18 a few weeks ago we had 35° 17:19:40 thats really annoying 17:19:47 arrrgh 17:19:53 where are you, btw? 17:20:02 Bremen, Germany 17:20:07 wow 17:20:14 i didn't know there's so warm in germany 17:20:22 it isn't always so warm 17:20:26 yeah 17:20:33 but still really warm, that day 17:20:50 it was just for 2 days.. the weeks before and the weeks after that days were 9-15°C 17:21:01 ok 17:21:30 but last week i was in france 17:21:40 ok 17:21:43 it was hot.... 17:21:47 too hot for me 17:21:53 :) 17:22:04 did you see that eiffel tower? 17:22:32 no i wasn't in Paris 17:22:37 ok 17:22:54 well, i haven't seen it 17:23:04 haven't visited france :( 17:23:08 i was at the Cote d'Azur (near Monaco or was it already Monaco?) 17:23:16 no idea 17:27:29 should i add Unnecessary to esowiki? :) 17:28:37 why? 17:29:11 for fun 17:29:19 to joke languages 17:30:16 does HQ9+ ignore any non HQ9+ characters ? 17:30:25 dunno 17:30:49 because if it does i have a Q less quine: Hello, world! 17:32:03 hey, you're right 17:32:09 never thought about that 17:32:10 :) 17:33:40 it doesn't... print_string "Unknown command: "; print_char c; 17:34:11 grh :( 17:34:41 otherwise it would've been neat new quine for that language 17:35:35 or well, it isn't officially said anywhere.. i think 17:35:44 that's just unofficial interpreter 17:35:49 ;) 17:35:55 no its the reference implementation 17:36:39 yes, one the site, but can't find anywhere the fact 17:36:56 "Those that I've managed to find are listed below." 17:37:17 oh 17:37:49 that doesn't clearly mean it's official. the author should've made more clear whether the language reports other characters as error or ignores them 17:38:17 anyways, you could e-mail the author :) 17:50:33 * Keymaker goes to play commander keen 5 18:26:09 rgh 18:26:17 bye 18:26:24 and thanks for all the fish 18:26:28 -!- Keymaker has quit ("I've seen this déjà vu before.."). 18:43:40 * {^Raven^} ponders 19:19:42 * GregorR ponders what {^Raven^} is pondering 19:31:46 -!- e has joined. 19:32:00 -!- e has quit (Client Quit). 19:47:17 and again the SEX instruction (COSMAC 1802 cpu) 19:53:32 LOL 19:53:49 Bow chicka bow wow. 19:54:04 I'm under the distinct impression that Berlios registration is borked :(* 19:56:07 oh, my Choon submission was accepted 19:56:32 i'm going to write 99 bob for the ELF II computer 19:56:36 Hmm, never mind ... apparently fourth time's a charm XD 19:56:42 but first i need an assembler for that cpu 20:04:32 * {^Raven^} hates writing GUI apps for Windows but is forced to today 20:06:49 * {^Raven^} explodes 20:09:52 I use FLTK. 20:09:59 Just makes the whole portability thing muuuuch easier. 20:10:10 And it's small enough to reasonably compile statically into the binary. 20:14:04 <{^Raven^}> The entire program is 41 lines of code, but need to add a few hundred extra for the IF. Grrr... 20:25:12 -!- tokigun has joined. 20:44:34 <{^Raven^}> I'll just make it a CLI tool for DOS and let the user deal with it 21:49:57 c:\app\addcust.exe /name="John Doe" /address="666th street, Moon" /phone="(+12)3456789" 21:50:20 Customer "John Doe" added. Use brwscust.exe to list data. 21:52:19 (forgot the C:\> prompt, sorry) 21:55:36 I'm designing 99 Bottles of Beer in Whirl.... yeah so difficult. 22:01:32 whirl is a PITA to code in (though you can compress the sources pretty well, like 8:1 at worst) 22:01:54 PITA? 22:02:12 pain in the arse 22:02:23 ah... 22:02:31 i see. 22:03:28 -!- jix has quit ("Banned from network"). 22:05:51 -!- calamari has joined. 22:07:09 speaking of the moon: http://www.userfriendly.org/cartoons/archives/04jan/uf006348.gif 22:07:45 hi calamari 22:09:33 hi pgimeno 22:12:44 <{^Raven^}> pgimeno: I used to be majorly "into" writing GUI software, these day I write portable, multi-platform CLI stuff wherever possible 22:25:40 hmm 22:26:04 http://leporidae.tokigun.net/.service/99bob.txt psuedo code of 99 bob... 22:26:43 though i should explain this meta-language. :p 22:33:03 -!- Keymaker has joined. 22:35:13 that vaguely reminds me of my planning of the "cat" program in Malbolge 22:35:18 tokigun: yeah, that's gonna be a good challenge. good luck. 22:35:19 hi Keymaker 22:35:21 hi 22:35:47 Keymaker: hello. / thanks :) 22:35:56 :) 22:36:29 the jumping is hard 22:37:11 (never tried, but at least that i got from the language specification..) 22:37:22 (or well, there doesn't read that, but i thought it is hard) 22:37:28 yes... i have many issues and i'm finding solutions of them. 22:37:41 Keymaker: I downloaded your sample Unnecessary source and works perfectly. Do you have more samples I can download to get a feeling of how it works? 22:38:06 some of them have been solved (perhaps) but sometimes another problem has been appeared :( 22:38:32 :( 22:38:37 Keymaker: How about Unnecessary interpreter for web? 22:38:40 pgimeno: try hello.unn 22:39:00 oh! trying now 22:39:05 heh. that could be fun :) 22:39:27 i could make one in php 22:40:37 by the way, anyone seen hitchcock's the birds? 22:40:43 i just saw it before came here 22:40:47 really good :) 22:40:54 now i'm afraid of birds, though 22:41:33 tweet 22:41:50 aaaargh 22:41:53 nice, http://koti.mbnet.fi/yiap/stuff/hello.unn also compiles and runs, though it doesn't print "Hello, world". I'll activate debugging to see what's wrong. 22:42:08 :D take your time 22:42:24 6:43 am KST... i get to sleep ;) 22:42:30 -!- tokigun has changed nick to tokigun^away. 22:42:30 :) hehe ok 22:43:04 good nite tokigun^away 22:43:19 is most of europe gmt? 22:43:27 dunno 22:44:00 never heard of kst :) 22:58:28 most of europe is CET = GMT+1/2 (currently 2 because of DST) 22:58:46 (with a relaxed concept of "most") 23:04:06 http://www.timeanddate.com/library/abbreviations/timezones/eu/cet.html 23:04:38 <{^Raven^}> does anyone know of some good references for cross-compiling brainfuck into something more efficient? 23:04:44 nope 23:04:58 Raven: there's that bf cpu where it can run native ;) 23:06:29 bbl.. food 23:06:34 :) 23:06:36 -!- calamari has quit ("Leaving"). 23:08:30 There are a bunch of BF compilers that compile BF into C. 23:08:54 too many 23:09:03 And a few of those combine things like >>> into one += 3 23:09:24 and mostly they are written in c 23:10:05 btw, here's unnecessary interpreter for web use: 23:10:05 http://koti.mbnet.fi/yiap/stuff/unnecessary.php?program=hello.unn&debug=on 23:10:28 <{^Raven^}> i've got a brainfuck optimisation engine that I'm working on that spits out code in whatever language you fancy 23:10:45 well, what if i fancy brainfuck? :) 23:10:53 <{^Raven^}> erm... 23:10:59 <{^Raven^}> it outputs brainfuck too 23:10:59 or well, thue then :) 23:11:48 <{^Raven^}> you'd have to write a set of rules to decompile the internal code to whichever language 23:12:09 :) 23:12:56 anyways, nice project 23:13:05 <{^Raven^}> i'd like to get together some more information than the optimisations that I already have 23:13:17 <{^Raven^}> i;'m sure there's stuff i've not thought about 23:22:18 <{^Raven^}> for an extreme case it reduces my Lost Kingdom from 2.1 million raw brainfuck instructions down to 147,000 instructions 23:23:50 <{^Raven^}> and that could be improved further 23:24:13 My befunge compiler does some optimizations too, so I guess it could be used for compiling brainf*ck (by translating first to befunge). I should just clean it up and write a code-generating backend, currently it can only spit out simple C code. 23:24:38 that's pretty good, raven 23:24:42 <{^Raven^}> fizzie: do you have a link? 23:27:00 I only have some generated output in the interweb ( http://gehennom.org/~fis/utm.html => http://gehennom.org/~fis/out.c.txt ), not the compiler sources. Oh, and http://gehennom.org/~fis/re.bf.txt -> http://gehennom.org/~fis/re.bef.txt for the "oh gods that's horrible" brainf*ck->befunge translation. 23:27:17 I'm not quite sure what re.bf did. Probably something related to regular expressions. 23:30:43 <{^Raven^}> fizzie: is there the C output of re.bef 23:30:53 <{^Raven^}> looks pretty good 23:32:15 Not really, since g/p don't work in the C-code-creation-backend. That could be easily fixed, though, since the 'p's in that translated-brainf*ck code don't do any self-modification. I think there were some known bugs in the compiler still, though. 23:33:53 Oh well. This part of Europe is EET (GMT+3 at the moment, with the DST) so it's 01:34am, and a ~early morning tomorrow, so -> sleeps now. Night. 23:34:05 <{^Raven^}> goodnight 23:40:02 -!- calamari has joined. 23:40:07 re's 23:43:55 nite 23:44:18 (thanks heaven i'm on summer vacation (and have no summer job either ;))) 23:45:01 slacker! 23:52:29 :) 23:52:42 well, i tried, but nobody hired me! 23:53:10 well, doesn't matter. i get to stay awake late 23:53:17 though, can't get money 23:53:58 lots of free time to come up with a new language 23:54:07 yeah 23:54:24 too bad i'm reading to final exams 23:54:28 or dunno what those are called 23:54:38 fizzie could probably translate but he went away 23:55:26 I'm curious what the sentence looks like natively 23:56:48 which one :D 23:57:14 the one you couldn't translate 23:57:48 ah. i'm talking about the big exams you need to get trough to get out from high school, or whatever would be the translation 23:57:58 school systems are annoyingly so different in different places 23:58:27 anyways, i could probably get through it without reading, but i'm hoping/going to get good grades 23:58:50 are high school exams common? I didn't have to take an exam to graduate.. but I know they started testing a few years ago 23:59:15 well, here there has been these exams/'writings' for years 23:59:27 essay? 23:59:27 probably 50 years or more, at least 23:59:40 ? 23:59:53 oh, just wondering if that was the word you meant 23:59:57 ah 2005-06-18: 00:00:00 well, dunno :) 00:00:54 anyways, since what's the point studying (read: wasting time to that crap) and take low grades in the final exams? nothing, so i'll try to get as good as i can 00:00:54 so, write me some nice trance music.. you europeans are good at that :) 00:01:08 yeah 00:01:20 :) 00:01:42 and therefore, i must read.. (although, i could probably take a small weekend break ;)) 00:01:53 and trance.. i wish i could compose it :) 00:04:26 <{^Raven^}> Keymaker: what kind of music do you compost atm 00:04:30 <{^Raven^}> *compose 00:04:39 <{^Raven^}> *if any 00:04:48 at the moment? nothing :) but tried something earlier today 00:04:58 well, i try to get monotrack with industrial flavour 00:05:08 <{^Raven^}> nice 00:05:17 :) 00:05:52 * {^Raven^} usually writes ambient classical 00:06:01 ok 00:06:23 as well, i must note: i don't know anything about music, i just try to find nice sounds, tweak and edit them and try to get it sound nice 00:06:31 i have zero knowledge of any theory :) 00:06:35 * calamari plays along to songs on his harmonica.. no musical talent here.. hehe 00:07:01 hehe 00:07:11 keymaker: I've listened to plenty of mods that were made just that way, and they are great 00:07:32 <{^Raven^}> i've heard some pretty amazing stuff made from loops and samples from peeps with no musical knowledge 00:08:07 yeah 00:08:23 hopefully talent or intelligence is not required :9 00:09:16 raven: heard of glastonbury? wondering if that is some kind of concert center? 00:10:37 <{^Raven^}> calamari: Glastonbury is a small village, the festival is held in a big field(s) on a farm 00:11:08 oic.. cool. 00:11:37 <{^Raven^}> calamari: people going there bring tents, food and stuff. It can get pretty muddy especially if it rains 00:11:57 is it free? 00:13:31 here's pleny of festivals 00:13:37 (not that i'd visit them) 00:14:33 why not? 00:15:57 well 00:16:05 no idea 00:16:08 trance is so small in the us.. most is lame dance stuff.. you guys have it lucky over there 00:16:15 yep 00:16:24 one thing is what i would like to see 00:16:45 in week or so, my absolutely favourite, SCOOTER, comes to one festival. 00:16:53 <{^Raven^}> tickets are about £125 gbp or $229 usd or 186 euros 00:17:06 it's one of the biggest festivals around, on midsummer, and there's also other good electronic music 00:17:28 would love to see them 00:17:42 raven: wow, that's pretty steep..no wonder they camp out 00:18:25 nothing actually stops me from going, in fact folks have been trying to get me going there since they know i like scooter so much. 00:18:33 either the way, for some reason i don't go 00:18:59 i'll complain for weeks how stupid i am, when it's gone and i can read from web how scooter fans say "AWESOME GIG!!!!!" 00:19:57 as well, very expensive tickets, raven 00:20:13 they're a lot cheaper around here 00:20:34 a lot 00:20:42 <{^Raven^}> Apparently is is well worth it, thousands of peeps over 2 days with several stages open at the same time 00:21:22 <{^Raven^}> do you like happy hardcore? 00:21:32 me? 00:21:41 <{^Raven^}> sure 00:21:42 yes, that as well :) 00:21:48 <{^Raven^}> cool :) 00:22:19 oh, you're talking about music.. yes, that as well. 00:22:24 (lame joke) 00:22:43 * {^Raven^} thinks he gets the joke but isn't sure 00:23:35 :) but anyways, 00:23:45 almost any electronic music is fine 00:25:26 but not noise or whatever it's called 00:25:36 like where there is just pure noise 00:25:51 like for example white noise combined with some annoying sounds 00:26:06 stuff that hurts ears.. no thanks 00:30:10 <{^Raven^}> you mean pop music ;) 00:30:14 hehe 00:31:12 "harsh noice" is the category, i guess 00:31:47 * {^Raven^} digs rock, metal and trance 00:32:18 <{^Raven^}> The Germans are pretty good for metal 00:32:43 and trance.. good ol' germantrance :) 00:32:58 (althouhg, no idea about metal, i hate that noise) 00:33:10 <{^Raven^}> yeah lol, didn't the Germans invent trance? 00:33:41 dunno 00:33:56 at least they produce and listen it a lot 00:41:21 hmm, the birds make more noise than usually (outside).. i hope they don't plan an attack 00:41:50 <{^Raven^}> they're out to get you 00:43:39 aargh seagulls!!!!!! 00:46:24 -!- malaprop has quit (Read error: 54 (Connection reset by peer)). 00:47:01 hm. i'm tired.. and hungry. i've eaten almost nothing this summer.. like only once a day, usually noodles. nothing else the whole day 00:49:10 i'll go to pile up z's 00:49:40 nite 00:49:42 -!- Keymaker has quit ("I've seen this déjà vu before.."). 00:51:15 <{^Raven^}> i'm gonna go to bed to and avoid programming some more 00:53:02 <{^Raven^}> got to get some ideas together for a text adventure programming competition that started a few days ago 00:53:54 <{^Raven^}> game engine has to be 2,899 bytes maximum with a 8,192 byte data file 00:56:44 good luck! :) 00:57:14 <{^Raven^}> Thx! I won last year 01:00:25 haha 01:00:46 <{^Raven^}> lament: ? 01:00:52 {^Raven^}: what languages are accepted? 01:01:42 <{^Raven^}> lament: loads, mainly it's if it can be run on any of a huge list of platforms 01:01:53 <{^Raven^}> *on one of 01:01:58 do they accept Thue? :) 01:02:30 how about sed? :) 01:02:35 <{^Raven^}> probably, although i'd contact the organiser 01:02:39 how about Inform? 01:02:43 (ha-ha) 01:03:07 <{^Raven^}> if you can do it in 2,899 bytes of source code with a max 8k data file 01:03:47 ORK is the best for the task, it's so compact... 01:03:59 Here you go: You are in a room. Exits to the north, east, south, west. (repeat) 01:04:21 <{^Raven^}> page is at http://www.geocities.com/dunric/advcomp.html 01:04:44 I hope that's not the same dunric I know 01:05:00 <{^Raven^}> Is there more than one? 01:05:27 * {^Raven^} cannot imagine PAP x 2 01:06:17 uhoh, it is :) 01:06:42 I know him from efnet #rgvc (or should I say used to know.. presently banned) 01:07:19 he occasionally posts a giant flame to rec.games.video.classic.. I think I was mentioned once.. lol 01:07:33 (although, iirc, in a positive light) 01:08:24 hehe, anyways.. pretty cool 01:25:10 * {^Raven^} goes to bed 01:25:14 <{^Raven^}> nite peeps 02:05:25 that sounds like an interesting contest... 02:33:13 -!- malaprop has joined. 02:37:25 -!- graue has joined. 02:38:36 who's this iamnothere dolt who has a package? 02:38:53 i hope it gets to La Puente all broken and covered with oats 02:51:53 I know 02:52:32 here's what needs to be done: 02:52:42 -!- lament has set topic: Another brainfuck site (http://www.bf-hacks.org/) is open! ~ http://chriscoyne.com/cfdg/ ~ Esolang wiki: http://esolangs.org/wiki/ Please pray for my package to arrive safely in Mumbai, India. thnx much!. 02:53:07 now that's something i can wholeheartedly support 03:10:55 -!- kipple has quit (Read error: 110 (Connection timed out)). 03:55:15 -!- pgimeno has quit (Read error: 104 (Connection reset by peer)). 03:56:09 -!- pgimeno has joined. 04:04:58 -!- calamari_ has joined. 04:11:13 -!- calamari has quit (Read error: 104 (Connection reset by peer)). 06:29:40 -!- graue has left (?). 06:47:28 -!- calamari_ has changed nick to calamari. 07:59:59 -!- clog has quit (ended). 08:00:00 -!- clog has joined. 08:01:50 -!- calamari_ has joined. 08:10:44 -!- calamari has quit (Read error: 60 (Operation timed out)). 09:09:53 -!- tokigun^away has changed nick to tokigun. 09:58:06 -!- calamari_ has quit ("Leaving"). 10:07:51 -!- jix has joined. 10:11:03 moin 10:56:22 ... 12:02:30 hey tokigun 12:05:38 puzzlet: why? 12:07:08 -!- tokigun has quit ("Chatzilla 0.9.68.5 [Firefox 1.0.3/20050414]"). 12:34:49 -!- J|x has joined. 12:35:27 -!- jix has quit (Nick collision from services.). 12:35:29 -!- J|x has changed nick to jix. 13:10:03 -!- tokigun has joined. 13:48:34 -!- kipple has joined. 14:50:43 -!- jix has quit ("This computer has gone to sleep"). 15:25:43 -!- jix has joined. 15:36:20 -!- graue has joined. 17:51:39 -!- ionas has joined. 17:51:48 -!- ionas has left (?). 18:14:48 -!- comet_11 has joined. 18:19:08 -!- CXI has quit (Read error: 104 (Connection reset by peer)). 22:14:02 -!- comet_11 has quit (Read error: 145 (Connection timed out)). 23:08:37 -!- graue has quit ("Leaving"). 23:09:50 -!- tokigun has quit ("rebooting"). 23:12:05 -!- tokigun has joined. 2005-06-19: 00:14:29 quiet today... 00:15:30 true 00:40:07 -!- calamari has joined. 00:40:16 hi 00:41:40 hello 00:51:14 hello 00:53:22 moin calamari 00:56:13 i'm writing low-level psuedo code of 99bob in whirl... eh. 01:10:55 jix: I need to write up a bool debugger so it's easier to verify solutions :) 01:11:17 yes that would help a lot 01:44:18 hmmm 01:44:30 http://zenith.sparcs.net/dev/whirl99bob.txt 01:44:47 i've just finished low-level psuedo code of 99bob in whirl. 01:45:02 (still hard to understand) 02:29:34 -!- jix has quit ("Banned from network"). 04:00:57 -!- calamari_ has joined. 04:02:14 -!- calamari has quit (Read error: 104 (Connection reset by peer)). 04:04:13 -!- CXI has joined. 04:19:23 -!- kipple has quit (Read error: 110 (Connection timed out)). 04:44:35 -!- pgimeno has quit (brown.freenode.net irc.freenode.net). 04:44:35 -!- puzzlet has quit (brown.freenode.net irc.freenode.net). 04:45:36 -!- fizzie has quit (brown.freenode.net irc.freenode.net). 04:45:36 -!- deltab has quit (brown.freenode.net irc.freenode.net). 04:47:35 -!- deltab has joined. 04:47:35 -!- fizzie has joined. 04:47:49 -!- pgimeno has joined. 04:47:49 -!- puzzlet has joined. 07:59:59 -!- clog has quit (ended). 08:00:00 -!- clog has joined. 08:13:55 -!- calamari_ has quit (Read error: 110 (Connection timed out)). 08:18:07 -!- calamari has joined. 09:22:40 -!- tokigun has quit (Read error: 131 (Connection reset by peer)). 09:22:42 -!- tokigun_ has joined. 09:22:44 -!- tokigun_ has changed nick to tokigun. 10:05:01 -!- jix has joined. 10:05:31 moin 10:17:54 hi jix 10:18:05 messing with that debugger.. 10:18:28 hehe 10:18:46 actually I should say messing with Swing, since I haven't written a line of interpreter code yet 10:22:07 hehe use ruby/tk 10:22:33 (he means python) 10:22:43 no ruby 10:23:22 pythen is nice but i prefer ruby's syntax and core features and stdlib 10:23:23 I've written a couple new LayoutManager's today.. but they should come in handy in the future 10:25:33 -!- pul has joined. 10:25:37 -!- pul has left (?). 10:37:48 jix: http://images.kidsquid.com/bool.png 10:38:48 nice 10:40:37 jix: thanks :) 10:51:54 -!- Keymaker has joined. 10:52:10 calamari: looks good 10:52:26 bool probably is some language? 10:54:48 it's 1bit brainfuck 10:55:25 ah 10:55:39 i thougth that was called boolfuck 10:55:49 calamari and me are trying to minimize the brainfuck instruction set without adding extra rules just by creating new instructions that can be build out of the old ones 10:55:55 boolfuck is different 10:55:59 ah yes 10:56:02 boolfuck is LE and has bit output 10:56:11 ok 10:56:36 good luck 10:58:30 anyways, i'll be back later. bye 10:58:33 -!- Keymaker has quit ("I've seen this déjà vu before.."). 11:14:33 jix: added the menu.. going to bed :) 11:14:47 -!- calamari has quit ("<=K"). 11:15:31 -!- kipple has joined. 11:17:13 moin kipple 11:17:22 hi 11:51:54 <{^Raven^}> morning 12:05:14 -!- J|x has joined. 12:07:45 -!- jix has quit (Nick collision from services.). 12:07:48 -!- J|x has changed nick to jix. 12:22:30 <{^Raven^}> anyone know who runs the esoteric.sange.fi mailing list? 12:26:30 I don't know, but it might be the same guy that runs the brainfuck archive 12:26:55 <{^Raven^}> do you know who that is? 12:27:05 Panu Kalliokoski, pkalliok@cs.helsinki.fi 12:27:09 http://esoteric.sange.fi/brainfuck/ 12:28:56 <{^Raven^}> cheers kipple 12:36:04 -!- J|x has joined. 12:38:01 -!- Keymaker has joined. 12:38:38 'ello 12:39:09 moin 12:39:16 <{^Raven^}> afternoon 12:39:33 :) 12:43:49 there is no new-line in morse code (the real, not the programming language), right? 12:44:32 yes 12:44:39 -!- tokigun has quit ("Chatzilla 0.9.68.5 [Firefox 1.0.3/20050414]"). 12:44:57 ok 12:47:09 -!- jix has quit (Read error: 110 (Connection timed out)). 12:48:41 -!- J|x has changed nick to jix. 12:50:56 <{^Raven^}> there are end of message and internal seperator codes 12:51:03 yeah 12:51:03 <{^Raven^}> ^ Keymaker: 12:51:07 yeah 13:16:06 <{^Raven^}> I've been working on a project that may be of interest to the esolang community 13:17:13 <{^Raven^}> it's a website that may or may not be useful 13:17:51 <{^Raven^}> if you want to take a peek msg me privately and I'll give you the URL 13:18:09 <{^Raven^}> but I don't want it public until I've got permission 13:18:39 <{^Raven^}> I'd appreciate some comments if anyone is willing 13:58:34 ok 14:53:32 -!- Keymaker has left (?). 15:01:55 -!- tokigun has joined. 15:02:21 hello 15:05:12 -!- Keymaker has joined. 15:05:27 Keymaker: I've finished 99bob in whirl :) 15:05:59 (i have to optimize but it works) 15:06:21 woooooooaaaaaah 15:06:28 i can't believe my ears :D 15:06:36 that's really cool! 15:06:45 wait a minute :) 15:06:48 ok 15:06:58 i wonder what the guy that invented whirl will say about that.. 15:07:52 be sure to e-mail him it 15:10:49 Keymaker: http://zenith.sparcs.net/dev/99bottle.wr 15:11:21 woah 15:11:41 it weighs 20,332 instructions 15:11:55 :) 15:12:12 amazing 15:12:25 it was generated by my own whirl assembler 15:12:27 it's a lot instructions smaller than some slarty's hello world 15:12:43 ok 15:12:59 slarty's hello world program gave me the idea about memory initialization 15:49:10 optimized 20,322 instructions -> 19,722 instructions 15:49:28 good 16:02:35 i've an idea for a new brainfuck dialect 16:02:43 cool! 16:02:53 2d 16:02:59 hm? 16:02:59 [|+|[ 16:03:00 |-] ] 16:03:07 is a programm that loops forever 16:03:08 it is 2d 16:03:12 ok 16:03:27 the program is equivalent to [-]+[] 16:03:32 in standard bf 16:03:37 yeah 16:04:56 the commands are: []+-<>,. |^%"$ and maybe (i'm unsure) macros 16:05:10 :) 16:05:46 the dialect throws the symmetry out of window :) 16:06:10 hm? 16:06:39 well, i think brainfuck is very symmetric with [ ] and , . and + - and < > 16:06:42 19,162 instructions. hmm... 16:06:56 the dialect has instructions like | and ^ and so on 16:07:01 oops, 19,158 instructions. 16:07:17 | is a reverse-mode-stop 16:07:30 maybe i should add a reverse-mode-start 16:08:33 ok new instruction set: [] +- <> ,. !? ^v '. 16:08:40 urgh 16:08:49 '.' is used twice ^^ 16:08:52 :) 16:09:03 that looks better 16:09:27 i need to symmetric characters for up and down 16:09:34 two 16:10:03 9 and 6? 16:10:09 hah 16:10:10 yes 16:10:15 [] +- <> ,. !? ^v 96 16:10:57 :) as we know, aesthetics is the most important thing in esolangs.. 16:10:58 and i need an exit character... @ 16:11:13 that seems good 16:11:57 !,[@ 16:11:57 .] 16:11:59 is cat 16:12:41 i suggest you writing some specification of the instructions.. sometime 16:12:46 yes 16:13:00 but i've to do my homework :( 16:13:04 :( 16:14:03 but it's only 3,5 weeks until summer holidays :) 16:14:10 :) 16:14:42 ah... i have final exam tomorrow. oops :( 16:14:54 :( 16:14:54 18,508 instructions. 16:15:02 nice work tokigun 16:18:37 i need a name for my dialect 16:19:12 hmm 16:21:52 YABAL 16:22:01 Yet Another Brainfuck A Like 16:22:07 that's good 16:22:57 argh homework... YABAL... homework.. YABAL... homework... URGH 16:23:01 yabal... 16:23:03 yaball... 16:23:15 18,294 instruction, anyway 16:23:21 good 16:23:35 going to get it below 10000? ;) 16:23:55 Keymaker: hmm... :p 16:24:00 hmm Yet Another Brainfuck A Like (Language?) .. YABAL..YABALL? 16:24:13 it looks like YA BALL 16:24:46 i'm going to write down the specs after the next 2 pages homework 16:24:58 ok 16:38:25 well, back to program in bf.. :) 16:57:21 i found 2 ways for converting bf->YABALL 16:57:31 the first produces polyglots 16:57:39 the 2nd YABALL only programs 16:57:58 the 2nd is more compact and more YABALL style code 16:58:59 hmm polyglots.. 16:59:08 that sounds like a neat way 17:04:37 i have a new nice cat ( and i'm still not done with homework 0o...) 17:04:43 !,[@ 17:04:44 !.]? 17:11:48 is 'fraction bar' this: _ 17:11:49 ?? 17:12:04 _ is underscore 17:12:12 ah i see now 17:12:16 then what is fracion bar? 17:12:26 no idea 17:12:30 d'oh :( 17:13:32 the fraction bar is the line in a fraction but i don't think its an ascii character 17:14:06 hm 17:14:08 can be 17:14:10 maybe slash / 17:14:15 no.. 17:14:23 i'm reading morse code entry at wikipedia 17:14:31 and there is no picture of fraction bar 17:14:49 or well, with picture i mean ascii 17:18:59 but in ascii representation i use / for the fraction bar 17:19:19 eg: 1/2 1212/1231234 6/9 17:19:47 yeah 17:20:11 but there is slash '/' that is -··-· 17:20:26 yes but there is no other ascii representation for a fraction bar 17:20:34 ah 17:20:41 i guess not, then 17:20:48 at least i'll ignore it if there is :) 17:21:07 jix: you mean slash and fraction bar look same but they are different letters? 17:22:15 no 17:22:27 hmm 17:22:36 in ascii there is just one / and no other character that is usefull for representing a fraction bar 17:23:03 i see.. 17:23:22 how about unicode? (bad joke) 17:36:38 -!- sp3tt has joined. 17:36:48 17,826 instructions. 17:37:04 cool 17:41:54 hmm i should add a cronjob for downloading the wiki database 17:47:41 hmmm, i got a new quine idea while writing another brainfuck program 17:47:46 better test the idea later 18:04:42 -!- tokigun has quit ("quit"). 18:22:58 is it normal that a wiki page is that slow? 18:30:34 HELLO WORLD!.... . .-.. .-.. --- .-- --- .-. .-.. -.. -.-.-- .-.-. 18:31:32 (there should be 7 spaces at one place, i hope this opera chat didn't trim them..) 18:31:41 (it at least don't show them) 18:47:30 -!- sp3tt_ has joined. 18:57:02 -!- J|x has joined. 18:57:36 -!- jix has quit (Nick collision from services.). 18:57:40 -!- J|x has changed nick to jix. 19:01:35 done.. 19:01:37 http://www.bf-hacks.org/hacks/morse.b 19:01:46 read from http://www.bf-hacks.org/programs.html how to use it 19:01:47 :) 19:02:31 it's surprisingly time-consuming to write that kind of program. the hardest part is to keep switching windows to look at wikipedia article etc.. 19:02:41 i hope wikipedia article has the right morse codes.. 19:02:46 anyways, gotta go. 19:02:47 -!- Keymaker has left (?). 19:06:04 -!- sp3tt has quit (Read error: 110 (Connection timed out)). 19:07:12 http://esolangs.org/wiki/YABALL specs done 19:17:13 anyone wants to write a YABALL interpreter for me? 19:19:52 -!- tokigun has joined. 19:20:12 15,556 instructions 19:20:30 tokigun: http://esolangs.org/wiki/YABALL 19:20:39 @15,556 cool 19:20:44 ;) 19:26:40 tokigun: do you want to write a YABALL interpreter for me 19:27:12 hmm i've to read spec before writing it 19:27:33 after final exam (22 june) ;) 19:27:41 (to 22 june) 19:28:19 hmm i thought in the next.. say 2 hours ;) 19:28:25 ;) 19:28:37 http://zenith.sparcs.net/dev/99bottle.wr 19:29:17 it's time to go public? 19:29:44 no idea 19:29:49 i like the wave pattern at the end 19:29:54 ;) 19:30:26 i'm considering c(or whatever)-whirl polyglot 19:31:19 c-brainfuck-ruby 19:31:37 uh whirl-bf-ruby 19:31:47 ruby... i know it but cannot use very well. 19:31:59 whirl-bf-YABALL 19:32:04 cannot -> don't 19:32:06 oh! 19:32:19 if you give me bf code i can convert it to a bf-YABALL polyglot 19:32:25 ;) 19:32:48 and you can fill any spaces in the code with 1s and 0s 19:35:48 i'm done with homework! 19:36:04 i just have to put it together and print it 19:36:09 yay! 19:59:08 -!- sp3tt__ has joined. 19:59:45 jix: the YABALL article doesn't list the , and . operators 19:59:55 aren't they used? 20:00:22 -!- sp3tt__ has changed nick to sp3tt. 20:02:00 urgh 20:02:11 the cat example uses them, and also a @ operator which isn't mentioned 20:02:22 hehe 20:02:32 homework+specwriting doesn't work 20:02:42 i should scan my homework for the @ operator ;) 20:04:32 fixed 20:07:22 -!- sp3tt_ has quit (Read error: 145 (Connection timed out)). 20:08:19 kipple: any comments about YABALL 20:08:44 looks nice, but too close to BF for my taste 20:09:45 its hard not getting to close to any other language 20:09:51 too 20:12:17 the concept of different modes is interesting. that's pretty original I think 20:15:23 -!- sp3tt__ has joined. 20:15:53 -!- sp3tt has quit (Nick collision from services.). 20:16:05 -!- sp3tt__ has changed nick to sp3tt. 20:16:08 I don't understand the cat example: when the [ moves the IP down, why doesn't the ] cause it to go right back up again, causing an endless loop? 20:16:45 because it's in normal mode and moves right after moving down 20:17:21 ah, I see 20:17:44 guess I'm thinking befunge 20:18:25 my first esolang was a vary simple fungoid 20:19:49 are the cells signed or wrapping? 20:20:07 signed or unsigned makes no difference 20:20:11 but they are wrapping 20:21:21 well, signed makes a difference if you try to output a negative number... at least it doesn't say anything about that 20:21:47 ok they are unsigned 20:22:12 " Values less than 32768 are reserved for future extensions" 20:22:26 do you mean _more_? 20:22:43 more? 20:23:02 greater I mean 20:23:46 0-255 stdout 256-511 stderr 512 close stdout 513 close stderr 514-32767 reserved 32768-?? custom 20:23:52 or is it Values >513 and < 32768? 20:24:02 ah yes 20:24:36 0-255 are also less than 32768, so you might want to be more precise ;) 20:24:53 feel free to clean that part up.. it's a wiki 20:25:21 ok, if you aren't editing it now... 20:30:06 1107 bytes already... bloody bloatware! {^Raven^}, i'm not sure whether to thank you or to curse you for bringing that contest to my attention 20:30:28 what contest? 20:30:36 golfing? 20:30:45 i want to golf! 20:31:02 * kipple hands jix a driver 20:31:30 jix: http://www.geocities.com/dunric/advcomp.html 20:32:57 hmmh 20:33:01 my english isn't that good 20:33:47 a german text adventure.. would be a lot easier for me (even tho the german grammar is horrible) 20:34:35 well, engrish has its charms too :) Just think of Zero Wing 20:35:22 zero wing? 20:35:44 "All your base are belong to us!" 20:35:48 ah ^^ 20:36:07 someone set us up the bomb... 20:36:18 what happen? 20:36:45 may i use other platforms than those on the page? 20:37:08 jix: you'd have to ask the person holding the contest 20:37:35 i 20:37:35 i'm thinking of a COSMAC ELF II 20:37:43 heh. 20:37:59 well, if there's a free emulator... there's always a chance 20:38:02 with a 1802 cpu 20:38:20 http://www.tinyelf.com/ is for mac os x 20:39:38 away 20:45:28 that's an interesting contest. though the rules are a bit confusing... 20:47:59 yeah 20:48:24 i wonder how much abuse they'll be subject to. 20:49:12 is linux an allowed platform? 20:49:59 I guess they'll have to be lenient with the rules 20:54:50 -!- sp3tt has quit ("Chatzilla 0.9.68a [Firefox 1.0.4/20050511]"). 21:08:03 <{^Raven^}> i am assuming that *any* programming language is acceptable 21:08:17 <{^Raven^}> as long as...etc 21:09:18 <{^Raven^}> cpressey: I'm still on paper 21:12:29 <{^Raven^}> cpressey: I'm going to max mine out at 2,899 bytes. I wish the organiser would decide on a definate limit with no leeway 21:14:09 <{^Raven^}> *definite - bah 21:17:48 <{^Raven^}> it says that the listed platforms include what is allowed but doesn't state the competition is limited to them only 21:23:55 in what languages are your adventures? 21:25:17 i've finished 99 bottles of beer in whirl: http://page.tokigun.net/obfuscation/file/99bottle.wr 21:25:52 tokigun: yay 21:26:09 <{^Raven^}> for this I am using BBC BASIC, was tempted to use 6502 but BASIC is more efficient 21:26:54 maybe i'm going to use ti-89/92(+)/v200 basic 21:27:04 or chipmunk basic 21:37:53 -!- Keymaker has joined. 21:38:05 'ello 21:38:12 tokigun: good job! 21:38:40 ;) 21:39:07 i'm writing a letter to author... 21:39:14 cool 21:53:38 cpressey: what programming language are you using? 21:57:59 -!- calamari has joined. 21:59:23 hi calamari 22:00:18 Keymaker: http://sparcs.kaist.ac.kr/~tokigun/dev/whirl99bob.txt 22:00:20 moin calamari 22:00:31 my Whirl assembler script ;) 22:00:36 hello calamari 22:00:38 wow 22:00:47 it is just a script.. but it helps me a lot 22:00:58 yeah.. confuses me a lot 22:02:38 so, that's the code you feed for your whirl assembler and it generates the 01 stuff? 22:02:43 yes 22:03:02 ok. btw, is the assembler available? 22:03:18 this script is assembler 22:03:35 oooh 22:03:38 main function is whirlasm, whirlasmtable. 22:04:13 first it assembles the given code, using whirlasm() 22:04:14 hey, is that python? 22:04:16 yes 22:04:19 ah 22:05:03 then it generates table that program uses, using whirltable() 22:05:10 yes 22:05:26 hi key, jix & toki :) 22:05:29 table is translated to whirl psuedo-code, using whirlasmtable(). 22:05:31 calamari: hello ;) 22:05:43 toki... in Korean it means "rabbit". ;) 22:05:55 :) 22:05:58 anyway... 22:06:18 program psuedo-code and table psuedo-code is combined, 22:06:34 and assembled again using whirlasm. 22:06:39 be vewwy vewwy quiet.. I'm hunting wabbits! 22:06:40 ok 22:06:46 so, the assembler could be used for any other program as well, when changing stuff inside p = r""" .... """ to some other..? 22:07:29 Keymaker: yes, but there are many restrictions. 22:07:37 ok 22:08:00 jix: assembly language 22:08:20 currently my assembler cannot preserve ring state... i.e. selected ring, selected instruction of each ring, direction of each ring. 22:08:33 rabbit gun? 22:09:13 cpressey: for what cpu/computer? 22:09:18 lament: hmm 22:10:01 lament: "-gun" is suffix in Korean/Japanese... 22:10:20 it has some nuance... eh... i don't know how to explain it. :S 22:11:00 Keymaker: so i have to arrange ring state manually... /0, /1, !blah/blah command is used for this reason. 22:11:11 jix: 286/MS-DOS 2.0 22:11:11 ok 22:11:38 maybe some 386 instructions if i get lazy :) 22:11:49 cool, that script was written tomorrow :) 22:12:25 calamari: what script? :) 22:12:39 whirl99bob.txt 22:12:47 ah ;) 22:13:04 it is 6:13 am Monday here. 22:13:15 :) 22:13:25 early riser 22:13:41 i don't think he has even gone sleepin' 22:14:00 Keymaker: gave him the benefit of the doubt :) 22:14:14 :) 22:14:18 i have exam in 9:00 am, 11:00 am... so i didn't get to sleep ;) 22:14:36 heh 22:15:46 I stayed up way too late last night working on that java gui.. barely made it to church this morning 22:16:18 :) 22:23:46 -!- jix has quit ("Banned from network"). 22:58:58 yes! i'm at 1011 instructions now.. 22:58:59 http://bf-hacks.org/hacks/quine.b 22:59:24 i hope to break the 1000 limit soon (although not tonight) 23:01:10 good luck ;) 23:01:32 cheers 23:09:40 wow, bf quine 23:10:10 heh, my first weights 7000+ instructions 23:10:36 My quine written in Aheui - http://puzzlet.org/puzzlet/%EC%95%84%ED%9D%AC~%EC%BD%B0%EC%9D%B8 23:10:46 i've gotten ideas randomly, like for example doing something and then "hey, i could try that trick" and so on :) 23:11:00 wow 23:11:04 looks cool :) 23:11:24 and sounds crazy in Korean 23:11:31 heh 23:12:19 by the way how you get ideas while doing some other things? 23:12:31 you must be multi-threaded 23:12:31 well, dunno 23:12:34 hehe 23:13:06 that just happens. i'm doing something non-brainfuck related and then i get some idea i could try :) 23:13:26 can be that the language has modified my brains.. 23:15:21 probably. 23:16:16 i sometimes feel funge iterator points wander around in my brain 23:16:30 heh 23:16:35 or aren't they instruction pointers? 23:16:47 forgot what IP stands for 23:17:00 not sure 23:18:22 instruction pointer seems correct 23:22:20 -!- heatsink has joined. 23:22:41 cool mumbai is spelled correctly 23:23:08 what is that stuff? 23:23:36 ? 23:24:26 that package from mumbai 23:24:40 i don't get the line in topic.. 23:24:57 no se. 23:26:18 nose. 23:49:56 oh no.. i have dentist time today, in ~10 hours 23:50:06 :( grrrrrrh 23:50:17 well, good nite 23:50:20 -!- Keymaker has left (?). 2005-06-20: 00:27:10 bbiaw.. phone 00:27:15 -!- calamari has quit ("Leaving"). 01:04:24 -!- graue has joined. 01:04:49 anyone written a quine in Qdeql yet? 01:08:06 my guess: no ;) 01:12:18 kipple, what have you been up to? 01:12:47 not too much :) 01:12:59 currently I'm pondering about the next Kipple version 01:13:40 Kipple07? 01:13:54 hehe. no 05 01:14:01 that should be done by now 01:14:02 hurry up with it 01:14:15 what's the rush? 01:14:21 oh, I was just jesting 01:14:31 actually I like kipple so much fundamentally that I've been thinking about the possibility of making a non-esoteric language resembling it 01:14:43 really? 01:14:47 yeah, it's cool having stacks built in like that 01:18:10 -!- calamari has joined. 01:18:13 hi 01:18:29 hi 01:18:48 hello 01:19:23 hi graue, kipple 01:19:43 that reminds me, I need to set up a cron job for that download :) 01:20:41 you need to write a quine in Qdeql 01:21:06 and it needs to be more than 0 bytes long 01:21:28 I wonder if there can be a tc language for which there is no quine 01:21:58 ah, that reminds me to forbid null programs in the Kipple spec :) 01:22:17 calamari: that is an interesting question! 01:29:17 graue: is & the only way to enqueue a byte in qdeql? 01:30:06 oh.. nm, I see it in \ 01:31:16 wait though.. when starting off there is nothing in the queue, so how do you get started besides input? 01:32:22 unless you start off with a single item in the queue.. then you could do -\ 01:48:44 \ reads 0 if the queue is empty 01:48:50 same as anything that reads from the queue 01:49:12 (that also means you can get a 0 byte by doing = to an empty queue, or get a 255 byte by doing - to an empty queue) 01:49:39 \ and & are the only ways to enqueue something when starting from a nonempty queue 01:49:57 of course there can be a TC language with no quine 01:50:01 Turing machines can't do output 01:50:09 there isn't a qdeql article in the wiki. do you have a link to the spec? 01:50:11 Smallfuck is a TC language with no quine 01:50:14 www.oceanbase.org/graue/qdeql 01:50:47 * kipple bookmarks it this time 01:51:27 if the queue is empy, how can you dequeue.. isn't that an error? 01:51:56 no, it returns 0 01:52:00 oh, I see it in the spec now :) 02:10:03 -!- kipple_ has joined. 02:10:03 -!- kipple has quit (Read error: 131 (Connection reset by peer)). 02:15:18 calamari: turing proved that any TC language has a quine 02:17:16 -!- kipple_ has quit ("See you later"). 02:21:03 heatsink, um, that's not true 02:21:07 it cannot be 02:21:16 TC languages are not obligated to provide any form of output 02:21:34 and you can't just say "any TC language with output" because what if it can't output all of the characters used in its source? 02:22:00 what if it throws a "This programming language is (C) 1999 ME! All rights reserved" message into the beginning of the output and using that is invalid? 02:22:14 you would need a totally different definition than "TC language" in order to provide anything meaningful like that 02:35:46 graue: if it throws that into the beginning of output it's okay, because the quine when run will automatically output that too 02:35:59 I'm pretty sure that the only output of a turing computer is what that computer writes on the tape (which is also its input) 02:36:37 So any program that has the same contents of the tape when it halts is a turing machine quine. 02:36:39 graue: oh wait.. yeah :) 02:36:57 That is different from having a separate I/O channel, I guess 02:37:12 graue: so I think that's pretty good evidence against quines :) 02:37:25 http://www.cs.cornell.edu/Courses/cs682/2004sp/Lectures/l34-recthm.pdf first page talks about the relation of quines to the fixpoint operator 02:54:07 since a UTM has to have a description of a TM on its tape when it starts... seems dreadfully easy to make a quine ;) 02:54:39 heh 03:03:45 bbl 03:03:47 -!- calamari has quit ("Leaving"). 03:20:01 heatsink, for the memory to be the code when the program finishes is not possible in many Turing-complete languages 03:20:13 the memory may not be a sequence of bytes (like code usually is) 03:21:19 that makes sense. 04:41:53 -!- GregorR has quit (Remote closed the connection). 05:05:28 -!- heatsink has quit ("Leaving"). 06:06:09 -!- graue has left (?). 06:24:21 -!- tokigun has quit (Read error: 110 (Connection timed out)). 06:40:18 -!- tokigun has joined. 07:59:59 -!- clog has quit (ended). 08:00:00 -!- clog has joined. 12:20:24 -!- tokigun has quit ("Chatzilla 0.9.68.5 [Firefox 1.0.3/20050414]"). 13:23:32 -!- jix has joined. 13:35:17 moin 13:45:18 ! 14:02:55 -!- tokigun has joined. 14:08:40 moin tokigun 14:09:21 away 14:10:18 hello 15:16:48 -!- kipple has joined. 17:05:59 back 17:20:14 i'm writing a YABALL interpreter atm 17:24:12 -!- tokigun has quit ("Chatzilla 0.9.68.5 [Firefox 1.0.3/20050414]"). 18:08:33 -!- Keymaker has joined. 18:08:46 'elgooggro 18:15:42 YABALL interpreter done 18:20:42 -!- azurespace has joined. 18:20:52 -!- azurespace has left (?). 18:23:00 underflow..grrr 18:36:25 found the bug.. 18:37:01 -!- tokigun has joined. 19:14:09 yeaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaah!!!! 19:14:18 i got the quine under 1000 instructions 19:14:19 http://bf-hacks.org/hacks/quine.b 19:14:24 933 instructions 19:14:29 neat 19:14:30 the previous version was 1011 19:14:33 thanks 19:15:01 so, neatly 78 instructions less :) 19:16:10 my goal was to get a quine under 1000 instructions, and i finally succeeded. now i don't write bf quines for a while, i'll do other kind of programs :) 19:18:24 (in bf, of course) 19:18:29 anyways, must go. 19:18:31 -!- Keymaker has left (?). 19:36:28 ok YABALL interpreter is linked on the wiki 19:44:10 -!- GregorR has joined. 19:44:42 I need a good dictionary of words related to esoteric programming to use for my scrabble clone :P 19:53:19 -!- CXI has quit (Read error: 104 (Connection reset by peer)). 19:54:06 -!- CXI has joined. 20:14:40 an entire dictionary? good luck... (the wiki is a good starting place) 20:15:05 are language names acceptable? 20:26:34 -!- J|x has joined. 20:27:48 <{^Raven^}> kipple: technichally no because they are proper nouns but you could make an exception 20:28:24 yes, I know the normal rules 20:29:34 but an esoteric scrabble that does not allow words like brainfuck or funge? I'd say allow it 20:30:02 <{^Raven^}> definatekly 20:38:39 -!- jix has quit (Read error: 110 (Connection timed out)). 20:51:19 -!- graue has joined. 21:06:15 -!- J|x has changed nick to jix. 21:09:57 My fault. The word "dictionary" is inaccurate here. 21:10:01 I really just mean "word list" 21:10:13 Hell, doesn't even have to be words. 21:11:45 I'm just trying to think of some bizarre dictionaries for my bizarre scrabble clone. Currently the only one I have is the libc symbol list :) 21:12:30 I tried to play as "Himself" in one of your games, but I couldn't come up with anything that would fit 21:15:04 so just copy all the language names and make a wordlist out of those, and related terms 21:15:18 funge, quine, stack, queue, cell, turing, etc 21:15:55 how about TMMLPTEALPAITAFNFAL with triple word score? 21:16:09 it's longer than 15 letters, so it can't be done :( 21:17:08 My board uses 20 letters. 21:17:15 -!- csaba has joined. 21:17:33 great then 21:17:34 The problem is, my libc symbol dictionary has 2,800 something words, and it's really, REALLY tough. 21:17:40 Hi, I've finished writing a visual Turing machine designer. If you're interested check it out: an be done? 21:17:40 [21:40] hmm maybe firefox will do 21:17:43 an be done? 21:17:44 [21:40] hmm maybe firefox will do 21:18:03 Didn't have the copy buffer you thought you did? :) 21:18:04 http://sourceforge.net/projects/visualturing/ 21:18:05 I'm interested in what you think 21:18:10 yeah 21:18:30 GregorR, libc has a lot of repetition 21:18:53 e.g. the fact that you can make all of vsprintf, vprintf, vsnprintf, snprintf, sprintf, printf, and fprintf, doesn't help much 21:19:06 Even so, the list of languages and common elements in esoteric languages would be well under 1000, probably under 500. 21:19:19 "quine," "cell," and "turing" are easy 21:19:37 don't make me write this wordlist for you 21:19:41 lol 21:19:53 I'll look in to it when not at work ;) 21:20:15 Turing machine is considered esoteric language? 21:20:35 no, but we like to prove that esoteric languages are equivalent to Turing machines 21:20:43 because that means they can compute lots of stuff 21:20:46 ah 21:21:14 so basically it's propaganda to fool people into using esoteric languages? :) 21:22:05 uh, no. It's for proving the usefulness of the language 21:22:26 anyone used brainfuck? 21:22:40 ha! 21:22:58 anyone not used brainfuck here? 21:23:11 I've downloaded an interpreter and now I've showing it to everyone to see what kind of people exist 21:23:21 they're like omg 21:23:24 lol 21:23:30 turing machines are very much like an esoteric language 21:23:39 they're about as hard to write programs for as brainfuck. 21:23:48 check out my program: 21:23:48 [22:20] "quine," "cell," and "turing" are easy 21:23:48 [22:20] don't make me write this wordlist for you 21:23:52 damn 21:23:57 http://sourceforge.net/projects/visualturing/ 21:24:14 I designed a machine which calculates factoriel in less than 5 minutes 21:24:21 -!- malaprop_ has joined. 21:29:37 that's cool 21:29:43 wait, a factorial of what? 21:30:10 well, 5! is |||||| and you'd get 125+1 lines in the end ;) 21:30:22 i see 21:30:56 it's cute to look at the machine head going left and right, doing stuff etc... 21:31:22 -!- malaprop has quit (Read error: 110 (Connection timed out)). 21:31:53 csaba: the factorial of 5 is 120 21:31:58 oops 21:32:14 I'm really tired, I haven't slept normally for 3 days 21:35:28 it is cool that you made this 21:36:12 does it run at yourplace? I'm worried that because it's written in Java people might have problems in starting it 21:38:09 I don't have java 21:49:02 csaba: just create a native binary and people can run it just like any other program 21:50:11 I've placed a start.exe which runs the "java -jar Turing.jar" command... it should work if JVM is installed... 21:51:00 csaba: yeah, but you can make it turing.exe with GCC 21:51:57 well ok, I'll make an exe... 21:53:15 Doesn't it use swing? Is there a swing for GCJ? 21:53:27 GregorR: yep 21:54:46 GregorR: and it's improving at a steady pace 21:57:05 although it seems to have some issues... 22:07:50 csaba: always use the name of the containing folder for a zip/tgz file.. it's a lot easier to find the folder that way.. 22:09:15 jix: rename the zip file to Turing.zip ? 22:09:28 i can't guess the name of the folder 22:10:06 ok I'll keep that in mind 22:10:11 but i like sticking the archive and folder together in a sorted list.. 22:11:23 well I was just happy I finished the damn thing, I haven't slept normally for 3 days because of it... didn't think about how to name the zip file ;) 22:11:47 hehehe 22:13:14 ok, I'll compile an exe file tomorrow... might as well add a readme.txt... now I'm going to bed... 22:13:32 -!- csaba has quit (" HydraIRC -> http://www.hydrairc.com <- IRC for those that like to be different"). 22:31:11 g'nite 22:31:25 -!- jix has quit ("Banned from network"). 2005-06-21: 00:30:10 -!- heatsink has joined. 00:44:12 -!- tokigun has changed nick to tokigun^away. 00:44:12 -!- kipple has quit (Read error: 104 (Connection reset by peer)). 00:49:22 * {^Raven^} has spent the last 4 hours fighting off DoS attacks 00:52:52 are they still there? 00:53:23 or have they abated 00:53:51 <{^Raven^}> i have blocked the attacks, but am leaving the server off overnight 00:54:49 good work 00:54:51 <{^Raven^}> one was from the US and one from Bucarest 00:55:28 <{^Raven^}> two seperate incidents in 8 hours and completely unrelated to boot 00:56:25 <{^Raven^}> one attacker has given up and the other one should soon 00:57:08 <{^Raven^}> but it's ruining things for everybody 00:57:37 Are they using much of your bandwidth? 00:57:57 <{^Raven^}> every last scrap 00:58:06 ouch. 00:58:14 <{^Raven^}> just enough for a really slow ssh to the server 00:58:21 <{^Raven^}> *left 00:59:18 <{^Raven^}> I've had to take 8 domains and 20 sites offline and severely knacker another 00:59:45 Is there anyone upstream who can filter packets? 01:01:08 * heatsink looks up "knacker" in the dictionary 01:01:21 -!- kipple has joined. 01:01:22 <{^Raven^}> There's no need to do that as I can block the attacking hosts 01:01:55 <{^Raven^}> But everyone is being reported 01:03:30 1 [British]: a buyer of worn-out domestic animals or their carcasses for use especially as animal food or fertilizer 01:03:30 2 [British]: a buyer of old structures for their constituent materials 01:03:30 I didn't know there was an authority to report DOSes to. 01:03:50 <{^Raven^}> knacker (usu) = someone who buys up old horses for slaughter 01:04:21 <{^Raven^}> there isn't, you just report them to their ISP 01:04:30 ok 01:05:34 <{^Raven^}> if it was a distributed denial of service attack i might need to get my ISP to filter packets aswell but no need this time 01:21:31 -!- malaprop_ has quit (Read error: 145 (Connection timed out)). 01:32:31 <{^Raven^}> sweet... first attacker has been told off and is now offline and their ISP has aplogised profusely :D 01:33:49 awesome! Powa brutha! (or sistah!) 01:34:14 * {^Raven^} checks... 01:34:25 <{^Raven^}> definately male 01:35:14 Hmm... I don't usually need to check... 01:35:28 <{^Raven^}> i *love* it when I win 01:35:50 :) 01:36:46 * {^Raven^} has booby traps on some of his sites which automatically report certain types of abuse 01:37:07 you get this often I guess 01:37:17 <{^Raven^}> no just twice today 01:37:33 Have you tested the boobytraps? 01:38:07 <{^Raven^}> I can't test them, I might end up getting my own net access blocked 01:38:45 * heatsink looks away 01:38:46 yeah... 01:38:48 <{^Raven^}> but the occasional email from ISP abuse departments tells me that they work fine 01:40:25 <{^Raven^}> there's no way that legit people can accidentally trip them, they just get the bad guys 01:41:29 <{^Raven^}> what really sucks is that I know that a lot of ISPs and other service providers do nothing about abuse originating from their networks 01:45:11 <{^Raven^}> anyways, I'm off to bed 01:45:15 <{^Raven^}> nite all 01:46:45 goondight raven 02:03:02 -!- kipple has left (?). 02:07:54 -!- malaprop has joined. 02:08:49 -!- kipple has joined. 03:11:46 http://grables.sourceforge.net/libc.php?view=0 < look at this awesome game. 03:11:49 I played liblongjmp 03:11:53 Err, siglongjmp. 03:12:06 I cannot believe that fate handed me siglongjmp!!! How friggin' lucky am I?! 03:17:25 hehe 03:17:37 cool scrabble variant! 03:18:09 Thanks ^_^ 03:18:35 Because the dictionary is so small, I had to give 30 tiles instead of 7 XD 03:18:39 And it's still tough. 03:22:37 I'm not very familiar with libc, but an esoteric themed version would be great! (if you can find enough words) 03:22:49 That's the problem. 03:22:55 I was discussing that here before. 03:23:02 I know 03:23:07 libc has 2,800+, and it's incredibly difficult. 03:28:04 Oooooooooooooooooooooh 03:28:05 I know. 03:28:19 How about I just download the logs from #esoteric, and any word in there goes XD 03:32:45 haha 03:33:29 anyway. gotta go to bed. I'm leaving town for a couple of weeks tomorrow, so see you all later 03:36:50 Bye 03:39:54 -!- kipple has left (?). 04:34:42 -!- tokigun^away has changed nick to tokigun. 05:07:25 -!- heatsink has quit ("Leaving"). 06:34:08 -!- calamari has joined. 06:34:45 hi 06:37:41 -!- malaprop_ has joined. 06:38:23 -!- malaprop has quit (Read error: 104 (Connection reset by peer)). 06:50:32 -!- wooby has joined. 06:55:20 -!- tokigun has quit (Read error: 104 (Connection reset by peer)). 06:55:23 -!- tokigun_ has joined. 06:55:25 -!- tokigun_ has changed nick to tokigun. 06:55:34 hi 06:58:43 -!- graue has quit (Read error: 145 (Connection timed out)). 07:08:56 -!- graue has joined. 07:25:43 hi wooby 07:26:29 howdy 07:33:32 -!- graue_ has joined. 07:33:56 -!- graue has quit (Read error: 145 (Connection timed out)). 07:34:01 -!- graue_ has changed nick to graue. 07:51:24 hi graue 07:52:24 hello 07:59:59 -!- clog has quit (ended). 08:00:00 -!- clog has joined. 08:34:38 whew, finally got the gui functioning, now just need to implement the model 08:51:08 -!- kipple has joined. 08:56:13 hi kipple 09:12:00 -!- sp3tt has joined. 09:22:10 hi sp3tt 09:22:29 Hi. 09:36:38 -!- kipple has left (?). 10:31:55 Step seems to be fully working :) 10:32:21 only two buttons left (Pass, Run) and I'm done 10:32:28 what are you doing? 10:32:47 graue: writing a bit/bool debugger as a Java gui app 10:32:52 great 10:42:58 <{^Raven^}> mornin 10:57:05 -!- calamari has quit (Read error: 110 (Connection timed out)). 11:00:02 oh wow, I just found a Beatnik interpreter for DOS that I wrote in 2002 11:00:22 who knew such things existed? 11:50:06 -!- jix has joined. 11:50:29 hi jix 11:50:38 moin graue 11:53:59 i'm going to mirror the mysql dumps from the wiki 12:01:57 great 12:02:09 have you written a XUML spec yet? 12:03:14 no and there is an error in my interpreter or converter 12:03:29 but i wrote YABALL spec and interpreter 12:05:54 I am interested in XUML because of its name beginning with the letter X 12:07:55 hehe 12:08:07 that was the reason for inventing XUML 12:27:13 -!- J|x has joined. 12:27:49 -!- jix has quit (Nick collision from services.). 12:27:51 -!- J|x has changed nick to jix. 12:46:07 weekly crontab for downoading the mysql dumps to http://esolangs.org.bu.jix.qz-b.de/wiki_db/ 15:13:28 is someone here (excepting me) able to find all (real) solutions for x for all real a and b for (2x + a + b)^3 = (x + a)^3 + (x + b)^3 15:14:33 what is character 0x1e? 15:15:08 uhm trash from copying it from a (german) website 15:15:13 http://www.mathematik-olympiaden.de/Aufgaben/42/3/42133a/42133a.html 15:15:23 no, i have no idea how to find real solutions for that 15:15:35 hehe 15:15:40 jix: http://paste.debian.net/833 15:16:01 nah without a cas 15:16:35 computer aided solvatron? 15:16:48 computer-algebra-system 15:17:11 i did it with my brain 15:17:20 my brain is a computer chip 16:34:15 -!- Keymaker has joined. 16:35:39 'ello 16:35:41 am i here? 16:36:05 yes 16:36:15 ok 16:43:02 hmm 16:43:13 who is a master of esolang webring? 16:43:21 no idea 16:43:47 iirc he was taken to mental hospital 16:43:48 i forgot to add the ring fragment to my page 16:43:59 (joke) 16:44:05 ;) 17:04:04 http://fun.sdinet.de/pics/english/rock_rule.jpg 17:05:38 hehe :) 17:14:10 well.. must go. i'll have blade marathon today. all three blade movies. gotta get snacks and lemonade from store. 17:14:18 :) 17:14:19 -!- Keymaker has left (?). 17:25:59 -!- J|x has joined. 17:26:33 -!- cpressey has quit (Remote closed the connection). 17:26:45 -!- cpressey has joined. 17:27:21 -!- jix has quit (Nick collision from services.). 17:27:23 -!- J|x has changed nick to jix. 17:32:45 i'm trying to write a 2k text-adventure in ruby 17:35:05 oh 17:35:30 oh? 17:36:42 can you show me the progress? 17:37:38 i have no story (yet) 17:37:43 but i'm writing story less code atm 17:37:55 (fight engine,io handling...) 17:38:29 421 bytes.. hmm i could compress the code usign my own algorithm or using zlib(because it's in the ruby stdlib) 17:38:31 hmm 17:38:40 do you have a nice idea for a story? 17:38:54 no idea 17:42:00 -!- sp3tt has quit ("Chatzilla 0.9.68a [Firefox 1.0.4/20050511]"). 17:48:16 no one has an idea 17:55:51 how about a homeless kid finds a discarded laptop on the streets of a city slum, connects to an unsecured wireless network, and begins learning about esoteric programming languages? 18:28:37 -!- J|x has joined. 18:29:10 -!- jix has quit (Nick collision from services.). 18:29:11 -!- J|x has changed nick to jix. 18:29:27 P"You are a small mouse, kept in a too small cage. Your mission is to escape from the cage." 18:30:43 graue: that's an awesome idea 18:30:54 story of my life :) 18:42:20 wooby, seriously? 18:44:07 well, i wasn't homeless... but my first computers were always discarded heh 18:44:07 -!- J|x has joined. 18:44:15 and that wasn't really wireless heh 18:44:23 more like... unsecured bbs 18:44:40 -!- jix has quit (Nick collision from services.). 18:44:45 -!- J|x has changed nick to jix. 18:45:15 there was that one "homeless hacker" guy who did some cheesy exploit on the new york times 19:11:34 -!- jix has quit ("This computer has gone to sleep"). 19:51:10 -!- wooby has quit. 19:56:40 -!- wooby has joined. 19:57:44 -!- tokigun has quit (Read error: 104 (Connection reset by peer)). 19:57:55 -!- tokigun_ has joined. 19:57:57 -!- tokigun_ has changed nick to tokigun. 19:58:03 hi tokigun 20:18:08 -!- jix has joined. 20:18:50 back 20:47:40 my text-adventure game engine is done about 500byte 20:51:36 and imo it has the right code-size / feature balance 20:52:45 mine's about 2000 bytes at present 20:52:58 just engine or game 20:53:04 engine 20:53:21 are you going to use an external datafile? 20:53:27 hell yes 20:53:36 hehe 20:53:48 i'm trying to do it without one 21:00:02 -!- graue has quit (Remote closed the connection). 21:00:10 -!- graue has joined. 21:02:01 700 bytes without text and code compression 21:02:08 1 room implemented 21:03:56 jix: is that for x86 and DOS? 21:04:06 no its written in ruby 21:04:23 ok 21:05:27 nah that story doesn't work.. i need a new story 22:26:21 -!- jix has quit ("Banned from network"). 23:18:38 -!- wooby has quit. 23:28:33 * {^Raven^} likes the idea of having competition this year 23:28:40 <{^Raven^}> good luck to all :) 23:29:13 -!- malaprop_ has quit (Read error: 104 (Connection reset by peer)). 2005-06-22: 00:02:48 back down to 1551 bytes ;) 00:08:40 -!- malaprop has joined. 00:43:46 -!- tokigun has quit ("Chatzilla 0.9.68.5 [Firefox 1.0.3/20050414]"). 01:14:51 new (i.e., old) Beatnik interpreter if anyone cares: http://www.oceanbase.org/graue/stupid/BEATNIK.c 01:16:21 pity Beatnik has only one stack and is therefore computationally useless 02:17:23 -!- graue has left (?). 02:20:21 -!- tokigun has joined. 04:38:17 -!- tokigun has quit (Remote closed the connection). 04:48:39 -!- GregorR has quit (Remote closed the connection). 05:42:51 -!- GregorR has joined. 07:59:59 -!- clog has quit (ended). 08:00:00 -!- clog has joined. 08:37:33 -!- tokigun has joined. 10:22:51 -!- CXI has quit (Connection timed out). 12:00:46 -!- lament has quit (Remote closed the connection). 12:09:47 -!- lament has joined. 13:34:57 -!- graue has joined. 13:40:41 -!- jix has joined. 13:41:07 moin 13:55:13 hi jix 13:55:50 is there a wiki page with a list of wiki db mirrors? 13:55:50 -!- lindi- has quit (Read error: 104 (Connection reset by peer)). 13:56:15 i think one exists a few minutes in the future, by which time you will have created it 13:56:19 but not at this time, no 13:56:36 are there any other public mirrors 13:57:10 there are mirrors of the sql file, but i don't think there are any mirroring the actual browsable content 14:01:09 -!- lindi- has joined. 14:01:21 graue: where are they? 14:05:03 one of them is at http://rune.krokodille.com/lang/wiki-backup/ 14:06:09 I've seen others mentioned here, but I can't find them at the moment 14:23:16 -!- CXI has joined. 14:47:15 i just noticed it's better to first have a story for a text adventure and than start writing it 14:47:41 oh and not just the beginning of the story but the whole game story 14:48:40 cpressey: how far are you with your engine? 15:04:43 -!- jix has quit ("Banned from network"). 15:04:54 -!- jix has joined. 15:32:19 -!- graue_ has joined. 15:32:19 -!- graue has quit (Read error: 104 (Connection reset by peer)). 15:33:06 -!- graue_ has changed nick to graue. 16:02:25 -!- tokigun has quit (Read error: 104 (Connection reset by peer)). 16:02:28 -!- tokigun_ has joined. 16:02:31 -!- tokigun_ has changed nick to tokigun. 16:03:30 hi tokigun 16:04:19 hello 16:13:23 -!- tokigun has quit (Read error: 104 (Connection reset by peer)). 16:13:26 -!- tokigun_ has joined. 16:13:28 -!- tokigun_ has changed nick to tokigun. 16:13:39 ....oops 16:28:43 -!- tokigun has quit (Read error: 104 (Connection reset by peer)). 17:13:31 -!- tokigun has joined. 17:17:07 * GregorR watches the big red rubber tokigun bouncing ;) 17:17:29 heh 17:17:57 hmm 17:18:10 i don't know why i was disconnected 17:43:01 -!- graue has left (?). 17:45:12 -!- graue has joined. 17:48:03 -!- tokigun has quit (Read error: 104 (Connection reset by peer)). 17:48:03 -!- tokigun_ has joined. 17:48:04 -!- tokigun_ has changed nick to tokigun. 17:48:11 is someone else writing an entry for the 2k text-adventure competition? 17:49:02 not really 17:50:15 i want application + string file (i'm going to supply a german and an english string file) to be less than 1.5k 17:50:20 but that's hard 17:51:41 what's the correct english word for a cage wall (the grid thing)? 17:55:14 fence 17:56:02 ok thanks 18:14:33 18:14:35 Kang Seonghoon strikes again, this time with the classic "99 Bottles of Beer" implemented in a shocking 15,556 instructions! Beyond cool! The code is also available here. 18:14:40 ;) 18:15:09 it's time to buy some foods... 18:18:34 -!- graue has quit (Remote closed the connection). 18:19:10 -!- graue has joined. 18:27:44 -!- J|x has joined. 18:30:28 -!- jix has quit (Nick collision from services.). 18:30:29 -!- J|x has changed nick to jix. 19:07:45 -!- J|x has joined. 19:17:34 -!- jix has quit (Connection timed out). 19:34:49 -!- J|x has changed nick to jix. 19:42:51 -!- graue has quit (Read error: 110 (Connection timed out)). 19:52:22 -!- tokigun has quit ("Chatzilla 0.9.68.5 [Firefox 1.0.3/20050414]"). 19:56:21 i have 1000bytes game (50% clean code i think i will shrink it down to 700byte) and ~600 bytes lang-file i think i have 30% of the game done 20:05:52 -!- pgimeno has quit (Read error: 54 (Connection reset by peer)). 20:37:39 -!- BlurredWe has joined. 20:37:49 heh, sweet...didn't know about this channel 20:38:48 so here's what I want to do: a shell script that runs under windows .bat interpreter and also under the sh interpreter. All it needs to do is 'echo "1 2 3" > $2' 20:42:37 -!- tokigun has joined. 20:42:48 hello 20:43:17 <{^Raven^}> jix: I am working on a game, for the competition 20:43:34 {^Raven^}: 2k text-adventure competition? 20:43:46 <{^Raven^}> tokigun: yeah 20:44:11 hmm 20:44:49 finally author of whirl replied me that he updated page. 20:44:56 http://bigzaphod.org/whirl/ 21:06:34 {^Raven^}: how far are you with your text-adventure? 21:17:28 <{^Raven^}> jix: at the end of the initial planning stage 21:30:51 -!- graue has joined. 21:37:52 {^Raven^}: at 17pm i was at the end of the planning stage 21:37:59 now i'm at the end of the coding stage 21:41:19 <{^Raven^}> sounds good 21:44:29 <{^Raven^}> jix: I'm looking forward to see what you come up with 21:49:09 jix: my engine is "done", if "done" means "it works and runs what i have for my game so far." i still have a significant list of improvements that i still want to make to it, though 21:56:04 -!- graue has quit (Remote closed the connection). 21:57:50 -!- graue has joined. 21:59:20 -!- graue has quit (Remote closed the connection). 22:01:58 -!- graue has joined. 22:09:32 -!- calamari has joined. 22:14:59 1219 mouse.rb 22:14:59 604 english.lng 22:14:59 1823 total 22:18:07 oh... 22:18:17 -!- graue has quit (Remote closed the connection). 22:18:28 jix: there is two langpacks? 22:18:31 s/is/are/ 22:18:40 at the moment not 22:18:46 but i'm going to add a german one 22:18:53 hmm... 22:19:07 -!- graue has joined. 22:20:19 anyway, good luck :) 22:21:43 hi jix 22:23:12 ok if i compress the sourcecode using zlib (self extracting sourcecode.. it's like a self extracting binary because in ruby there are no binaries) 22:23:27 1256 total 22:25:12 good 22:26:15 with a data file it could be up to 10.5kb 22:26:22 but i only need 1.2 kb 22:31:32 -!- BlurredWe has quit ("Leaving"). 22:44:34 2 langpacks + game 1924 total 22:45:06 with comments and no compression (game and packs) 6757 total 22:48:26 does someone want to test my adventure? (online) 22:48:55 requirement is telnet or netcat 22:49:02 me me me 22:50:03 for the most commands there are shortcuts 22:51:44 oh btw with x you can examine things 22:54:56 jix: I'd like to also :) 22:55:46 calamari: just one person a time 22:55:52 'k :) 22:56:15 because i'm starting the "server" manually using netcat and tail -f ^^ 22:57:40 -!- Keymaker has joined. 22:58:10 'ello 22:58:15 moin Keymaker 22:58:21 hi 22:58:34 there is no help 22:58:39 i can give you a command list calamari 22:59:01 that's okay... I'm just experimenting 22:59:19 grrr i never get e-mail 22:59:24 (not even spam) 22:59:27 jix "to the north" 22:59:46 calamari: hm? 22:59:55 vs "in the north" 23:00:03 -!- graue_ has joined. 23:00:20 -!- graue_ has quit (Remote closed the connection). 23:00:39 jix: creative game idea btw, I like it :) 23:01:21 it seems to pause after certain things, unless I push enter again 23:01:29 yes 23:01:38 that's a bug, I presume? 23:01:45 no it isn't a bug 23:02:00 any room for a "Press Return" message, then? :) 23:02:12 it's my laziness 23:02:21 hmm uh.. not really 23:02:40 uhm yes there is room i just found it 23:03:32 do you mean there is something blocking the other end of the pipe? 23:03:45 no there is just something 23:03:54 use the x command 23:04:01 or examine 23:04:10 eg x the_thing_you_want_to_examine 23:04:54 uh i can't parse complex sentences like that in 0.6 kb 23:05:08 what's complicated about "x pipe" :) 23:05:15 examine the pipe 23:05:18 x other end of the pipe 23:05:33 I tried x pipe first 23:05:37 and there is nothing interesting about the pipe so i didn't added a message 23:05:44 try to examine other things 23:06:12 lol 23:06:33 take not get 23:07:40 do you want a hint? 23:07:55 nope.. unless it's because of a command I don't know about :) 23:08:07 ok 23:08:34 x may work with directions too 23:10:08 exit? 23:10:22 no it was a question 23:10:32 there is no exit command and telnet sends ctrl-c as characters 23:10:40 and not as signal 23:10:55 i have to exit the program 23:11:07 do you now want to hear the solution? 23:11:24 nope! 23:11:34 do you want to try again? 23:11:54 nope. I need to get off actually, company came to the door :) 23:12:09 do you want to try it with the german langpack ^^^ 23:12:12 cool game.. could use a bit of polish, but really neat idea 23:12:18 -!- calamari has quit ("bbl"). 23:12:35 i'm going to bed now good nite 23:13:05 -!- jix has quit ("Banned from network"). 23:23:33 (reply lag) good night! 23:30:07 good night ;) 23:30:44 exam has finished but some reports are remained... hmm. 23:46:29 -!- calamari has joined. 23:46:38 re's 23:58:20 -!- graue has quit (Remote closed the connection). 23:58:52 -!- graue has joined. 23:59:32 -!- Keymaker has quit ("I've seen this déjà vu before.."). 2005-06-23: 00:00:34 hi graue 00:01:33 graue: can I use rsync to grab the dump, or do I need to use wget? 00:12:57 you need to use wget 00:16:04 'k :) 00:21:32 well, it's set up.. so now you have 3 mirrors :) 00:39:15 url? 00:40:58 on the preservation page 00:41:09 oh, of course 00:42:17 dunno if all that cron stuff is needed, but I didn't know it.. so I'll use it if I ever need to set it up again 00:45:18 one thing about it though.. if the wiki goes down, what point is there to have that list of mirrors on the wiki page.. hehe 00:45:43 so http://kidsquid.com/esowiki ;) 01:05:12 -!- graue has quit (Read error: 131 (Connection reset by peer)). 01:05:42 -!- graue has joined. 01:07:21 -!- graue has quit (Remote closed the connection). 01:08:03 -!- graue has joined. 01:14:34 -!- graue has quit (Remote closed the connection). 01:15:06 -!- graue has joined. 01:28:51 -!- graue has quit (Remote closed the connection). 01:34:25 -!- graue has joined. 01:35:25 graue: having fun with irc? 01:40:01 no 01:58:35 bbl 01:58:36 -!- calamari has quit ("Leaving"). 02:08:25 <{^Raven^}> nite peeps 03:34:59 -!- calamari has joined. 03:40:39 hi 03:49:13 -!- graue has quit (Read error: 60 (Operation timed out)). 07:59:59 -!- clog has quit (ended). 08:00:00 -!- clog has joined. 08:28:34 -!- calamari has quit (Read error: 60 (Operation timed out)). 10:15:51 -!- pgimeno has joined. 10:50:18 -!- andreou has joined. 11:12:29 -!- andreou has quit ("i be novel."). 12:57:41 -!- jix has joined. 13:00:27 moin 13:11:24 <{^Raven^}> morning 13:51:01 -!- jix has quit (Read error: 104 (Connection reset by peer)). 13:51:44 -!- jix has joined. 17:23:24 -!- HisteriX has joined. 17:23:41 -!- HisteriX has left (?). 17:37:04 -!- graue has joined. 17:55:05 -!- pgimeno has quit ("rebooting"). 17:57:56 -!- pgimeno has joined. 17:58:22 hi pgimeno 17:58:27 hey 18:01:29 -!- Dedo has joined. 18:03:53 -!- Dedo has quit. 18:09:43 -!- CXI has quit (Read error: 104 (Connection reset by peer)). 18:11:03 -!- CXI has joined. 18:26:33 electric storm - bbl 18:26:39 -!- pgimeno has quit ("This is the default quit message"). 19:56:26 -!- Keymaker has joined. 20:03:00 AAAAAAAAAAARRRRRRRGGGGGGGGH 20:11:10 -!- calamari has joined. 20:11:15 hi 20:11:16 hi 20:11:34 hello 20:13:07 how are things in eso land? 20:21:29 boring 20:58:53 -!- lament has changed nick to desafinado. 20:58:53 -!- Keymaker has quit (Read error: 54 (Connection reset by peer)). 22:42:29 -!- jix has quit ("Banned from network"). 2005-06-24: 00:00:26 -!- calamari_ has joined. 00:02:12 re's 00:12:54 -!- harkeyahh has joined. 00:18:36 CharServ STFU! 00:18:49 U r always on my case abotu something ChanServ 00:19:10 if you wanna serve me get me something to drink and then get down on your knees... 00:19:33 -!- calamari has quit (Read error: 110 (Connection timed out)). 00:25:12 harkeyahh: did you package arrive safely to Mumbai? 00:25:17 *your 00:25:38 oh, yes it did i meant to change the topic 00:26:36 -!- harkeyahh has set topic: Another brainfuck site (http://www.bf-hacks.org/) is open! ~ http://chriscoyne.com/cfdg/ ~ Esolang wiki: http://esolangs.org/wiki/ Thank you for your prayers my children. The package arrived safely into the arms of a 10,000 pound elephant.. 00:37:18 there has been confusion regarding turing-completeness of smallfuck 00:37:55 and the amount of available memory. 00:38:23 I made up my mind. Available memory is limited. Smallfuck is not turing-complete. 00:57:38 desafinado: on that topic, you might be interested in this: http://catseye.webhop.net/projects/sf2tab/src/sf2tab.c 00:57:46 it compiles smallfuck programs into lookup tables 01:05:35 hey that's cool 01:06:16 -!- heatsink has joined. 01:14:42 cpressey: hahaha 01:16:29 neat 02:40:02 -!- tokigun has quit ("Chatzilla 0.9.68.5 [Firefox 1.0.3/20050414]"). 02:58:10 -!- malaprop has quit ("bounce"). 03:14:42 -!- desafinado has changed nick to lament. 04:24:16 I added pages to the esowiki on Archway and Qdeql 04:43:11 -!- calamari_ has quit (Read error: 110 (Connection timed out)). 05:02:18 -!- heatsink has quit ("Leaving"). 05:39:15 -!- harkeyahh has quit ("Chatzilla 0.9.68.5 [Firefox 1.0.4/20050511]"). 07:59:59 -!- clog has quit (ended). 08:00:00 -!- clog has joined. 08:14:59 -!- pgimeno has joined. 08:31:08 -!- graue has quit (Read error: 110 (Connection timed out)). 11:36:33 -!- tokigun has joined. 11:36:43 hello 11:38:37 i've submitted three beer song program to 99-bottles-of-beer.net; one of them is already uploaded. 11:38:38 http://www.99-bottles-of-beer.net/language-whirl-761.html 12:18:41 nice work, tokigun 12:19:23 ;) 12:24:03 I've voted it as top-geek 12:33:33 nice work tokigun :) 12:51:06 thanks ;) 13:18:13 -!- malaprop has joined. 13:28:18 -!- jix has joined. 15:50:39 -!- jix has quit ("Banned from network"). 17:46:48 -!- calamari_ has joined. 17:46:53 hi 18:42:46 -!- graue has joined. 18:52:48 hello 18:55:22 -!- comet_11 has joined. 18:55:37 -!- CXI has quit (Read error: 104 (Connection reset by peer)). 18:55:56 -!- comet_11 has changed nick to CXI. 19:01:27 hi graue 19:08:33 -!- calamari_ has quit ("bbl"). 20:23:36 -!- graue has quit (Remote closed the connection). 20:36:28 -!- calamari has joined. 20:49:10 -!- graue has joined. 21:32:19 regraue 21:32:37 hello 21:54:03 -!- jix has joined. 21:59:01 -!- jix has quit ("Banned from network"). 22:08:53 <{^Raven^}> hi 22:15:07 hi raven 22:15:41 <{^Raven^}> how's things? 22:16:21 better now that I've taken my math test :) 22:16:52 <{^Raven^}> :) 22:17:55 I'm considering writing an adventure game.. need to see if my idea is feasible though. Of course an extra 8k of data storage helps a lot :) 22:18:22 <{^Raven^}> just 2.8k is suficcient for a large game 22:18:55 depends on how much time you spend compressing things 22:19:26 nothing in the rules says not to use the data file, so why not? hehe 22:19:35 <{^Raven^}> I enjoy squeezing every last byte out of code. optimisation is fun 22:20:13 oh, don't get me wrong.. it's just that if I limit myself to 2.8, it's not going to be the same game as 2+8k 22:20:38 still only 2k of code.. the 8k is for data 22:22:17 I need to write a quick assembler, though, so that I can use a compressed source format.. 2929 bytes of standard asm source code won't get me much 22:23:06 <{^Raven^}> last year assembler games were accepted without source code 22:23:13 I think that source rule is silly, though.. it's the binary that matters.. actually a lot of the rules are silly, it's all for the fun of it, I suppose 22:23:32 oic.. that makes things considerably easier 22:25:04 with 2k of code, I could probably write a semi-generic engine 22:25:22 <{^Raven^}> once that fits your game perfectly 22:25:56 <{^Raven^}> if you want to follow the rules as posted then a zip of your engine + your data file has to be under 2.7Kb and that's pretty impossible 22:26:20 <{^Raven^}> the organiser has not thought about the rules, think of them as general guidelines 22:26:36 <{^Raven^}> and there should be an OR clause between rules one and two 22:27:01 it was funny how he called it RAM, that makes no sense in the context 22:27:13 <{^Raven^}> the source code limit is for games written in BASIC or interpreted languages 22:27:42 <{^Raven^}> the executable code limit is for compiled/assembled games 22:29:23 <{^Raven^}> yeah, it implies that a UPXd EXE (!) when decompressed must be within the 2.79Kb [sic] limit 22:29:34 I should e-mail him to see what the actual rules are 22:30:33 <{^Raven^}> people have tried this year and last year to clarify them but to no avail. Good Luck! 22:31:01 raven: I think it'd be pretty hard for him to verify how much ram is being used 22:31:48 pretty much impossible without disasseming the source, on game systems such as the atari 5200 22:32:39 <{^Raven^}> yeah. I'm still strying to get the whole concept of a 1024-2048 byte game competition that allows entries up to almost 3K in size 22:34:41 not 3K 22:34:42 a lot more 22:34:56 i mean come on 22:34:57 <{^Raven^}> i meant only for the game object 22:35:01 8k is for "data" 22:35:06 what the fuck is "data" 22:35:11 maybe my "data" is Python code 22:35:15 exactly 22:35:18 <{^Raven^}> non-executed code 22:35:26 define "executed", eh 22:35:26 <{^Raven^}> *oops, non-executed stuff 22:35:39 define non-executed 22:35:44 an interpreter doesn't execute anything, it just looks at "data" and decides what to do 22:35:47 right? 22:35:52 <{^Raven^}> everything is data 22:35:56 exactly 22:35:58 everything is data. 22:36:58 of course for an interactive fiction game 22:37:08 you probably need much more "real data" than code 22:37:29 it might be possible to fit Scott Adams' engnine in 2k 22:37:41 and any scott adams' game fits easily (zipped) in 8k data 22:37:47 <{^Raven^}> easily, you could do it in much less 22:38:00 (which is exactly what i was planning to do for the competition :)) 22:38:38 <{^Raven^}> Previously I used my own custom data compression code rather than relying on any external libraries 22:40:06 <{^Raven^}> For this I would prefer to do the same to keep the 'game' as self contained as possible (not saying that I won't though) 22:41:32 wisdom from the dunric file: http://groups-beta.google.com/group/rec.games.video.classic/browse_thread/thread/5110daaa04a82c2c/0267f0dcc89cbaf5?q=rec.games.video.classic+dunric&rnum=8&hl=en#0267f0dcc89cbaf5 22:45:14 <{^Raven^}> Here is a "clarification" of the rules (at the bottom) http://groups-beta.google.com/group/rec.arts.int-fiction/browse_frm/thread/68e352749cb768ff/cc85e00f30ff941d?q=dunric&rnum=6&hl=en#cc85e00f30ff941d 22:45:49 <{^Raven^}> if accepted as true it allows for some major abuse of the rules 22:46:15 ha 22:46:21 he says you can use "TADS, Adrift, etc" 22:46:24 which also means inform 22:46:34 ha 22:47:01 <{^Raven^}> for instance you could write a *huge* generic game engine without any size limitations (the interpreter) 22:47:27 <{^Raven^}> the code (game logic) would have to fit in 2.83Kb which would allow for a huge amount of logic 22:47:44 <{^Raven^}> and all data (strings etc) would go in the 8Kb data file 22:48:21 <{^Raven^}> IMHO that's what dunrics clarification allows and that goes against what I feel to be the spirit of the competition 22:48:55 TADS, Adrift, Inform ARE "huge, generic game engines" 22:49:00 and what's better, you don't have to write them yourself. 22:50:18 <{^Raven^}> but it means that you could really submit anything, you can compress the logic (code) to fit within 2.83Kb and not suffer from the EXE/UPX clause in rule one 22:51:35 basically the rules of the competition are kinda dumb :) 22:51:45 <{^Raven^}> completely and utterly 22:51:47 he should have restricted them waay more 22:52:11 <{^Raven^}> this needs to be sorted out, the rules need to be revised 22:54:08 <{^Raven^}> My entry from last year was fully self contained at 2,803 bytes of BBC BASIC, it even ran on a BBC 22:57:07 <{^Raven^}> He states that the absolute maximum source size is 2.83Kb and later adds 'give or take a few hundred bytes' and gives a new limit of 2.86Kb 22:57:41 <{^Raven^}> no-one, to my knowledge has ever understood what dunric's rules mean 22:59:12 including him, I'd imagine.. where would 2.83k come from? not exactly a common file size :) 23:00:54 <{^Raven^}> ~2.831Kb = 2899 bytes. Since when are there only 1000 bytes in a kilobyte? Any programmer (aside form dunric!) should know this. 23:01:43 <{^Raven^}> and 2.83Kb is waaaay outside the 1Kb to 2Kb remit of the contest 23:01:54 it doesn't matter tho, in the end :) 23:02:43 <{^Raven^}> not really, but knowing the original reason why the competition started makes it seem silly 23:04:38 hmm, if I don't have an external data file, I'd better think harder about compression. Maybe perl? :) 23:05:54 <{^Raven^}> #defining common operations as macros would allow a good degree of compression. 23:06:15 I'm think more along the lines of text compression 23:07:06 -!- CXI has changed nick to test. 23:07:10 -!- test has changed nick to CXI. 23:07:20 <{^Raven^}> hmmm, the main problem is the trade off between the space gained by compression and the code size required for decompression 23:08:11 <{^Raven^}> finding an optimal or beneficial balance is difficult but possible if you limit yourself to only 2.83Kb for the entire game 23:16:47 it is possible to decompress in very little code, depending on the compression used. For example, dictionary compression 23:35:00 -!- KarlMarx has joined. 23:41:20 I've e-mailed him.. hopefully I'll get a response since we used to hang out online all the time 23:44:53 <{^Raven^}> what have you asked? 23:45:33 I asked for clarifications, and also offered alternate rules that made sense to us 23:46:02 <{^Raven^}> hmmm...i am doing the same (but not sent yet) 23:46:25 let me paste the rules I suggested to see if you agree 23:46:30 <{^Raven^}> please 23:46:50 1) The size of the unzipped game file may be no larger than 2048 bytes in 23:46:51 size, whether source or binary in nature. The internal details or methods 23:46:51 used in the binary or source file are unimportant (feel free to use UPX 23:46:51 compression, platform tricks, etc), so long as the game file itself is no 23:46:51 more than 2048 bytes in size. 23:46:53 2) External game engines or language interpreters may be used to run the 23:46:55 game, so long as it can be verified that the engine or language employed was 23:46:57 written prior to the contest starting date. 23:47:15 .. That was it :) 23:48:43 <{^Raven^}> very well pu calamari 23:49:50 he relied already, basically ignoring the rule suggestions 23:49:54 replied rather 23:50:10 <{^Raven^}> I would have suggested that the original 2899 byte limit be allowed for this year only 23:50:23 Perhaps you can suggest that 23:50:53 why was the limit set at 2899 bytes? 23:51:04 no idea.. absolutely none 23:51:09 <{^Raven^}> IMHO it's an interesting story 23:51:34 maybe a certain auto-adventure generator saves files of that size? 23:51:50 with the external data file 23:52:06 maybe so 23:52:10 seems VERY far fetched 23:52:15 <{^Raven^}> It may not be 'entirely' true, but it fits the events surrounding the announcement of the original competition last year 23:52:47 <{^Raven^}> Each year in the interactive-fiction community there is a competition called IF-Comp 23:53:27 <{^Raven^}> Dunric submitted his game B-Venture to the 2004 IF-Comp 23:53:40 yeah, I heard he placed last? 23:53:57 <{^Raven^}> his entry was disqualified because it broke the 'entries must not have been previously released' rule 23:54:06 haha 23:54:30 that sux.. so he probably made his own contest in spite? 23:54:30 <{^Raven^}> he discussed this fervently (to understate reality) with the organisers and community at large 23:54:49 <{^Raven^}> and yes, in spite he made his own competition 23:55:06 you know what I think would be really neat 23:55:09 <{^Raven^}> in his competition there were no rules to disallow previously released games 23:55:12 a modular music studio, using Brainfuck programs 23:55:31 effects would be programs that read samples on stdin and produce samples on stdout 23:55:49 <{^Raven^}> And B-Venture was 2,700(ish) bytes long, so he set a max code limit which was a little larger 23:56:03 heh 23:56:14 <{^Raven^}> This was part of the reason why the first competition was ignored by the IF community 23:56:19 graue: go for it! 23:56:46 the other part of the reason is probably because the vast majority of the IF community couldn't care less about "old-school" crappy games which fit in a few K 23:56:50 <{^Raven^}> graue: very nice idea 23:56:59 you could even get fancy and have wave in, wave out bookends 23:57:12 I am not familiar with the use of the term 'bookend' in this context 23:57:26 sorry, my lack of vocabulary 23:58:24 the idea is that you'd give a regaular wav file, it'd be decoded and sent to the next filter, which would only be dealing with a raw file, then after the last filter you'd feed the raw into the last program and it'd becomes a playable wav again 23:58:28 <{^Raven^}> lament: it's not that miniature masterpieces in general are crap, coding small elegant programs with a apurpose is a lost art. The quality of the works of certain authors (not mentioning names here) does leave a lot to be desired 23:58:47 {^Raven^}: it's an art the IF community isn't terribly interested in. 23:59:03 they have their own art to worry about 23:59:25 calamari, I guess so, but I was thinking the environment executing the programs would do that sort of coding 23:59:27 lament: maybe not, but it is interesting, nonetheless 23:59:39 graue: oic, that'd make sense 2005-06-25: 00:00:02 are there any portable mp3 players that are programmable? 00:00:20 yes 00:00:22 well 00:00:30 not officially 00:00:35 but unofficially, yes. 00:00:43 the ipod is one i believe? 00:00:47 iriver also 00:01:28 <{^Raven^}> ipod is definately programmable 00:02:34 <{^Raven^}> the thing is to work out how to do it. The only non-reprogrammable ones are implemented in pure-hardware which is not common 00:03:20 -!- heatsink has joined. 00:03:23 <{^Raven^}> calamari: I am going to point out to Dunric where the current rules can be abused 00:03:56 cool.. I gave him the 2899 + 8192 example, but that didn't seem to phase him 00:04:16 <{^Raven^}> calamari: can I use/paraphrase/steal your suggested rules (with due credit) 00:04:33 <{^Raven^}> calamari: am not sure about it as it would probably be better for it to seem completely independant 00:04:39 of course, and that'd be great too, because he'll be hearing the same thing again from someone new 00:05:18 <{^Raven^}> i am tempted to post it to as RFD to raif (rec.arts.int-fiction) 00:05:34 you won last year, mention that ;) 00:05:53 <{^Raven^}> :D 00:06:16 <{^Raven^}> That's a good idea 00:06:33 my wording can be improved.. I'm not the greatest writer, which kinda rules me out of serious IF, but this 2k stuff seems a bit different 00:06:46 <{^Raven^}> I am researching other 2Kb(ish) competitions to gather a common rule set 00:07:05 {^Raven^}: have you written any "normal" IF? 00:07:09 <{^Raven^}> My own writing can be pretty awful 00:08:05 <{^Raven^}> lament: yes, quite a lot, including games, game engines and IF development tools 00:09:04 <{^Raven^}> I used to be quite prolific in the late eighties and early ninties 00:09:08 wow 00:09:14 late eighties! 00:09:19 that's before inform isnt it 00:10:30 <{^Raven^}> Before Graham Nelson's Inform became widely used. I think that the original Infocom ZCode engine predates my original game 00:10:46 uhhhh 00:10:47 haha 00:10:50 of course it does 00:11:00 second IF game ever was written in it 00:12:54 the only text adventure I played of any length of time was called something like "leather goddesses of phobos". I don't remember what that title was about, and I never beat the game.. it was fun, though 00:13:21 that game is hard 00:13:45 it was big, I liked that 00:13:55 big games are intimidating :( 00:14:24 <{^Raven^}> I'm not sure about that since Colossal Cave was 1972ish and ZCode was 1979 00:14:44 well, real life beckons.. bbl 00:14:52 -!- calamari has quit ("<=K"). 00:15:13 <{^Raven^}> and Zork was originally written in MDL and released in 1977, but there has to be a wealth of IF in the intervening years 00:26:29 -!- calamari has joined. 00:26:37 yay, escaped back to eso and 00:26:45 land even 00:58:41 ehm, .... ok 00:58:43 i'm undecided now 00:59:17 having an 8K data file is really a lot of space. where's the challenge? 00:59:46 -!- tokigun has quit ("Chatzilla 0.9.68.5 [Firefox 1.0.3/20050414]"). 01:01:45 cpressey: choose not to use it :) 01:02:19 I was going to, but it's true.. there is no challenge that way 01:04:10 well... i mean, there still can be a challenge, but it's mostly the same as any other IF competition - just design and implement a good game. 10K is plenty of space to do that in, if you're any good at writing small code. 01:04:28 <{^Raven^}> cpressey: I am going to try to make the biggest and best game I can 01:04:30 i guess the thing is, i'm running out of ideas, before i've run out of space. heh 01:04:49 chris: i hear that :) 01:05:54 <{^Raven^}> A good programmer can do a lot in less than 2,899 bytes of code 01:06:11 <{^Raven^}> (Several complete operating systems were 2k or less) 01:06:42 came across this page, it's quite interesting: http://www.costik.com/nowords.html 01:07:26 <{^Raven^}> calamari: That title is so Harlan Elison 01:07:33 raven: generally those are they types of operating systems where you have to look up "error 231" in a separate manual :) 01:07:58 raven: who is that? 01:08:30 -!- KarlMarx has left (?). 01:10:06 <{^Raven^}> Harlan Ellison is an author of Science Fiction. 01:10:15 <{^Raven^}> (very good SF) 01:11:28 <{^Raven^}> The title of the Costik page refers to his short-story "I Have No Mouth And I Must Scream" 01:11:54 wtf 01:12:05 he refers to IF as "interactive fantasy" 01:12:30 calamari: there're much better articles on IF game design. 01:13:32 lament: cool.. I just came across this one.. it was really a sidenote as it seems to concentrate on other types of games more than IF.. I think he brings up some good points about what can make a game fun (or prevent it from being so) 01:13:35 for example this: http://www.inform-fiction.org/manual/html/ch8.html 01:13:40 if you have a few weeks to read it :) 01:14:07 <{^Raven^}> The IFWiki has a lot of useful information http://www.ifwiki.org/index.php/Main_Page 01:14:56 raven: so you're going for the whole 10k, then? 01:15:33 <{^Raven^}> calamari: It would be too easy for me to knock-up another game based on my original engine 01:16:32 <{^Raven^}> calamari: I am going for the full 10k because I want to see how far I can take the concept 01:18:21 <{^Raven^}> calamari: For me I feel that I have explored the 2k limit to my own logical ends, 01:19:01 <{^Raven^}> calamari: The 10k limit presents a really difficult challenge to overcome with what I am planning 01:28:35 btw, here is what I got the 2nd time around: The adventure game source file can be anywhere from 1 to 2.8k. It's still a 1-2k contest, in that entries (source code, anyway) will usually be 1-2k in size. The extra data file allowed (consisting of 8,192 bytes) makes 2k games playable to a larger extent, and in essence makes the games entered adventure game drivers, a la Scott Adams. 01:29:07 whatever scott adams is.. you'd probably know :) 01:31:05 <{^Raven^}> lament: Have we met on r*if? I am sure that I know you from elsewhere. 01:31:36 "usually be 1-2k in size" ??? 01:31:59 i would hazard to guess that if the limit is 2.8k, most entries would be, well, 2.8k in size :) 01:32:31 <{^Raven^}> cpressey: 2.83Kb is still 2Kb (if you're rounding down), but last year several entries were under 1Kb 01:33:43 yes... but two of those entries seemed more like jokes than serious entries to me 01:35:36 the thing is, i don't know what will score higher in the judging - good (i.e. playable) game or small game. 01:35:50 seems to me: good game 01:36:05 <{^Raven^}> that is what concerns me most is that there was only one reviewer and judge last year 01:36:07 (from last year, anyways) 01:37:00 <{^Raven^}> calamari: I think that it will be the same this year 01:37:17 aha, another response: VIC-20 text adventures used to require at least 3K of RAM expansion, and sometimes 8K. Some text adventures were written that barely fit into the 3,584 bytes of RAM afforded by an unexpanded VIC, but they were barely playable. That is why a "playable" text adventure needs at least 8K of data. 01:39:08 * cpressey shrugs 01:39:15 i'll just write something i like 01:39:21 yeah, sounds good 01:40:36 <{^Raven^}> cpressey: I have only ever written for myself, I don't believe that there is any other honest ay work 01:40:52 <{^Raven^}> *way to write 01:40:59 raven: for work 01:41:21 {^Raven^}: perhaps we have 01:41:32 although i haven't written any 01:42:38 the only thing i ever did for IF was some sort of language that compiled to Scott Adams' platform 01:42:46 and i never even released that 01:44:02 aha, http://www.ifwiki.org/index.php/Scott_Adams 01:44:05 :) 02:22:30 -!- heatsink has quit ("Leaving"). 02:29:22 * {^Raven^} if off to bed (to watch Highlander) 02:31:46 <{^Raven^}> goodnite peeps 02:58:08 -!- graue has left (?). 04:14:42 -!- watermellonz has joined. 04:14:54 -!- watermellonz has left (?). 04:22:50 -!- calamari has quit (Read error: 145 (Connection timed out)). 05:09:53 -!- malaprop has quit (brown.freenode.net irc.freenode.net). 05:09:57 -!- lindi- has quit (brown.freenode.net irc.freenode.net). 05:09:57 -!- puzzlet has quit (brown.freenode.net irc.freenode.net). 05:09:57 -!- fizzie has quit (brown.freenode.net irc.freenode.net). 05:09:57 -!- deltab has quit (brown.freenode.net irc.freenode.net). 05:09:57 -!- ChanServ has quit (brown.freenode.net irc.freenode.net). 05:09:58 -!- cpressey has quit (brown.freenode.net irc.freenode.net). 05:10:01 -!- {^Raven^} has quit (brown.freenode.net irc.freenode.net). 05:10:02 -!- CXI has quit (brown.freenode.net irc.freenode.net). 05:10:02 -!- pgimeno has quit (brown.freenode.net irc.freenode.net). 05:10:02 -!- cmeme has quit (brown.freenode.net irc.freenode.net). 05:10:02 -!- mtve has quit (brown.freenode.net irc.freenode.net). 05:10:04 -!- ZeroOne has quit (brown.freenode.net irc.freenode.net). 05:12:29 -!- ChanServ has joined. 05:12:29 -!- CXI has joined. 05:12:29 -!- malaprop has joined. 05:12:29 -!- pgimeno has joined. 05:12:29 -!- lindi- has joined. 05:12:29 -!- cpressey has joined. 05:12:29 -!- puzzlet has joined. 05:12:29 -!- fizzie has joined. 05:12:29 -!- deltab has joined. 05:12:29 -!- {^Raven^} has joined. 05:12:29 -!- cmeme has joined. 05:12:29 -!- ZeroOne has joined. 05:12:29 -!- mtve has joined. 05:12:29 -!- irc.freenode.net has set channel mode: +o ChanServ. 05:20:31 -!- malaprop has quit (brown.freenode.net irc.freenode.net). 05:20:36 -!- puzzlet has quit (brown.freenode.net irc.freenode.net). 05:20:36 -!- lindi- has quit (brown.freenode.net irc.freenode.net). 05:20:36 -!- fizzie has quit (brown.freenode.net irc.freenode.net). 05:20:36 -!- deltab has quit (brown.freenode.net irc.freenode.net). 05:20:36 -!- ChanServ has quit (brown.freenode.net irc.freenode.net). 05:20:37 -!- cpressey has quit (brown.freenode.net irc.freenode.net). 05:20:38 -!- {^Raven^} has quit (brown.freenode.net irc.freenode.net). 05:20:40 -!- pgimeno has quit (brown.freenode.net irc.freenode.net). 05:20:40 -!- mtve has quit (brown.freenode.net irc.freenode.net). 05:20:40 -!- cmeme has quit (brown.freenode.net irc.freenode.net). 05:20:40 -!- ZeroOne has quit (brown.freenode.net irc.freenode.net). 05:20:40 -!- CXI has quit (brown.freenode.net irc.freenode.net). 05:22:04 -!- ChanServ has joined. 05:22:04 -!- CXI has joined. 05:22:04 -!- malaprop has joined. 05:22:04 -!- pgimeno has joined. 05:22:04 -!- lindi- has joined. 05:22:04 -!- cpressey has joined. 05:22:04 -!- mtve has joined. 05:22:04 -!- ZeroOne has joined. 05:22:04 -!- cmeme has joined. 05:22:04 -!- {^Raven^} has joined. 05:22:04 -!- deltab has joined. 05:22:04 -!- fizzie has joined. 05:22:04 -!- puzzlet has joined. 05:22:04 -!- irc.freenode.net has set channel mode: +o ChanServ. 05:23:10 -!- malaprop has quit ("sleep"). 07:59:59 -!- clog has quit (ended). 08:00:00 -!- clog has joined. 10:30:32 -!- jix has joined. 12:09:12 -!- tokigun has joined. 12:27:18 -!- J|x has joined. 12:27:52 -!- jix has quit (Nick collision from services.). 12:27:54 -!- J|x has changed nick to jix. 14:18:26 -!- tokigun has quit (Read error: 104 (Connection reset by peer)). 14:21:04 -!- tokigun has joined. 19:01:25 -!- calamari has joined. 19:01:30 hi 19:06:46 moin calamari 19:15:18 hi jix, how's it going? 19:15:39 quite a few people are making games now, or at least planning to :) 19:16:24 <{^Raven^}> hi 19:16:34 hi raven 19:17:54 <{^Raven^}> calamari: I finally figured out the syntax of the BFBASIC BF command :) 19:18:06 haha.. not much syntax there to be found ;) 19:18:39 what did you need it for? needing that is generally a bad sign 19:18:59 <{^Raven^}> i dunno, it's nice writing otherwise pure brainfuck with just a few @myvar's scattered in 19:19:37 <{^Raven^}> looking at it for code optimisation mainly 19:19:42 oh, yeah.. didn't think of that! 19:20:38 <{^Raven^}> instead of myvar=2 using BF @myvar[-]++ 19:20:41 although I'm pretty sure I came up with the @ syntax, but who knows, my memory could be going 19:21:00 yeah.. it makes it a lot easier to see what is going on 19:21:03 <{^Raven^}> i like that the BF statement doesn't have any pre/post code around it 19:21:46 <{^Raven^}> are array elements supposed to be 2 cells wide? 19:21:49 of course.. then it wouldn't be raw. Although, it might have post code before it 19:21:56 yeah, 2 elements 19:22:07 cells, whatever :) 19:22:21 one is used for data, the other for movement 19:22:56 <{^Raven^}> ahh, i;'m not sure if it's me but BF @array(1)[-]@array(2) generates (>>>etc)[-]>[-] 19:23:11 <{^Raven^}> instead of (>>>etc)[-]>>[-] 19:23:18 there are 3 cells leading the array as well 19:23:37 x b a (or x a b), can't remember 19:24:32 I think I documented it somewhat on the wiki 19:26:28 iirc, the way it works is: 1) movement cells start off as 0's. 2) take element index we want to find, do [>>] which gives us an empty movement cell, increment it, do [<<] to get back, decrement the index, repeat until index =0.. so now the movement cells are populated with 1's, and we can do something like [>>]< or [>>]> to get to the data cell 19:27:01 3) transwer the data with a simple add loop, using [>>] and [<<] instead of > <.. 19:27:04 <{^Raven^}> do arrays have a zeroth cell? 19:27:22 of course there are all the fine details that go along with getting it right, but that's the basic idea of how it works 19:27:24 yeah 19:28:01 I'd check the 0 cell, 1 cell, and max cell, max-1, max+1 19:28:09 err cell -> element 19:28:19 just to make sure everything is working as expected 19:28:35 it's likely that one of those is where the bug is 19:29:08 * calamari has been having fun researching his game 19:29:15 <{^Raven^}> yeah, I am getting the impression that arrays are not always contigous 19:29:35 <{^Raven^}> i will play with using BF to simplify tracking 19:29:44 it's possible that a movement cell is not getting cleared out and it's going off to lala land 19:30:27 I have my bit debugger pretty close to done.. I should do a bf version, since I like the interface 19:30:57 that would make this sort of thing a LOT easier to debug, than trying to do it by hand 19:34:04 I'd be done with the bit debigger already, but I ran into a problem the other day.. if the program was running, I couldn't stop it, because it was using the same thread as Swing. I could use multiple threads, but I lose a bit of control, and can't do certain things. But, the other night I realized that I could just use step, and a special runnign flag, so the view knows when the model is done running. 19:34:29 That way it's all in one thread, and it'll be cool because you'd see the highlighted instruction moving as it ran 19:34:56 It also makes possible the Pass button (for running iuntil a loop is done) 19:35:14 so anyhow, yeah.. it is almost done, just got caught up in this adventure game stuff :) 19:35:27 I need to get to other work tho.. so afk 19:37:03 <{^Raven^}> have fun 19:55:34 * {^Raven^} is playing with a version of BFBSAIC that doesn't expand @var's into arrows 19:56:39 * calamari is doing dishonest programming.. or whatever it was you called it the other day :) 21:18:37 -!- calamari has quit ("bbl"). 22:14:12 -!- J|x has joined. 22:26:18 -!- jix has quit (Read error: 110 (Connection timed out)). 22:49:21 -!- Keymaker has joined. 22:49:32 'ello 22:59:40 are anybody here? 23:00:54 -!- ChanServ has quit (Shutting Down). 23:01:20 -!- ChanServ has joined. 23:01:20 -!- irc.freenode.net has set channel mode: +o ChanServ. 23:05:34 -!- J|x has changed nick to jix. 23:05:45 Keymaker: me is here 23:08:10 me sees now 23:16:17 * {^Raven^} is vauguely around 23:24:01 :) 23:44:59 -!- tokigun has quit ("Chatzilla 0.9.68.5 [Firefox 1.0.3/20050414]"). 23:45:05 d'oh!!!!!! 23:45:12 i was just writing a question for tokigun 23:45:23 well, anyways, maybe someone other knows.. 23:45:48 so, does a whirl program start from the beginning again if there is no 'terminate program' instruction? 23:51:01 -!- Keymaker has quit ("I've seen this déjà vu before.."). 2005-06-26: 01:37:41 I don't think so, Keymaker, but you can always try how the reference interpreter works. 02:10:01 i'm writing 99 bottles in lazy-k 03:36:08 -!- jix has quit ("Banned from network"). 03:38:41 -!- calamari has joined. 03:38:43 hi 03:39:30 I just noticed that the latest wiki dump I downloaded was smaller than the last dump... is that logical? 04:15:18 bbl 04:15:19 -!- calamari has quit ("Leaving"). 04:37:54 -!- mickoko has joined. 04:38:36 -!- mickoko has left (?). 06:47:14 -!- calamari has joined. 06:57:39 hi 07:59:59 -!- clog has quit (ended). 08:00:00 -!- clog has joined. 08:14:19 -!- BigZaphod has joined. 08:23:31 hi zaphod 08:27:12 hey 08:33:26 This is my first time here. :) 08:34:42 welcome 08:34:55 did you find us from the wiki? :) 08:37:50 Yes. Actually, in a rather round-about way. I was googling one of my own languages Whirl. 08:37:55 Found references to here. :) 08:38:23 hehe 09:45:05 -!- calamari has quit ("Leaving"). 09:52:49 <{^Raven^}> hi 10:45:49 -!- jix has joined. 11:00:25 -!- Keymaker has joined. 11:01:04 hmm 11:01:44 bigzaphod.. whirl inventor? 11:03:23 -!- tokigun has joined. 11:04:22 tokigun! 11:04:32 i've a question 11:04:45 hello 11:04:51 hi 11:05:10 hmm 11:05:22 eh... what is your question? 11:05:28 oh 11:05:33 sorry :) wait a bit 11:05:38 ;) 11:05:56 yesterday i was asking here that do whirl programs require that terminate instruction 11:06:02 but i guess they don't 11:06:17 yes terminate instruction is not required 11:06:27 but i added it for complete program 11:06:32 yeah 11:06:40 in case of beer song ;) 11:06:49 yeah 11:06:52 anyways; 11:06:53 1100 11:06:53 00 11:06:53 111100 11:06:59 why doesn't that program work? 11:07:03 it should print 0 11:07:20 hmm 11:07:28 1100 -- op::one 11:07:31 00 -- math::noop 11:07:40 111100 -- op::padd 11:08:08 if you want to print 0 use op::intio instruction instead. 11:08:12 hmm.. there must be then something wrong the way i thought 11:08:20 i thought it did: 11:08:55 11 move to One 00 execute it, change ring 11:09:01 yes 11:09:03 00 NOP, change ring 11:09:16 1111 move to IntIO 11:09:19 hmm 11:09:21 00 execute it 11:09:40 Keymaker: you have to use 0111100 instead of 111100 11:09:48 nope 11:10:01 ah 11:10:07 sorry, i read "have you used" 11:10:09 :) 11:10:11 ;) 11:10:30 but 11:10:43 doesn't the direction of ring stay when you switch it? 11:10:47 when 111100 is executed, it selects 6th (not -2th == 10th) instruction 11:10:59 hmm 11:11:13 0 changes the direction of ring 11:11:22 but i thought the first line "1100" 11:11:28 changes it to anticlockwise 11:11:36 00 changes the direction of ring twice, executes the selected instruction, and so on.. 11:11:43 ah 11:11:54 no. it changes the direction "twice". 11:12:02 so the direction changes every time there is 0 11:12:03 ah 11:12:05 yes ;) 11:12:54 ah this clears it. i thought the direction doesn't change if the zero executes instruction :) 11:12:58 well, now i can go and fix this 11:13:06 hehe 11:13:36 i've returned home... good :) 11:13:42 :) 11:13:53 now the program works 11:13:56 it prints 0 11:13:58 nice 11:13:59 :D 11:14:18 i'll make it print unix new-line as well 11:14:29 btw, i'm using your c interpreter. it's great 11:18:19 haha... 11:18:34 it doesn't have debugger, though ;) 11:18:51 yeah, something option showing memory states would be useful 11:19:44 question; 11:20:07 if there is a jump where the instruction pointer is moved.. what if it goes outside the program? 11:20:12 should the program end? 11:20:31 as well, does whirl support negative numbers? that jump to left and right can be done? 11:22:45 hmm 11:22:55 first whirl supports negative numbers 11:23:07 ok 11:23:08 so you can move memory pointer left or right 11:23:14 ok 11:23:23 but what about the jump outside the program? 11:23:27 hmm 11:24:19 my interpreter can handle it.. but maybe it is user-defineded. 11:24:23 s/eded/ed/ 11:25:02 hmm 11:25:11 the author *cough bigzaphod* should clear some things on the web site.. 11:25:17 :) 11:25:19 :) 11:25:41 wait a moment 11:26:37 in this case, his interpreter terminates immediately. 11:26:46 ok 11:26:51 terminates program 11:26:54 ok 11:27:12 and my interpreter terminates program when memory pointer > program upper bound, 11:27:30 and return to first instruction when memory pointer < program lower bound (that is origin) 11:27:48 ok 11:28:55 -!- tokigun has changed nick to tokigun^away. 11:36:11 i can't understand english. does "Sets value to memval." mean that 'value' gets the value of 'memval'? 11:46:37 tokigun: bigzaphod is here 12:01:50 -!- tokigun^away has changed nick to tokigun. 12:01:53 back 12:01:56 puzzlet: oh. 12:11:51 -!- Keymaker has left (?). 12:30:23 -!- J|x has joined. 12:31:03 -!- jix has quit (Nick collision from services.). 12:31:05 -!- J|x has changed nick to jix. 12:31:47 my 99bob in lazy k is done 12:32:41 it's about the size of the whirl 99bob .. and has the same obfuscation amount 12:59:27 * {^Raven^} ponders orthogonal 8-bit RISC processor design and layout of 16-bit opcodes 13:37:18 -!- hashendgame has joined. 15:20:36 * {^Raven^} finished pondering orthoganal processor design 15:27:50 -!- Kmkr has joined. 15:28:50 'ello 15:28:56 <{^Raven^}> hi there 15:28:57 couldn't use name Keymaker 15:29:08 this thing said it was token 15:29:32 jix: sounds really cool 15:29:38 can't wait to see the program 15:30:04 <{^Raven^}> kmkr: have you done /whois keymaker 15:30:09 no 15:30:40 hmm, seems to be some french dude 15:31:03 <{^Raven^}> i recommend that you register Keymaker at the next opportunity 15:31:20 he has probably registered it already 15:31:56 as well, i didn't feel like trying to register it, since that system was strange. i couldn't use it 15:42:08 <{^Raven^}> i'v had enough of enough brainfuck for the moment, gonna take a break 15:44:40 :) 15:53:35 -!- hashendgame has quit ("Leaving"). 15:53:40 hmm 15:53:56 can one send another version for some language to that 99 bottles of beer list? 15:54:09 if i remember correct i've seen some language have several versions 15:54:32 perl for example 17:04:33 Hey tokigun. Nice to finally "meet" the world's best whirl programmer. :) 17:22:46 -!- tokigun has quit (Read error: 110 (Connection timed out)). 18:07:41 Kmkr: http://rafb.net/paste/results/hExqvL26.html 18:08:23 nice :) can't understand anything 18:08:50 the first part is the scheme-like code.. the 2nd part is se lazy k code 18:09:16 and i think you can't understand anything in the whirl 99bob 18:12:40 me? in whirl it's possible but takes time :) 18:13:25 well, here is the boring 99bob in c i made: 18:13:26 #include /* written by Keymaker :) */ 18:13:26 int main(){int a[9]={0,1,2,0,2,3,0,1,2},b=99,c;while(b>0){for(c=0;c<9;c++){ 18:13:26 if(a[c]==0){if(b==0){printf("no more");}else{printf("%i",b);}printf(" bottle"); 18:13:26 if(b!=1){printf("s");}printf(" of beer");}if(a[c]==1){printf(" on the wall");} 18:13:26 if(a[c]==2){if(c==2){printf(", ");}else{printf(".\n");}}if(a[c]==3){ 18:13:27 printf("Take one down and pass it around, ");b--;}}printf("\n");}} 18:14:03 i don't submit it to 99-bottles-of-beer, since i just noticed ther reads they don't want anymore c examples of the program 18:15:01 Kmkr: if you take a look at the first part (the non-compiled version) it's even easier to understand as the whirl code 18:15:59 yes 18:24:47 i think it's fun writing BASIC => Esolang converters 18:24:58 never tried :) 18:25:15 i didn't but i think it's fun 18:25:29 extra fun when you write the converter in the esolang 18:26:32 hehe 18:27:23 i think i'll write a new version of my beer.b 18:28:01 there's 1003 ways to get it shorter 18:30:31 must go. 18:30:33 -!- Kmkr has left (?). 20:00:30 3code 99 bottles: http://www.bigzaphod.org/3code/bigzaphod-99bottles.txt 20:00:36 not terribly impressive, but it was fun. 21:42:36 -!- calamari has joined. 21:42:39 hi 21:45:02 jix: bitdebug 1.00 is ready: http://kidsquid.com/programs/bf/bf.html 21:45:27 let me know which bugs you find :) 21:48:53 <{^Raven^}> hi calamari 21:53:46 hi raven 21:53:53 working on the bf port of that debugger :) 21:54:22 <{^Raven^}> working on a BF related project myself 21:54:25 if there's anything about the bit one that needs fixing, let me know so I can put it in the bf version 22:12:30 wow, that was easier than I thought 22:13:15 Only thing left is allow clicking memory to change it.. was easier with bits because it could just flip.. will need a dialog this time, though :) 22:15:54 -!- BigZaphod has quit. 22:15:55 and its way slow because of all the graphics.. not great for running programs.. just debugging them 22:31:58 raven: check it out, http://kidsquid.com/programs/bf/bf.html 22:32:35 <{^Raven^}> will do, am hitting BFBASIC bugs right now 22:32:38 I should put my array code in and test it 22:32:41 cool 22:33:23 <{^Raven^}> array(var)=array(var2)+var3 (or -var3) does not work 22:37:52 <{^Raven^}> calamari: default file mask for file>open could be *.b;*.bf 22:38:23 <{^Raven^}> calamari: input box does not seem to accept input in range 00-FF 22:40:01 really? it should accept any decimal 22:40:31 unless you mean the input tab? 22:40:43 <{^Raven^}> the input tab 22:40:54 <{^Raven^}> seems limited to printable characters 22:42:38 hmm yeah.. probably is, unless it's pasted in 22:42:55 <{^Raven^}> even when pasted. 22:43:57 <{^Raven^}> test code starts [.] debugger cannot get past that. skipped to [-] and it gets stuck there too even though cell is set to 0 22:44:48 -!- jix has quit ("Banned from network"). 22:45:15 I don't follow you on that last bug report 22:45:33 if you're changing the program in the middle of a run, that could cause problems 22:45:44 <{^Raven^}> BF debugger cannot leave a loop 22:46:34 that'd be weird, because I was able to run the standard hellow world type stuff, the triangle, etc 22:47:06 <{^Raven^}> is file>open supposed to load the code into the program tab? it is not doing that here 22:47:15 yeah, it's supposed to 22:47:15 -!- heatsink has joined. 22:47:43 so much for write once run anywhere :/ 22:48:02 you didn't write it in java, DID YOU? 22:48:08 ;p 22:48:12 hehe 22:48:26 <{^Raven^}> ok, gonna stop using the evil OS now 22:48:57 oh, were you trying it in windows? 22:49:09 <{^Raven^}> do you know how I can start your program from a unix shell (to load it on X-Windows) 22:49:12 <{^Raven^}> I was 22:49:21 java -jar filename.jar 22:50:04 <{^Raven^}> hmmm, gotta be doing it wrong, that command gives me a pile of exception errors 22:50:13 nice 22:50:18 -!- cmeme has quit (Read error: 104 (Connection reset by peer)). 22:50:37 nice, more programs to try.. 22:50:41 * calamari tries it .. works here.. I'm runnign 1.5 tho 22:51:30 -!- cmeme has joined. 22:51:46 <{^Raven^}> using gij 3.2.3 here 22:51:49 -!- cmeme has quit (Remote closed the connection). 22:52:31 -!- cmeme has joined. 22:53:13 {^Raven^}: great. i'm using jamvm 1.3.0 with gnu classpath cvs head 22:53:33 * {^Raven^} has never been any good at getting 'real' java installed on his server and uses the default GNU version instead 22:55:36 * calamari just downloaded it from sun.. didn't even use those fancy installer script thingys 22:55:41 {^Raven^}: very nice, let me know if you see any bugs so i can test them with the latest version 22:57:16 <{^Raven^}> lindi: bfdebug-100 won't even run on my gij...and it dosn't work as expected using sun java on Windows 22:57:23 seems i've reported 25 bugs during the last 37 days :) 22:57:59 raven: really weird that it doesn't work on windows, since I'm not really doing anything nonstandard this time 22:58:14 {^Raven^}: gij-3.3 is quite old in that respect, a lot has happened to swing after that 22:58:25 calamari: are you sure? ;) 22:58:55 lindi: lol.. I think it's impossible to say for sure 22:58:59 * {^Raven^} goes to download sun java (and hopes it doesn't break anything) 22:59:10 calamari: esoshell had some nice gems, like this one: https://savannah.gnu.org/bugs/?func=detailitem&item_id=13254 22:59:26 esoshell was definitely doing some nonstandard stuff 22:59:33 <{^Raven^}> calamari: I've got a really nice BFBASIC program in the making 22:59:40 I was overriding swing methods, etc 23:00:18 raven: cool, basic program, or bfbasic java program? 23:00:50 calamari: anyways, those swing programs are really create testcases for improving gnu classpath 23:00:55 <{^Raven^}> basic program 23:02:33 <{^Raven^}> i am finding more bugs in BFBASIC but nothing I have been able to solve 23:02:36 adventure game, or something new? spill it ;) 23:02:43 <{^Raven^}> ok... 23:02:44 thanks for fixing on bfbasic 23:02:55 be sure to commit to the cvs repos :) 23:03:16 <{^Raven^}> i will do if I ever manage to work out how to fix any bugs 23:03:36 * {^Raven^} doesn't know java 23:03:51 {^Raven^}: what OS are you using btw? 23:03:56 * calamari doesn't know Java either, apparently 23:04:44 <{^Raven^}> lindi-: what for? I am using RISC OS, Linux (Whitebox RHEL3.0) and WinXP Pro interchangably atm 23:05:26 {^Raven^}: fedora core 4 comes with a large collection of java programs compiled with gcj 23:05:39 {^Raven^}: and on debian you could just apt-get install free-java-sdk 23:06:10 <{^Raven^}> lindi-: I need to find an rpm / other installer 23:06:28 hmm, for what? 23:06:42 sun's proprietary stuff? 23:06:48 * {^Raven^} often writes software on RISC OS, compiles it on Unix and runs it on Windows (and any variation thereof) 23:07:26 <{^Raven^}> I need a more recent java+SDK that will just install and work, any suggestions 23:07:27 i wish i knew brainfuck more so i could test this bfdebug better 23:08:17 {^Raven^}: i can recommend jamvm if you want to help out in testing gnu classpath 23:09:21 * calamari should do that 23:09:49 I could never contribute, though.. because I've looked at all kinds of sun code trying to figure out things 23:10:00 you can contribute by testing 23:10:49 <{^Raven^}> calamari: My program is an emulator for an 8-bit RISC CPU 23:10:56 coolness 23:11:10 bet that's slow :P 23:12:25 <{^Raven^}> not really slow, Hello World runs in less than a second 23:13:08 <{^Raven^}> I want to see if a RISC CPU with an orthoganl instruction set can be emulated by brainfuck 23:13:57 calamari: Interpreter.java has _memory.add(Integer.valueOf(0)); but there's no such method valueOf(int) in Integer 23:14:14 lindi: that must be 1.5 23:14:17 there's only valueOf(String s) and valueOf(String s, int radix) 23:14:21 err wait 23:14:37 * calamari checks his java book 23:15:01 I wanted Integer.getInteger 23:15:17 but valueOf is a method 23:15:22 still, i want to sort this out. where is valueOf(int) documented? 23:15:45 one sec, I'll check it out for ya 23:16:15 1.5.. checked the sun source 23:16:28 it's part of all that int wrapper crap 23:16:33 /clear 23:16:39 better not paste it here :) 23:16:46 not gonna paste anything 23:16:56 but is there any public documentation on that one? 23:17:24 is the javadoc from the code considered public? 23:17:49 no, not from the code 23:18:04 but if sun has published it in a book or on their web page, then yes 23:18:12 yeah, let me find it ;) 23:18:51 I have the feeling I know exactly what to search for hehe 23:19:00 ah, found it 23:19:41 http://java.sun.com/j2se/1.5.0/docs/api/java/lang/Integer.html 23:19:54 yeah, that's what i found 23:20:10 i'll write some quick'and'dirty version and check if it works 23:20:56 are you going to handle the caching? 23:21:36 not sure how it should be done, i'll ask on #classpath 23:25:51 hmm actually I needed new Integer(i) to replace it :) 23:26:26 raven: probably explains why it wasn't working in windows :) 23:26:41 wonder if I'm using any other 1.5 code.. wish there was an easy way to find out 23:27:44 i thought there was 23:27:57 some kind of tool that'll tell me? 23:28:06 I'll ask in #java 23:28:27 -!- Kmkr has joined. 23:29:15 hi 23:29:28 sounds like an interesting project raven 23:29:28 <{^Raven^}> kmkr: the french dude(tte) has logged off 23:29:37 ah 23:29:40 -!- Kmkr has changed nick to Keymaker. 23:29:43 <{^Raven^}> :) 23:30:04 <{^Raven^}> Keymaker: it is. I just wanted to see if it was possible and it most definately can be done 23:30:19 yeah, everything can be done with brainfuck!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! 23:30:24 <{^Raven^}> hello world works perfectly 23:30:39 what is that orthagonal or something instruction set? 23:30:47 and what the hello world looks like in that? 23:32:12 <{^Raven^}> the simple version is (in assembler) just MOV r0,#72:OUT r0:MOV r0,#101:OUT r0:etc:RET 23:32:38 ah 23:33:03 <{^Raven^}> each instruction is assembled to a 16-bit word by a seperate program, the object code is loaded and executed by the emulated CPU 23:34:30 <{^Raven^}> it's only 36Kb of brainfuck (compiled BFBASIC) so far 23:34:43 :) 23:34:56 calamari: turns out that there is already valueOf(int) but it's in a separate branch that targets 1.5 23:36:14 <{^Raven^}> keymaker: In computer science, an instruction set is said to be orthogonal if any instruction can use any register in any addressing mode. 23:36:40 ok 23:36:51 calamari: here, http://paste.debian.net/897 23:39:51 interesting.. sun's is shorter, but the gnu one is easier to understand :) 23:42:23 MIN_CACHE and MAX_CACHE are -128 and 127 btw 23:43:18 calamari: < dalibor> a brainfuck debugger! < dalibor> we should ship that instead of jdb in kaffe < Sven_M> lindi-: Oh, well I can see how this is terribly useful. =) 23:43:37 lol 23:53:42 * {^Raven^} has installed sun java 1.5.0, put it in the $PATH before libgcj but libgcj is still being used instead 23:55:21 -!- BigZaphod has joined. 23:55:24 {^Raven^}: redhat has 'java' as a symlink to 'gij'? 23:56:00 <{^Raven^}> yes, but it is later in the path than sun java 23:56:04 <{^Raven^}> *run path 23:58:51 ./java 23:59:05 <{^Raven^}> got it working now 23:59:35 <{^Raven^}> bfdebug is running as you described 23:59:36 I really like the look of 1.5 Swing 2005-06-27: 00:01:12 <{^Raven^}> yup, it was Windows/sun java1.4.2 that was broken 00:01:38 because of the 1.5 method call I was using 00:02:00 <{^Raven^}> can't we blame windows just a little? ;) 00:02:16 nah.. I bet it was spewing all sorts of errors to the console 00:02:28 but if the console isn't visible.. well :) 00:02:42 works fine in windows using 1.5 00:02:50 (just tested via qemu) 00:03:00 <{^Raven^}> that's good to know 00:03:21 segfaults jamvm in some mysterious way 00:03:41 but it only happens after it has looped for a long time in bf code 00:09:52 <{^Raven^}> calamari: very nice program 00:11:03 <{^Raven^}> calamari: what is the cell width in the debugger? are cells supposed to be able to hold -ve numbers? 00:11:37 what means '-ve'? 00:11:52 <{^Raven^}> negative, and +ve is positive 00:12:03 ah :) 00:12:26 i saw that same thing today somewhere else but couldn't realize what it meant.. i see now 00:12:28 -!- graue has joined. 00:13:13 raven: thanks :) int sized cells 00:13:25 I should provide an 8-bit option, shouldn't I 00:14:03 (8, 16, int) 00:14:08 <{^Raven^}> definately 00:14:29 will do.. working on it anyways (to allow *.bf, fixed the 1.5 bug) 00:14:42 can you paste non-char text into the input box now? 00:15:29 <{^Raven^}> yes, but I am not sure if it's correct 00:15:52 it should be using unicode 00:16:11 (that's why ints were convienient) 00:16:25 <{^Raven^}> how about File>LoadInput to load a file into the input tab? 00:18:58 do you want to save as well? 00:19:20 of course you do :) 00:19:34 <{^Raven^}> it makes sense to be able to 00:25:13 <{^Raven^}> lindi-: hey, this Sun Java is waaaaaa(etc)ay faster than libgcj 00:31:32 -!- Keymaker has left (?). 00:35:20 brb 00:35:21 -!- calamari has quit ("Leaving"). 00:37:14 -!- calamari has joined. 00:41:11 <{^Raven^}> calamari: I have hit a brick wall with the emulator, array bugs that cannot be kludged :(( 00:42:21 okay 00:42:31 * {^Raven^} wishes he knew java well enough to fix all these 00:42:43 I have a few more of those features to add ;) 00:42:58 then I'll check out the array code 00:43:34 <{^Raven^}> thx, I really hate to keep bugging you about BFBASIC, esp since you have a life and all 00:44:44 haha, I have a life? 00:46:18 <{^Raven^}> or is it an occupational hazard for all of us programmer types? 01:01:51 got the load/save done, now working on bit width 01:10:57 -!- tokigun has joined. 01:11:17 ã…—ì œì˜�ã…� 01:11:19 oops 01:11:27 anyway hello ;) 01:11:48 <{^Raven^}> hi 01:12:47 hey 01:15:25 BigZaphod: hello ;) 01:15:55 tokigun: good to "see" you :) 01:16:05 haha... 01:16:08 :) 01:16:32 your 99 bottles is #2 on the 99 bottles of beer site. ;) good stuff. 01:16:56 thanks. 01:21:05 BigZaphod: i've submitted more 99 bob programs... :) 01:21:16 http://www.99-bottles-of-beer.net/language-r4-script-762.html and http://www.99-bottles-of-beer.net/language-windows-nt-batch-763.html 01:22:36 I saw those in the recently added list on the site. :) 01:23:23 had never heard of R4 before. 01:26:30 r4 is visualization software that provides custom scenes, network interfaces, and so forth. 01:26:58 (usually i used r4 visualization plugin for r4) 01:27:03 oops, for winamp* 01:28:22 i'm thinking about 99 bob program in Piet, Gammaplex, RUBE, Aheui. :) 01:29:11 * {^Raven^} is thinking about a spoon / whirl polyglot (just thinking tho) 01:29:48 tokigun: those would be fun to see... 01:30:30 {^Raven^}: whirl polyglot? :) 01:30:48 you mean whirl-c polyglot? 01:31:10 <{^Raven^}> tokigun: i mean a whirl-spoon polyglot 01:31:17 ah... 01:31:40 i see. i didn't see "spoon". :) 01:33:21 <{^Raven^}> i'd guess it would be impossible to do anything meaningful 01:46:32 write a program that generates a whirl-spoon polyglot for you 01:55:38 <{^Raven^}> g'nite peeps 02:00:30 -!- graue has left (?). 02:48:28 -!- heatsink has quit ("Leaving"). 03:15:47 -!- puzzlet has quit (Read error: 54 (Connection reset by peer)). 03:20:17 -!- puzzlet has joined. 03:53:43 -!- BigZaphod has quit. 04:25:39 -!- BigZaphod has joined. 05:15:23 {^Raven^}: you compared it to gij? ;) gcj should be bit closer 05:23:55 -!- calamari has quit (Read error: 60 (Operation timed out)). 05:31:54 -!- graue has joined. 06:02:03 -!- graue has quit. 06:12:15 -!- calamari has joined. 06:12:21 re's 07:59:59 -!- clog has quit (ended). 08:00:00 -!- clog has joined. 08:37:39 -!- entri has joined. 08:39:44 yo 08:46:37 hi entri 08:53:09 -!- entri has quit. 08:56:17 raven: got the new version done: http://kidsquid.com/programs/bf/bf.html 08:57:02 raven: I realized I'm setting EOF = 0, but it'd probably be nice to make than an option (0, max value, unchanged).. too tired to do it now, though 08:58:04 you'll notice a blue marker (and magenta when blue and red overlap).. this is the highest memory cell accessed. Useful for bf golf contests ;) 08:58:19 anyhow.. night 08:58:38 -!- calamari has quit ("<=K"). 12:30:38 <{^Raven^}> calamari: I'll take a peek 12:30:49 <{^Raven^}> morning to all the peeps 13:29:14 <{^Raven^}> anyone around? 13:30:22 <{^Raven^}> I need some inspiration for the name of a project I'm working on (currently called !:) 13:39:58 -!- malaprop has joined. 13:50:03 -!- tokigun has quit ("Chatzilla 0.9.68.5 [Firefox 1.0.3/20050414]"). 13:56:39 -!- jix has joined. 13:57:05 moin 14:03:03 sometimes what is esoteric is the usage of a language rather than the language itself... http://www.unidex.com/turing/utm.htm 14:08:34 <{^Raven^}> pgimeno: thx, i like that 14:09:16 np, enjoy 14:15:26 <{^Raven^}> There seems to be a requirement that all existant UTMs/FSMs must have hellow, 99bobb amd rot13 implemented 14:16:02 <{^Raven^}> The holy trinity (sic) of example programs :) 15:35:27 it's ever so comforting to know that your text processing tools are subject to the halting problem 15:54:59 the 'cur' and 'last' links in the wiki history pages don't seem to be working. they don't take me to diffs, they just take me back to the article page. 15:57:25 which page, cpressey? it works for me 15:58:30 pgimeno: i was trying on the smallfuck history page 15:58:55 oh sorry 15:58:59 it does work 15:59:18 it just links down to the bottom ('preview') part of the diff, which looks just like the main article 15:59:26 oh, I see 15:59:26 i had to scroll up to notice the difference 15:59:51 yup 16:17:09 -!- CXI has changed nick to test. 16:17:11 -!- test has changed nick to CXI. 16:37:28 Keymaker: why is bf-hacks.org down? 16:38:11 -!- CXI has quit (Read error: 104 (Connection reset by peer)). 16:38:31 -!- CXI has joined. 16:41:34 -!- CXI has quit (Client Quit). 16:42:51 -!- CXI has joined. 16:42:55 -!- CXI has quit (Read error: 104 (Connection reset by peer)). 16:43:34 -!- CXI has joined. 16:43:53 -!- CXI has quit (Client Quit). 16:44:00 -!- CXI has joined. 17:21:10 -!- BigZaphod has quit. 17:22:29 -!- calamari has joined. 17:22:32 hi 17:23:02 -!- calamari has quit (Remote closed the connection). 18:01:25 -!- BigZaphod has joined. 18:18:47 -!- calamari has joined. 18:18:50 hi 18:19:00 -!- calamari has quit (Remote closed the connection). 18:26:46 -!- calamari has joined. 18:26:49 blah... 18:34:37 -!- J|x has joined. 18:43:48 -!- jix has quit (Read error: 110 (Connection timed out)). 18:49:00 -!- J|x has changed nick to jix. 18:49:06 -!- jix has left (?). 18:49:11 -!- jix has joined. 18:49:14 wrong key 18:54:44 hi jix 18:55:04 I put that bit debugger online, dunno if you saw my announcement on that 18:55:23 http://kidsquid.com/programs/bf/bf.html 18:55:59 I've made some improvements to the bf version that I need to backport to the bit version 18:56:10 bbl.. class 18:56:12 -!- calamari has quit ("Leaving"). 18:56:15 <{^Raven^}> calamari: have had it running a test program for 5 hours and all is well 19:56:36 -!- J|x has joined. 20:12:06 -!- jix has quit (Read error: 110 (Connection timed out)). 20:18:06 -!- J|x has changed nick to jix. 21:14:02 -!- calamari has joined. 21:14:18 hi 21:15:33 <{^Raven^}> calamari: I have been running your debugger through a test cycle for the last 8 hours and all is well 21:15:34 raven: glad to hear it.. sorry it's taking so long to run a program, though :) 21:16:02 maybe there should be a fast run button where it just goes for it without all the updating 21:16:47 I haven't had a chance to put my array code on the bench and check it out.. 21:16:53 <{^Raven^}> maybe one option would run until the next ',' 21:17:21 <{^Raven^}> but an occasional window refresh would be good 21:17:40 also, I realized my Pass button isn't right.. it stops on ], but it should actually run until the loop is complete 21:18:29 so there can be more options :) 21:18:31 <{^Raven^}> Maybe File>SaveInput could be changed to File>SaveOutput as loading input and saving output seems more logical 21:18:45 I was looking into making a toolbar for them, but didn't want to get sidetracked 21:19:04 do you need to have the output of a program run? 21:19:35 I figured that the input is what needed to be saved, for repeated testing, etc 21:19:43 <{^Raven^}> not really and copy/paste is more convenient 21:19:54 But, it's easy enough to add a Save Output option, so I will :) 21:19:54 <{^Raven^}> ahh, i see. Yes that does sound betetr 21:20:41 <{^Raven^}> The Java GUI stuff (source code) looks deceptivly simple 21:22:39 yeah.. that pretty much sums it up 21:22:52 lots of work ent into those lines though, believe me :) 21:27:01 <{^Raven^}> I have been fleshing out my processor design 21:27:25 did oyu get past that last bfbasic bug that was stopping you last night? 21:27:37 -!- graue has joined. 21:28:14 <{^Raven^}> no, the bug is too deep in the compiler to workaround :( 21:28:26 k 21:31:19 <{^Raven^}> the line is originally array(val1) = array(val1) + array(val2) 21:31:51 <{^Raven^}> but it seems to compile to array(val1) = array(val1) 21:38:54 -!- Kmkr has joined. 21:38:56 is that what is printed by the debug output ? 21:39:00 hello 21:39:04 hi kmkr 21:39:12 hi 21:39:32 bbiam.. moving this pterminal to a different computer :) 21:39:36 -!- calamari has quit ("Leaving"). 21:40:04 <{^Raven^}> hi 21:40:15 -!- calamari has joined. 21:40:22 hi.. /whois tells me that i'm Keymaker 21:40:31 haha 21:40:32 i mean /whois Keymaker 21:40:37 you dork :P 21:40:45 :) 21:41:06 <{^Raven^}> calamari: I have PRINT array(val1) statements around the assignment 21:41:12 it'd be nice to be able to use @var's inside the debugger, wouldn't it :) 21:41:24 <{^Raven^}> you have read my mind 21:41:48 I need to make a list of all this stuff otherwise I'm gonna forget 21:42:20 <{^Raven^}> with BFBASIC compiled to debug output you can see which statement you are in 21:43:13 <{^Raven^}> what you need is the ability to set breakpoints, so you can run a program to the breakpoint 21:44:45 ZeroOne: when? it must've been something very temporary, i hope. it has worked for me every time i've been there today 21:45:09 (it's my start page in opera) 21:45:30 <{^Raven^}> compile to debug output, set breakpoint around the code in question, run silently (and quickly) to the breakpoint, and then step through the code at the point of the suspected bug 21:47:03 now that'd be cool 21:47:45 wonder how I can set a breakpoint.. perhaps just a special character in the code, like # 21:48:09 since that's the traditional bf debugging symbol 21:48:40 actually, that'd be extremely easy 21:48:56 <{^Raven^}> for @vars, add an option to BFBASIC to output out a @var map at the top of the output 21:49:18 <{^Raven^}> so maybe '@_T0 = 1 21:49:33 <{^Raven^}> '@_T1 = 2 21:50:00 <{^Raven^}> etc, the debugger would read these from the source on program load 21:50:06 btw, what you're talking about? 21:50:20 raven: oic, symbolic debugging.. nice :) 21:50:48 <{^Raven^}> :) 21:50:59 that's even easier than what I was thinking of doing, so it's good :) 21:51:40 keymaker: working on bfdebug, a java swing debugger I've written recently 21:51:49 trying to make it more useful :) 21:51:54 <{^Raven^}> kmkr: were talking about a really nice BF debugger in java calamari wrote 21:53:13 ok 21:53:24 that sounds useful 21:53:35 sometimes i spend hours hunting some bug 21:53:51 and mostly it's because of one instruction in wrong place 21:53:51 keymaker: http://kidsquid.com/programs/bf/bf.html 21:58:05 -!- graue has quit (Remote closed the connection). 21:58:35 * {^Raven^} has spent days tracking down fencepost errors 22:04:32 $varName=cellNumber (how's this for the defines)? 22:04:41 <{^Raven^}> calamari: would it be possible to make [-] an optional special case in Interpreter.java so it does setCell(_mp, 0); 22:04:51 sure 22:05:11 <{^Raven^}> that define sounds good to me 22:05:34 and it'll just be # for the breakpoints, placed by the user 22:06:33 I can't remember.. are the @var's produced by bfbasic uppercase ? 22:07:10 <{^Raven^}> yes they are 22:08:22 okay, I'll make them case insensitive in the debugger then 22:08:43 <{^Raven^}> how about breakpoints being disabled until the first BF instruction is encountered? It will save false positives if the program has a unix header. 22:09:23 would a different breakpoint character be preferred? 22:09:34 -!- graue has joined. 22:09:48 <{^Raven^}> no # is perfect 22:10:26 okay... I was just trying to avoid adding that extra state, but it can be done :) 22:10:34 -!- graue has quit (Read error: 54 (Connection reset by peer)). 22:11:08 -!- graue has joined. 22:11:15 <{^Raven^}> I'm on a quest to make brainfuck interpreter authors to add that particular usage 22:11:31 afk 22:11:42 <{^Raven^}> but since we're dealing with BFBASIC debug output here it's not much of an issue 22:12:39 <{^Raven^}> hi graue 22:13:21 <{^Raven^}> graue: i like your anti-(mp3/ogg)-streaming php script 22:14:02 anti-(mp3/ogg)-streaming php script?? 22:15:42 <{^Raven^}> it encourages users to download mp3s before listening to them instead of just streaming them from the server 22:16:06 i would add itunes too 22:16:21 -!- graue has quit (Remote closed the connection). 22:16:47 -!- graue has joined. 22:17:21 User-Agent: iTunes/4.8 (Macintosh; N; PPC) 22:17:41 <{^Raven^}> i'm looking for a way to stop storm downloads of music aswell 22:17:56 storm downloads? 22:18:52 <{^Raven^}> when you have multiple connections to a server each downloading different parts of a file 22:19:27 ah 22:19:56 tell apache to disallow downloads by file position 22:20:11 <{^Raven^}> multiply that by 40 or so mp3s and you have no bandwidth for a very long time 22:20:36 <{^Raven^}> I need resume enabled though for people with dodgy# connections 22:20:43 hmm ok 22:21:32 in php is it possible to execute some code if the user disconnects? 22:22:07 -!- Kmkr has quit (Read error: 110 (Connection timed out)). 22:22:53 you could use a mysql db with a lock table.. if a user starts a download the script puts the ip into the table if the user is done with the download it removes it 22:23:32 <{^Raven^}> that's basically the plan 22:23:44 and all ip:s that are older than 24h are removed (if the php script terminates without deleting the entry) 22:24:24 -!- graue has quit (Remote closed the connection). 22:24:29 * jix has to go to bed 22:24:59 <{^Raven^}> jix: good idea and good night :) 22:25:07 -!- jix has quit ("Banned from network"). 22:48:38 bbl 22:48:40 -!- calamari has quit ("Leaving"). 22:49:11 -!- graue has joined. 23:06:01 hey 23:06:50 I just finished up another silly language for those who might be interested: http://www.bigzaphod.org/taxi/ 23:06:58 -!- graue_ has joined. 23:09:22 -!- graue_ has quit (Remote closed the connection). 23:11:11 -!- graue has quit (Read error: 60 (Operation timed out)). 23:23:59 <{^Raven^}> BigZaphod: That looks seriously freaky :) 23:25:21 -!- graue_ has joined. 23:37:58 -!- graue_ has quit (Remote closed the connection). 23:38:46 -!- graue_ has joined. 23:39:08 {^Raven^}: thanks. :) 23:41:36 -!- graue_ has quit (Remote closed the connection). 2005-06-28: 00:20:52 -!- BigZaphod has quit. 00:22:44 -!- graue_ has joined. 00:29:13 -!- graue_ has quit (Remote closed the connection). 00:29:59 -!- graue_ has joined. 00:39:23 -!- calamari has joined. 00:40:39 -!- graue_ has quit (Remote closed the connection). 00:41:22 -!- graue_ has joined. 01:17:59 -!- sergacity has joined. 02:08:38 -!- BigZaphod has joined. 02:19:16 -!- calamari has quit ("Leaving"). 03:05:47 -!- graue_ has quit (Remote closed the connection). 03:07:02 -!- graue_ has joined. 03:07:15 -!- graue_ has changed nick to graue. 03:23:40 echo is pretty easy in taxi: Go to the Post Office: west 1st left, 1st right, 1st left. Pickup a passenger going to the Post Office. Go to Tom's Trims: north. Go to the Post Office: south. Go to the Taxi Garage: north 1st right, 1st left, 1st right. 03:24:01 taxi? 03:24:05 there's an esolang called taxi? 03:24:12 as of today. :-) 03:24:13 http://www.bigzaphod.org/taxi/ 03:24:28 wonderful 04:39:10 OMG 04:39:15 That is the greatest thing I have ever seen XD 04:39:24 :D 04:39:30 -!- malaprop has quit ("sleep"). 04:57:08 OK, Gregor = loozer. 04:57:25 I've made an installer system, and now I'm making a packaging system. 04:57:41 For totally different audiences, but, how can I be so obsessed with installation of packages? Oy. 05:09:13 I am going to sleep good night 05:09:14 -!- graue has quit. 06:13:27 -!- BigZaphod has quit. 06:20:56 -!- calamari has joined. 06:20:59 hi 06:53:26 -!- BigZaphod has joined. 06:54:08 hi 06:54:11 BigZaphod: nice! 06:54:11 hey 06:54:20 tnx. :) 07:03:37 for my own part i have produced this today: http://catseye.webhop.net/projects/alpaca/eg/braktif/src/braktif.alp 07:04:01 Smallfuck/Brainfuck F-as-a-cellular-automaton 07:07:53 interesting.. 07:18:32 is life the simplest turing complete automaton ? 07:59:59 -!- clog has quit (ended). 08:00:00 -!- clog has joined. 08:35:43 calamari: i can't think of a simpler one :) 08:37:01 life is 3x3, right? I wonder if there can be a 2x2 08:37:44 moin 08:38:14 am I the only one who thinks that Wireworld is simpler than Life? 08:38:33 not in number of states but anyway 08:39:38 cpressey: just curious, does the sketch of proof by Minsky use encoded counters as a single integer? 08:40:10 (re discussion in Talk:Befunge) 08:50:47 cpressey: nice work the cellular automaton; I still have to figure out how it works though 08:51:15 afk, bbl 09:20:12 night 09:20:15 -!- calamari has quit ("Leaving"). 09:24:57 wireworld makes a lot more sense than Life 09:25:35 cpressey: I can 09:27:39 actually i dunno 09:28:05 mathworld never actually explains in what sense is the rule 110 automaton "universal". 10:00:28 there is also KS-lambda UTM, which has three elements (two bits) like ` is 1, K is 00 and S is 01. 10:01:33 http://homepages.cwi.nl/~tromp/cl/cl.html 11:00:00 -!- jix has joined. 11:36:04 moin 11:44:51 -!- hashendgame has joined. 12:59:17 -!- malaprop has joined. 13:05:42 -!- jix has quit ("This computer has gone to sleep"). 13:09:37 -!- hashendgame has quit ("Leaving"). 15:40:54 -!- graue has joined. 15:41:52 hello 16:20:42 -!- graue has left (?). 16:21:25 -!- jix has joined. 17:15:52 -!- BigZaphod has quit. 18:08:44 pgimeno: yes, he uses prime factorization encoding at various points... 18:14:27 lament: sorry. i assumed calamari was talking about 2d cellular automata... 18:25:27 pgimeno: yeah, i checked - he mentions a 3-register machine and a 5-register machine... he emulates the 3-register machine in a 2-register subtract/jump machine by encoding the 3 registers into one (2^a*3^m*5^n) and using the other as scratch. he then argues that the 5-register machine can be simulated on a 1-register multiply/conditional-divide machine with all five encoded as (2^a*3^b*5^c*7^d*11^e) 18:33:06 of course, in befunge, you can make life easier by storing the data in one register and the program in the other... and you can use a less pathological encoding for the program (e.g. 8 bits per symbol) 18:41:30 lament: actually they do, on http://mathworld.wolfram.com/UniversalCellularAutomaton.html and http://mathworld.wolfram.com/Universality.html 18:42:16 i agree they don't do a good job, though... they neglect to mention any other meanings of universality (e.g. construction-universal) 18:48:33 cpressey: i don't get those pages 18:49:02 they say rule 110 can emulate the other automatons 18:49:20 that's obviously not universality in the Turing sense 18:51:21 "Universal systems are effectively capable of emulating any other system." ? 18:52:27 i don't like wolfram 18:53:23 haha 19:00:30 i suppose if you can avoid the parts of mathworld that sound like free advertising for NKS, it's not _that_ bad... 19:01:25 mathworld is useful 19:01:31 i just wish they gave me a free copy of Mathematica 19:02:46 cpressey: NKS? 19:03:07 lament: have you used maxima? 19:04:04 lindi-: yes 19:04:19 maxima is so weird. 19:04:31 why give me access to Lisp 19:04:33 i don't want your lisp 19:05:22 lament: try wxmaxima 19:06:04 -!- BigZaphod has joined. 19:06:47 lindi-: NKS = "A New Kind of Science", wolfram's (monstrous) book 19:06:50 lament: you can do a lot with maxima without even knowing it's written in lisp 19:06:56 cpressey: uh 19:07:25 lament: that especially applies to wxmaxima, try it, you'll be surprised ;) 19:07:31 -!- calamari has joined. 19:07:41 i'll look at it 20:05:18 -!- J|x has joined. 20:10:11 -!- jix has quit (Nick collision from services.). 20:10:12 -!- J|x has changed nick to jix. 20:35:05 -!- guest_2566 has joined. 20:35:17 -!- guest_2566 has changed nick to jimbo00000. 20:38:31 yay, help system implemented.. how I just need to write up the html for it :) 20:38:38 now 20:39:21 Hey all, does anyone still have any interest in Befunge93? 20:40:51 that's the original, right? 20:40:55 right 20:41:00 80x25 20:43:57 I haven't really studied befunge much.. I didn't learn of it until after bf, and so I got hooked on the tarpit idea :) 20:45:13 well i just made this real neat befunge interpreter in flash (http://jimbomania.com/code/flunger.html), only to find most of the links and mailing lists dead 20:47:00 I need to figure out why flash doesn't work.. very annoying 20:47:24 I like flash programs.. always look very smooth 20:48:44 yea, totally - get that plugin running. the pc leaves behind alpha scaled trails over the code space 20:48:53 it looks cool:) 20:51:01 jimbo00000: wow the interpreter is cool 20:52:22 but the trail is too short in the random-song example 20:52:37 hey, thank you very much! you can adjust the trail length with the slider in the lower left 20:52:56 up to 100 spaces back - gotta click the handle again if youre restarting 20:53:12 yes its on 100 but the trail is only 1 char long 20:53:27 or 2..3 but not 100 20:54:44 hmmmm that does not seem correct... this is a brand new thing so bugs may abound 20:54:59 can you reproduce the bug? 20:55:09 maybe try kicking that widget once or twice - no, im getting 100 tyrails over here 20:55:28 sometime what happens is flash doesnt register the end of the drag event if you release outside of the movieclip 20:55:31 a reload did it 20:55:35 sweet 20:56:33 i'm not 100% sure the g and p instructions work perfectly - does anyone perchance have any diagnostic programs to test it? 20:56:54 or maybe some idea on how to write a good one... 21:00:40 hmm, I get just a black screen .. is that normal? 21:03:18 no, what you should see is a 80x25 textfield labeled "Funge Space" 21:03:37 and a stack, and a gray frame that says "Welcome to Flunger" 21:03:49 weird... this page worked, so I assume Flash is okay http://www.jengajam.com/r/ultimate-pong 21:04:08 jimbo00000: hey.. why not write an interactive flash interpreter for: http://esolangs.org/wiki/YABALL 21:05:33 oooo kinky - i had thought of making a SNUSP mode too 21:05:47 shouldn't be so hard given the existing graphical framework 21:06:06 but SNUSP isn't written by myself 21:06:33 How are you, Mr H? :) 21:06:49 Mr H? 21:07:18 are you the writer of YABALL? 21:07:21 yes 21:07:35 jimbo00000: cool interpreter! 21:07:38 Why H and not Harder? 21:07:42 very cool - thanks BigZ! 21:07:52 jimbo00000: I'm on linux so that's probably what's wrong 21:08:04 maybe linux flash it out of date 21:08:32 calamari: i compiled it for flash player 7 21:08:58 jix: i dunno. what was your inspiration for the language? 21:09:54 calamari: argh. flash is even worse than java at the moment ;) 21:10:01 jimbo: do you know of a website with a flash program that prints the flash version number? 21:10:28 oh cool, it's working now.. 21:11:37 jimbo00000: in Brainfuck [] can be nested.. so one needs "complex" parsing or counting the ] and [s for loops.. i wanted to avoid that 21:13:43 so the memory model is like Brainfuck's? a 1D array? 21:14:12 yes 21:14:23 just the code flow is different 21:14:53 jix: I currently know of 3 ways to deal with [], I 21:14:57 'm sure there are more: 21:15:35 1: at a ] go back and for every ] count++ for every ] count-- stop at count == 0 start with count=1 21:15:40 1) stack, 2) search for matching [] 3) convert [] to jumps before execution 21:16:06 2: do the same thing once for all loops and store them as linked list or whatever 21:16:07 3 is the fastest that I know of.. no stack needed :) 21:16:18 my nr. 2 is your nr. 3 21:17:18 I was thinking of making a button to toggle blocking on input in the interpreter - anyone think that would be practical? 21:17:29 what is the procedure if there no input waiting - just push 0? 21:18:02 push 0 or don't push at all 21:18:20 i think don't push at all is more flexible 21:18:21 jimbo: I don't think I can use the interpreter correctly yet.. the A-Z program just goes around the first row over and over :) 21:19:23 Hmmm yea, thats not right. You know, I haven't tested this in linux yet. 21:19:45 on mac os x it works.. but sometimes there is this trail bug 21:21:01 trails seem fine.. 50% looks pretty good 21:21:22 jimbo00000: are you going to release the source code? 21:21:48 jimbo00000: re befunge-93 example programs to test with: http://catseye.webhop.net/projects/befunge93/eg/ 21:23:02 I assume the v instruction means go down 21:23:04 jix: yea, sure. least i could do - thanks for the awesome languages! 21:23:11 yep, v is down 21:23:13 I guess that's what's not happening :) 21:23:30 all the source is in flash actionscript, very similar to javascript and c 21:28:41 cpressey: Thanks for the funges! what happened a couple of months ago, i thought your site went down for good? 21:30:37 jimbo00000: it moved to the current address about 2 years ago 21:32:01 there's also a strange error with the webserver<->subversion thing that i haven't been able to track down, so it's not been the most reliable in the past months 21:32:30 but now i'm restarting the webserver nightly, so it should be "OK" 21:36:09 jimbo00000: btw, thanks for making the interpreter... unfortunately i have no way to test it until i get near a machine that i can use flash on :( 21:43:49 Does anyone here ever mess with choon? 21:44:07 me 21:44:21 do anything cool with it? i just found that page today 21:44:22 but very little 21:44:27 sounds just like r2 from starwars 21:44:49 http://www.99-bottles-of-beer.net/language-choon-750.html 21:49:39 pgimeno: best beer program EVER 21:50:14 would it be possible to port the interpreter and the wav converter to php, for the integrated web choon experience? 21:50:36 i guess it would, php can write files 21:59:34 jimbo00000: excuse me, what should i do after entering execution mode? 22:00:05 oh, i got it, i got it. 22:02:29 g'nite 22:03:13 -!- graue has joined. 22:05:52 -!- jix has quit ("Banned from network"). 22:06:45 jimbo00000: it appears 'p' won't hold values with ascii value less than 32, isn't it? 22:07:54 it replaces them with symbol "?" (ascii 63). 22:08:31 mtve: that sounds correct, yes, and the upper limit is ASCII 126 22:08:49 is this correct behavior? i think i saw that javascript funge interpreter do it 22:09:37 i doubt it. at least few known programs expect values to be kept intact. 22:10:41 hmmm so i should just dump the value there, even if it is unprintable? 22:10:56 yea that makes sense for computation 22:11:27 I'll have to find some hackaround for that, as flash will most likely balk at the unprintables 22:14:04 jimbo00000: thanks 22:14:43 has anyone ever tried to mate choon with funge? 22:14:44 yep. it wasn't explicitly told in the spec, but it would be good. and yes, interpreter is very nice. 22:15:13 * pgimeno rolls eyes 22:16:01 I just had a wild idea - concurrent pcs in a 2d space executing choon, making chords possible 22:16:55 maybe add a tempo change command 22:18:10 -!- calamari has quit (Read error: 60 (Operation timed out)). 22:20:32 actually choon is not the kind of language I feel comfortable with 22:22:13 I am most attracted to the musical aspect of choon, more so than its syntax 22:28:06 -!- graue has quit. 22:30:36 I've been looking for an UTM program with two symbols but have been totally unsuccessful. A book by Roger Penrose has a description. Does anyone know of a TM program implementing an UTM? 22:34:21 pgimeno: yes, there are a few in the Minsky book. (it's actually a really nice book, i wish i'd found it a lot earlier...) 22:34:23 (I have the book, The Emperor's New Mind, but have lent it to someone I might not see again) 22:34:33 oh, cool 22:34:42 what's the name of the book? 22:34:51 Computation: Finite and Infinite Machines 22:35:10 the name sounds pretty attractive 22:35:20 i can scan or type in one of the UTM state diagrams if you can't find it 22:35:26 Minsky's design is... 46 or so states long, right? 22:35:52 :) he was a tarpit fan too.... he has a 4 state x 7 symbol UTM 22:35:56 (IIRC, for what I have seen googling) 22:36:33 sorry, that's 4 symbols, 7 states 22:36:41 yeah, the Wikipedia article (or was it the Wolfram one?) has the records 22:36:53 there's a 2-state one in 18 symbols IIRC 22:37:24 or probably 19 22:38:05 I've been googling for a while and seen all that 22:38:23 but I've found no description of a TM program 22:38:58 hrm, so you want one that is 2 symbols, explicitly? 22:39:16 yeah, for the extended Befunge-93 proof :) 22:40:43 heh 22:40:49 my idea is to use the two counters as two bit stacks as in part 1 of the counter article 22:40:52 there's one that never erases a symbol once written... 22:41:14 one what? utm? 22:41:20 yeah 22:41:29 blank and 1, and blank -> 1 but 1 never -> blank 22:41:35 reminds me a lot of smith :) 22:41:44 kind of, yeah 22:42:15 anyway, for the b93 proof... if i were to try it i'd probably do the multiply/conditional-divide model, since Befunge has those instructions 22:42:26 and that's only 1 register 22:42:34 so you can use the other for holding the program 22:42:41 which should make things MUCH easier, i'd think 22:42:44 -!- calamari has joined. 22:42:48 hi 22:42:58 hi calamari 22:43:03 Gentlemen, it has been a pleasure to be in such esteemed company. Have an excellent evening. 22:43:05 hi chris 22:43:08 yeah, but I don't want to use exponential encoding because I'd like to try it with a real machine 22:43:11 -!- jimbo00000 has quit ("Today is a good day to chat."). 22:43:19 ah, i see. 22:43:47 hrmmm..... 22:44:40 you could implement bigints *as* a prime factorization internally - that would make it feasible (i think) - but it would make implementing add/subtract, um, "interesting"... but on the other hand, you don't ever have to *use* add or subtract... 22:45:22 anyway, all the 2-symbol UTMs seem to be conversions from tag systems (which are neat in themselves.) 22:46:26 my idea is to use the Befunge 80x25 playfield to implement the handling of stacks and the FSM (Turing program), and the two counters as two bit stacks that implement the tape 22:46:50 right 22:46:57 the state will be maintained by the program counter, probably 22:47:14 you know, you could almost use 2-symbol brainfuck (brainfuck f/smallfuck) 22:48:05 it's easier to reason about than most of these "proof that such a machine must exist (no explicit construction given though)" things :) 22:48:46 heh, you're right 22:48:59 I'm a bit dumb sometimes 22:50:50 I suppose that writing a boolfuck/smallfuck/bf F interpreter that uses the two counters as the cells would complete the proof 22:51:08 hey i like that bignums-as-primes idea 22:55:16 is it just me or is the wiki down? 23:03:00 not working for me either 23:04:03 thanks 23:04:37 I've just found the EsoLang FAQ :) 23:13:00 does anyone have a backup mediawiki installation? I can redirect esolangs.org to point to it 23:16:55 wooby and malaprop were the ones who offered to set up a mirror 23:17:11 I'm downloading mediawiki just for fun 23:17:25 I suspect the wiki will come back shortly.. but this is a good test :) 23:17:36 :) 23:18:06 so you can manipulate the esolangs.org domain? I thought it was wooby who controlled it 23:18:27 wooby is in Iraq and he placed it in my care while he is gone 23:18:43 wow 23:18:52 yeah, sux huh? 23:19:15 I sure wouldn't want to be over there :) 23:19:16 kind of astonishing news 23:20:44 I just hope he returns in perfect shape 23:21:04 as do I.. suprised he didn't tell anyone else 23:22:17 maybe he thought it was offtopic here or something 23:29:25 -!- BigZaphod has quit. 23:44:51 <{^Raven^}> hi 23:46:47 hi raven 23:46:55 got the @ stuff working in the debugger 23:46:58 also # 23:47:13 haven't changed bfbasic yet, though.. so it's not much use :) 23:47:26 <{^Raven^}> hey cool, that debug run is still going from the other day :) 23:47:27 I should release it anyways 23:47:30 haha 23:47:41 <{^Raven^}> am running bf2c.b on itself ;) 23:48:23 what will that give you? a c program that converts bf to c? 23:48:39 <{^Raven^}> yeah 23:48:41 I could write that in much less than a day ;) 23:49:06 <{^Raven^}> It's just a test run that I've not bothered to terminate... 23:49:16 cool to hear it's still going 23:50:41 <{^Raven^}> I have the C version of my emulator 75% finished, I'm writing it as a reference against the future BF version 23:53:13 raven: how long till you go to bed? wondering if I want to mess with bfdebug more or release it now 23:54:26 <{^Raven^}> calamari: a few hours 23:54:42 it turns out that only mysql 4.1+ can import dumps.. My shell provider is running mysql 4.0 :( 23:55:01 <{^Raven^}> where is a copy of the db? 23:55:14 http://kidsquid.com/esowiki 23:55:59 afk, going to see if I can get them to install 4.1 23:56:39 -!- Kmkr has joined. 23:56:42 woah 23:56:57 jimbo00000: really cool befunge interpreter! 23:59:30 wooby's in iraq? i hope everything goes well. 2005-06-29: 00:00:19 for some reason i thought graue controlled the wiki.. 00:00:38 he does 00:00:51 hmm, then what wooby does? 00:00:56 esolangs.org 00:01:07 ah. me see now 00:10:00 <{^Raven^}> i can convert it to an earlier version of SQL but not without losing metadata so no luck here as I don't want to corrupt that 00:10:29 * {^Raven^} is running 3.x.x on his server 00:11:06 hahaha 00:11:23 how is the conversion done? 00:12:28 I heard I could modify mysql table headers, but I have no clue how to 00:13:18 <{^Raven^}> easy(ish), first remove the instances of ` in SQL commands 00:13:32 <{^Raven^}> and then remove all the CHARSET stuff 00:14:19 <{^Raven^}> you need to remove the charset stuff from the INSERT statements too 00:14:29 for 4.1 to 4.0 I need to do this? 00:16:29 <{^Raven^}> for some of it yes, but I recommend against it, you will destroy too much information 00:17:05 <{^Raven^}> do you know any friendly sysadmins who could host it for a while? 00:18:00 nope.. well I know some.. but they wouldn't know how to set it up :) 00:19:02 <{^Raven^}> hmmm, it should be pretty simple, create database + account, install mediawiki, import database 00:19:24 <{^Raven^}> my MySQL/PHP can be tough for a newbie to setup 00:19:27 <{^Raven^}> *but 00:21:17 bigzaphod: really cool language :D 00:27:40 well, bbl. 00:27:43 -!- Kmkr has quit ("I've seen this déjà vu before.."). 00:31:14 <{^Raven^}> calamari: a competent person should be able to set it up remotely given ssh / webmin access 00:31:57 <{^Raven^}> calamari: + ftp of course 00:33:50 raven: afk a minute.. jarring/releasing 1.20 00:41:58 -!- heatsink has joined. 00:47:01 -!- graue has joined. 00:47:29 raven: http://kidsquid.com/programs/bf/bf.html 00:47:35 hi graue :) 00:47:40 having fun with the wiki? 00:49:47 no 00:49:49 why? 00:49:54 why would I be having fun with it? 00:50:08 oh, because it's down 00:50:10 that sucks 00:51:14 I've been trying to set up mediawiki on my webspace, but have 4.0 00:51:26 err mysql 4.0 00:53:00 graue: I'd like to request daily dumps when it comes back, because of all the activity.. a week loses a lot 00:56:03 <{^Raven^}> calamari: Wow! 00:56:18 looks the same, huh? :) 00:56:46 <{^Raven^}> Now if "Now @varname goes to the cell defined by varname (note: it can be derailed with < and >)" does what I think it does that's really cool 00:57:25 yeah.. it doesn't just jump to the cell, because that's impossible in normal bf 00:57:43 @a>@b will bump you one past actual @b 00:58:42 <{^Raven^}> does this mean that we could theoretically compile a BFBASIC program without parsing it through arrows() and it should still work as long as the varmap is present? 00:59:15 possibly 00:59:33 that's the idea, at least :) 01:00:03 <{^Raven^}> I have thought about that feature, even produced the required version of BFBASIC (last week) 01:01:15 haha 01:01:25 <{^Raven^}> This will allow the integrity of the parser proper to be tested since all the @var stuff would be theoretically perfect! 01:01:34 have you tried $ yet? there's a hidden bonus feature :) 01:02:28 <{^Raven^}> Definately, I have added a cvarmap to a short program which is running atm 01:02:49 cool 01:03:36 <{^Raven^}> Would the bonus be a window refresh every thousand or so cycles? I have definitly noticed that 01:05:13 nope.. it's the varnames on the memory list 01:05:24 :) 01:05:59 I haven't added that quick run stuff yet 01:06:34 <{^Raven^}> That's the first thing I spotted :) 01:07:19 <{^Raven^}> *the varnames on the memory list 01:07:28 oops, I forgot to change the version # in the code 01:10:18 -!- BigZaphod has joined. 01:11:02 okay, uploaded the version fixed 1.20, also fixed a small help bug while I was at it 01:11:53 (if you closed help and came back, it wouldn't be back to the contents) 01:17:11 <{^Raven^}> I am running this on an extra debug version of a BFBASIC program with all the symbols defined 01:18:01 <{^Raven^}> i can see exactly which statement is currently being executed and what all the CVARS are :) 01:18:05 cool 01:18:11 is it working? 01:19:38 I'd test the array code, but the wiki is down :/ 01:20:21 the support guy at my isp will try to get 4.1, so that's cool 01:20:30 err shell, not isp 01:21:12 <{^Raven^}> yeah, the first PRINT came out garbled but I'm using a non-standard BFBASIC atm 01:21:18 oic 01:21:22 <{^Raven^}> otherwise all seems perfect 01:22:57 <{^Raven^}> calamari: garbled text seems to be my fault 01:29:22 raven: I think what what I did with the @vars is called a wimpmode :) 01:31:42 <{^Raven^}> definately not, your debugger is going to be really useful for any brainfuck developer 01:35:16 <{^Raven^}> calamari: http://jonripley.com/~jon/action.png 01:37:56 cool 01:53:59 bbl.. phone 01:54:03 -!- calamari has quit ("Leaving"). 02:04:03 -!- graue_ has joined. 02:04:16 why are there two of me? 02:04:47 oh, that was stupid 02:04:47 -!- graue_ has left (?). 02:06:01 -!- calamari has joined. 02:13:18 <{^Raven^}> calamari: feature idea for BF debugger... 02:14:49 <{^Raven^}> calamari: the ability to vertically extend the memory view to show locations 16..31, 32..47, 48..63, etc 02:16:36 <{^Raven^}> it would dramatically cut so 02:17:00 <{^Raven^}> *down on the amount of left<>right scrolling and make the debugger more transparant/useful 02:30:29 raven: do you mean there would be 48 memory locations going across? 02:30:46 oh.. vertically :) 02:34:04 that would really slow things down the way I'm currently drawing memory 02:34:18 so I should fix the way I'm drawing memory :) 03:06:46 -!- graue has left (?). 03:12:12 * {^Raven^} is asleep 03:26:08 -!- CXI has quit (Read error: 104 (Connection reset by peer)). 03:26:20 -!- comet_11 has joined. 03:26:46 -!- comet_11 has changed nick to CXI. 03:35:19 -!- heatsink has quit ("Leaving"). 03:37:40 -!- malaprop has quit ("quit"). 05:15:12 -!- BigZaphod has quit. 05:29:16 -!- calamari has quit ("Leaving"). 06:40:48 -!- calamari has joined. 07:10:34 raven: my x(y)=z routine as on the wiki seems to work fine for x(4)=2 and x(0)=2. It uses 3 + 2 * (total # of indices) bytes of memory 07:29:12 I've added an explanation of x(y)=z to the wiki page 07:37:32 -!- BigZaphod has joined. 07:40:39 hi zaphod 07:40:47 hey 07:59:59 -!- clog has quit (ended). 08:00:00 -!- clog has joined. 08:46:11 -!- tokigun has joined. 08:46:30 hello 08:52:53 hi tokigun 09:05:37 -!- calamari has quit ("Leaving"). 09:25:32 -!- {^Raven^} has quit (brown.freenode.net irc.freenode.net). 09:25:38 -!- mtve has quit (brown.freenode.net irc.freenode.net). 09:25:38 -!- pgimeno has quit (brown.freenode.net irc.freenode.net). 09:25:38 -!- ZeroOne has quit (brown.freenode.net irc.freenode.net). 09:26:10 -!- tokigun has quit (brown.freenode.net irc.freenode.net). 09:26:12 -!- cmeme has quit (brown.freenode.net irc.freenode.net). 09:26:12 -!- lindi- has quit (brown.freenode.net irc.freenode.net). 09:26:34 -!- tokigun has joined. 09:26:34 -!- cmeme has joined. 09:26:34 -!- lindi- has joined. 09:27:49 -!- ChanServ has quit (brown.freenode.net irc.freenode.net). 09:27:49 -!- fizzie has quit (brown.freenode.net irc.freenode.net). 09:27:49 -!- deltab has quit (brown.freenode.net irc.freenode.net). 09:27:49 -!- puzzlet has quit (brown.freenode.net irc.freenode.net). 09:27:51 -!- cpressey has quit (brown.freenode.net irc.freenode.net). 09:27:54 -!- CXI has quit (brown.freenode.net irc.freenode.net). 09:28:18 -!- puzzlet has joined. 09:28:18 -!- cpressey has joined. 09:29:34 -!- deltab has joined. 09:29:34 -!- fizzie has joined. 09:30:03 -!- CXI has joined. 09:31:20 -!- cpressey has quit (brown.freenode.net irc.freenode.net). 09:31:22 -!- puzzlet has quit (brown.freenode.net irc.freenode.net). 09:31:24 -!- cpressey has joined. 09:31:30 -!- puzzlet has joined. 09:43:31 -!- {^Raven^} has joined. 09:44:16 -!- pgimeno has joined. 09:47:03 -!- ZeroOne_ has joined. 11:29:22 -!- mtve has joined. 11:33:34 -!- ChanServ has joined. 11:33:34 -!- irc.freenode.net has set channel mode: +o ChanServ. 12:00:58 -!- ChanServ has quit (brown.freenode.net irc.freenode.net). 12:00:58 -!- mtve has quit (brown.freenode.net irc.freenode.net). 12:00:58 -!- CXI has quit (brown.freenode.net irc.freenode.net). 12:00:59 -!- fizzie has quit (brown.freenode.net irc.freenode.net). 12:00:59 -!- deltab has quit (brown.freenode.net irc.freenode.net). 12:00:59 -!- pgimeno has quit (brown.freenode.net irc.freenode.net). 12:01:01 -!- cmeme has quit (brown.freenode.net irc.freenode.net). 12:01:01 -!- lindi- has quit (brown.freenode.net irc.freenode.net). 12:01:01 -!- tokigun has quit (brown.freenode.net irc.freenode.net). 12:01:02 -!- ZeroOne_ has quit (brown.freenode.net irc.freenode.net). 12:01:02 -!- puzzlet has quit (brown.freenode.net irc.freenode.net). 12:01:03 -!- BigZaphod has quit (brown.freenode.net irc.freenode.net). 12:01:10 -!- {^Raven^} has quit (brown.freenode.net irc.freenode.net). 12:02:23 -!- ChanServ has joined. 12:02:23 -!- BigZaphod has joined. 12:02:23 -!- tokigun has joined. 12:02:23 -!- cmeme has joined. 12:02:23 -!- lindi- has joined. 12:02:23 -!- deltab has joined. 12:02:23 -!- fizzie has joined. 12:02:23 -!- CXI has joined. 12:02:23 -!- puzzlet has joined. 12:02:23 -!- {^Raven^} has joined. 12:02:23 -!- pgimeno has joined. 12:02:23 -!- ZeroOne_ has joined. 12:02:23 -!- mtve has joined. 12:02:23 -!- irc.freenode.net has set channel mode: +o ChanServ. 12:02:48 -!- CXI has quit (brown.freenode.net irc.freenode.net). 12:02:52 -!- CXI has joined. 13:00:43 -!- malaprop has joined. 13:15:48 <{^Raven^}> wb everybody 13:50:28 -!- tokigun has quit ("Chatzilla 0.9.68.5 [Firefox 1.0.3/20050414]"). 13:59:50 -!- jix has joined. 14:01:11 moin 14:33:35 -!- yrz\werk has joined. 14:33:39 eh... 14:33:43 today 14:33:52 i wrote an interpreter 14:34:01 for a hypercubical version of bf 14:35:18 (perfectly backward compatible) 14:36:15 nice 14:36:24 is it backward compatible in all directions? 14:37:09 of course ;) 14:37:35 is somewhere where i can post specification for the *new* language? 14:37:40 yeah 14:37:49 tell my please :) 14:37:53 http://www.esolangs.org/wiki/Main_Page 14:38:08 uff, was enough read the topic. 14:38:12 that's not funny. 14:38:15 ok... 14:38:25 well, not actually there; go to the Languages list, add it and create a page for it 14:44:20 pgimeno: are you english native speaker? 14:44:46 nope 14:45:12 uff... anyway... do you take a look on my explication when i finish to edit? 14:47:24 I'm afraid it will have to wait, as I'm a bit busy at work and eager to go home. Anyway, rest assured that someone (me or whoever finds it) will correct it if it's not clear enough. That's what a wiki is for, collaborative edits :) 14:47:55 done. 14:52:21 link? 14:53:06 nm, found it 14:55:36 please take a look at other wiki articles to get a feeling of how the articles look like 15:04:05 i see... 15:04:28 that'll take time... 15:13:40 you can let others do the work if you like 15:14:09 anyway it would be nice if the link to the interpreter is in the page 15:29:51 today in school i tried to write a BF interpreter in ti-89 basic.. but the screen is too small i lost control over my own code... :( 15:37:29 i'm going to write esolang interpreters for the ti-89/92+ (using ti-gcc because basic is slow).. 15:37:52 esolang programming at school.. yeah 16:31:09 can't i upload a tar.gz on http://esolangs.org/wiki/ ? 16:33:10 No, you have to beg someone with CVS access to put it in the files section for you. 16:44:05 malaprop: do you have such access? 16:47:37 No. I have no idea who has access beyond graue. 16:49:29 uff... 16:49:42 i would upload my hcbf interpreter. 17:22:03 -!- BigZaphod has quit. 17:25:11 -!- yrz\werk has quit (Read error: 110 (Connection timed out)). 17:42:26 -!- CXI has quit (Connection timed out). 17:57:47 -!- BigZaphod has joined. 17:57:52 -!- CXI has joined. 18:11:23 -!- yrz\werk has joined. 18:11:55 -!- comet_11 has joined. 18:12:33 -!- CXI has quit (Nick collision from services.). 18:12:35 -!- comet_11 has changed nick to CXI. 18:12:50 yrz\werk: I'm back home and have CVS access 18:13:00 (SVN rather, but anyway) 18:13:46 what's the license of the interpreter? 19:10:08 -!- cmeme has quit (Connection reset by peer). 19:10:53 -!- cmeme has joined. 19:20:25 -!- cpressey has quit (Remote closed the connection). 19:20:27 -!- cpressey has joined. 19:30:23 -!- calamari has joined. 19:30:32 hi 19:39:40 <{^Raven^}> hi calamari 19:43:37 hi raven 19:44:20 found a few more bugs in the program 19:44:33 adding the *.bf messed up my automatic .b adding 19:45:11 there was something else too, but it was minor :) 19:46:30 one thing I realized when working on x(y)=z, is it would be REALLY nice to either be able to edit while running, or have a copy that can be edited 19:46:58 I kept wanting to add comments or newlines or whatever, but I couldn't 19:47:40 not sure of a good way to handle it yet though.. there are keyevents I can catch, but I need to see if copy/paste still works 19:48:14 anyhow.. 19:48:33 at least we know that the theoretical version of x(y)=z works as expected 19:48:48 the question is whether the implementation is correct 19:49:27 iirc, it was just doing x(y)=z in a for loop that was crashing 19:49:49 so I don't even need to check x=y(z) yet 19:50:05 bbl .. lunchtime 19:57:48 <{^Raven^}> i have been editing code in between runs, copy and paste works fine, a minor issue is that when the program is loaded the first character of the program is highlighted 19:58:38 <{^Raven^}> meaning if you load some code and say immediately paste in the cvar map you trash the first character 20:00:21 <{^Raven^}> I have noticed a few BFBASIC optimisations that could be done later on and some redundant code that could be removed 20:05:18 -!- J|x has joined. 20:06:10 -!- jix has quit (Nick collision from services.). 20:06:13 -!- J|x has changed nick to jix. 20:31:42 hi jix 20:32:38 raven: still working on your adventure game? 20:33:10 <{^Raven^}> not much since it was released 20:33:52 <{^Raven^}> have only been looking at using the BF statement for optimisation 20:37:00 raven: oh, I thought you were going to write a 10k game for the 2005 contest 20:38:01 <{^Raven^}> calamari: oh...that one. yes i am still working on the compo game 20:38:30 I need to do more research, but haven't had time between other projects 20:39:22 <{^Raven^}> I have 75% research complete, main thing is the puzzles 20:40:06 yeah.. mine won't have puzzles in that sense.. it might be disqualified as not text adventure-enough.. dunno :) 20:40:46 <{^Raven^}> puzzle-less IF is still IF, there's quite a lot out there too 20:44:21 i'm done with my first try 20:44:25 but it isn't good enough 20:44:43 its 1.6 or 1.8k (with 2 langpacks (german and english)) 20:45:06 and it isn't written in a classic language 20:51:12 bbl.. work 20:51:14 -!- calamari has quit ("Leaving"). 20:55:29 <{^Raven^}> calamari: I have found a bug in the FOR code 21:02:30 i have a new idea for an esolang 21:03:30 -!- yrz\werk has quit (Client Quit). 21:04:02 -!- yrz\werk has joined. 21:06:31 hmm no 21:07:47 -!- yrz\werk has quit (Client Quit). 21:09:02 -!- yrz\werk has joined. 21:11:46 -!- CXI has quit (Read error: 104 (Connection reset by peer)). 21:12:04 -!- CXI has joined. 21:12:53 -!- CXI has quit (Read error: 104 (Connection reset by peer)). 21:13:13 -!- CXI has joined. 21:26:29 trying to implement bf in taxi. brain hurts.. 21:26:52 taxi? 21:27:07 http://www.bigzaphod.org/taxi/ 21:27:33 ah 21:51:19 <{^Raven^}> calamari: (when you get back...) I have improved and fixed a bug in the FOR code 21:52:23 * {^Raven^} ponders... Does debugging a program written in a programming language you don't know count as esoteric programming? 21:58:58 It does if it's perl! 21:59:15 But then again, programming in perl is esoteric programming *shrugs* 21:59:26 <{^Raven^}> nah, it's Java 21:59:51 -!- jimbo00000 has joined. 22:00:15 Hullo 22:00:41 Hey everybody, is there any choon source on the net ouside of the examples on that one page? any at all? 22:03:28 I don't know of any, but that's just me. 22:05:33 not that any of this stuff is real mainstream, but google turns up nada 22:06:58 ok how about a Befunge93 question: how might one go about testing if a value on the stack is less than a number? 22:07:21 d'oh nm, i just saw it 22:07:25 <{^Raven^}> jimno00000: have you tried alltheweb, msn, lycos, altavista et al.? 22:07:41 Raven: I have not, ill do it now. 22:08:07 i don't think there's any choon stuff. 22:09:11 turns up a lot of hits on peoples names, tough to filter out 22:22:05 -!- graue has joined. 22:35:45 cpressey: about usefulness for computation 22:36:01 cpressey: i think it has to do with ability to implement algorithms 22:36:36 cpressey: i can write a smallfuck program to add two numbers 22:36:57 cpressey: naturally it will only add numbers up to a certain size 22:37:06 but to increase that size, i wouldn't need to change my program 22:37:14 just the alloted memory 22:39:12 can't do that with lookup tables :) 22:40:56 so i'm making a distinction between "code" and "data" ,for which i will presumably get shot 22:41:17 although in smallfuck the distinction happens to be clear 22:42:57 but then of course, even with this amount of handwaving, it's clear that SMETANA isn't useful, either 22:43:02 ... 22:43:26 or at least that being able to compile smallfuck to it doesn't prove anything 22:48:44 grrrr. 22:48:59 also consider Wireworld 22:49:13 i think it's pretty clear that wireworld is useful 22:49:42 but to implement a turing machine, you need infinite space to put the tape in. 22:49:57 However, it's very easy to describe how to create that tape 22:50:08 (it's just repetitions of a simple pattern stretching out to infinity) 22:50:12 same with Smallfuck and SMETANA 23:20:11 -!- jix has quit ("Banned from network"). 23:33:34 i can write a lookup table for adding two numbers 23:33:36 it's easy 23:33:38 1, 1, 2 23:33:40 1, 2, 3 23:33:41 etc 23:34:53 for wireworld, program space == data space, and it's unbounded. 23:35:28 but Smallfuck programs (and tapes) and SMETANA programs are bounded. 23:36:03 if you have a program that isn't bounded, you seriously bend the rules for what makes an algorithm or not 23:36:15 e.g. if my lookup table is unbounded, then it really can add any two integers 23:43:34 for wireworld, an "unbounded" program would require infinite specification of the initial state... 23:43:51 unlike Life where you can create stuff 23:45:12 no, this definitely has to do with algorithms somehow. 23:45:44 but i'm not certain what your point is 23:45:55 i'm not etiher 23:45:57 ok 23:46:08 just thinking aloud. 23:46:49 whether a language allows arbitrary storage is really not very interesting. 23:47:51 it's fairly interesting to me 23:52:39 -!- BigZaphod has quit. 2005-06-30: 00:56:34 -!- BigZaphod has joined. 01:16:53 <{^Raven^}> any CVS type peeps here? 01:28:24 hum, interesting discussion 01:28:36 (the above) 01:28:47 sorry to be late 01:29:05 I've been thinking about a sensible definition of "useful for computation" 01:29:54 -!- yrz\werk has quit (Client Quit). 01:31:26 -!- malaprop has quit (Read error: 131 (Connection reset by peer)). 01:32:38 -!- malaprop has joined. 01:39:58 -!- pgimeno has quit (Read error: 60 (Operation timed out)). 01:52:07 -!- jimbomania has joined. 01:52:37 nice wings raven 01:52:58 anyone write choon? im trying to figure out a way to get a pattern of ascending thirds within a loop 01:54:29 -!- jimbo0000 has joined. 01:54:37 -!- jimbomania has quit (Client Quit). 01:57:38 -!- pgimeno has joined. 01:58:32 whats up pgimeno? 01:58:37 what part of my discussion has been read? 01:58:39 hi jimbo0000 01:58:52 you're the local choonsmith, right? 01:59:00 not much 01:59:30 well i was trying to write a looping construct to print ascending minor thirds 01:59:35 so x+=3 basically 02:00:03 i tried stepping up the notes to get a few iterations of loop - %AB++++++B.||: :|| 02:00:50 inside ive tried =1+ 02:02:12 I've never used the = instruction 02:02:28 my only Choon program was 99bob and all I needed was the correct looping 02:02:40 i thought i might be easily able to just use =-1 to get the last note played, and each time transpose up by that amount 02:03:12 i can manually plot out notes, but thats no fun 02:03:22 hell, even that is non-trivial 02:03:34 to get multiple octave range 02:04:33 I'm sorry, I need to rest, I can't make much sense of that right now in this state 02:04:48 thanks anyway, gnight 02:05:03 nite all 02:10:14 -!- graue_ has joined. 02:10:24 -!- graue has quit (Read error: 145 (Connection timed out)). 02:12:53 -!- graue_ has changed nick to graue. 02:17:37 <{^Raven^}> nite peeps 03:48:40 -!- jimbo0000 has quit. 04:19:35 -!- graue has quit. 04:54:49 -!- pgimeno has quit (Read error: 131 (Connection reset by peer)). 04:55:00 -!- pgimeno has joined. 06:22:07 -!- calamari has joined. 06:22:11 hi 07:59:59 -!- clog has quit (ended). 08:00:00 -!- clog has joined. 08:07:52 -!- jix has joined. 08:08:09 moin 08:21:28 -!- jix has quit ("Banned from network"). 08:28:54 -!- yrz\werk has joined. 09:28:19 -!- calamari has quit ("Leaving"). 11:33:03 <{^Raven^}> mornin peeps 12:11:07 -!- puzzlet has quit (Client Quit). 12:37:17 -!- puzzlet has joined. 12:59:02 -!- jix has joined. 13:21:16 moin 13:26:29 -!- puzzlet_ has joined. 13:26:29 -!- puzzlet has quit (Read error: 104 (Connection reset by peer)). 15:14:46 -!- jimbo00000 has quit ("Today is a good day to chat."). 17:24:50 * {^Raven^} twiddles the volume control 17:25:24 * jix pushes command-f1 17:34:56 -!- BigZaphod has quit. 17:50:33 -!- jumpi has joined. 17:56:06 -!- pgimeno has quit (Read error: 104 (Connection reset by peer)). 18:08:00 -!- pgimeno has joined. 18:09:50 -!- BigZaphod has joined. 18:17:59 wc 18:29:53 -!- jumpi has quit ("[BX] Time wasted: 5 millenia 5 centuries 1 decades 8 years 0 months"). 18:43:40 -!- cmeme has quit (Remote closed the connection). 18:44:28 -!- cmeme has joined. 18:44:46 -!- cmeme has quit (Remote closed the connection). 18:45:33 -!- cmeme has joined. 19:17:46 -!- jimbo0000 has joined. 19:18:15 Hey everyone, a lovely day to you all 19:26:34 <{^Raven^}> hi jimbo0000 19:28:24 it's quiet today 19:28:39 <{^Raven^}> oddly so 19:30:37 does anyone in this room own a psp? 19:37:01 * jix doesn't 19:38:00 the homebrew scene is in the process of exploding - i am very excited 19:38:41 i did programming for the game-boy advance 19:41:19 how did you like it? how mature did those libraries eventually get, especially w respect to graphics? 19:42:24 oh it was.. c without stdlib and direct accessing memory-mapped registers 19:42:36 there was a stdlib.. and c++ worked too 19:42:43 and there were some graphic libs 19:42:47 but i never used them 19:43:13 an arm7tdmi 16mhz cpu isn't that fast and the less function calls the more speed 19:44:06 and memcpy is slow.. so i used DMA (there was one thing that was faster than dma using the load/store 4 registers at once asm instruction) 19:44:40 it was std gcc + std binutils + newlib 19:44:53 but with a different link scripts and crt0.s 19:45:13 and some emulators have gdb support + elf loader build in 19:45:30 <{^Raven^}> LDM/STM (as many registers as possible) in a partially unrolled loop would probably be fastest memcpy 19:45:55 <{^Raven^}> (using writeback to remove the need for ADD ctr,ctr,#x 19:46:00 DMA can be faster 19:46:12 what did you use to get executables onto the device? cable? 19:46:30 jimbo0000: flashcard and/or multi-boot cable 19:47:01 first i had to use a windows machine for development & flashing 19:47:06 -!- CXI has quit (Read error: 104 (Connection reset by peer)). 19:47:23 than i could use mac os x for development (linux build instructions) 19:47:24 -!- CXI has joined. 19:48:00 and later i could use mac os x for flashing (f2a open source flasher + a osx driver for some usb micro controller) 19:50:30 i had a real good time homebrewing on the dreamcast, too bad it was a dead system 19:50:48 but the psp - man its gonna be huge 19:51:30 i would prefer building my own computer (including own cpu (of course (esoteric? ^^))) and programming it 19:52:16 <{^Raven^}> jimbo0000: dreamcast homebrew is still going strong 19:53:04 Raven: i havent been checking that often, it seemed more exciting in what i thought of as its heyday around 2 years ago 19:53:38 jix: do you think you could build a computer out of wooden gates, a river and a series of small water channels? 19:53:50 uh.. no 19:53:56 i couldn't 19:54:11 but.. i could design one.. but not build it 19:54:40 i thought about water-gates a few years ago 19:54:54 really 19:55:02 but i think wood isn't the right material for it 19:55:20 i think i saw a slashdot post on it - yeah, but it would have that really old-world natural look and feel :) 19:56:06 jimbo0000: with wooden marbles and wood.. that would be more "realistic" than wood + water 19:58:22 it would probably perform a lot better - i always thought of the water&wood thing as something to do after I tired of the whole world and became a recluse deep in the wilderness 19:59:22 -!- J|x has joined. 19:59:48 -!- jix has quit (Nick collision from services.). 19:59:56 -!- J|x has changed nick to jix. 20:00:04 what was my last msg? 20:00:11 ? 20:00:58 <{^Raven^}> jimbo0000: with wooden marbles and wood.. that would be more "realistic" than wood + water 20:01:08 ok 20:01:21 any replies? 20:01:30 <{^Raven^}> it would probably perform a lot better - i always thought of the water&wood thing as something to do after I tired of the whole world and became a recluse deep in the wilderness 20:01:37 <{^Raven^}> that's all 20:01:46 ok thx 20:02:31 * jix has to learn french 20:04:20 * jix hates learning french 20:05:54 * {^Raven^} gave up learning french after leaving school 20:06:16 * jix is going to give up learning french as soon as possible (in one year) 20:15:24 learned 117 french words today 20:15:58 trained every word about 6 times 20:16:20 <{^Raven^}> good luck with it 20:16:23 ok grammar now 20:16:31 french test tomorrow.. 20:16:43 and i hadn't time to learn earlier... 20:17:19 * {^Raven^} has said. "I have been eaten by my dinner..." at least once 20:17:43 lol 20:18:22 we hadn't passive constructs yet 20:19:21 but french is a lot easier than german.. so i'm lucky german is my native language and i don't have to learn it :] 20:19:54 german is not my native language 20:19:59 and i still don't have to learn it :D 20:20:12 lament: yes but you can't speek german i can :p 20:20:33 pffft 20:20:39 who would you speak german with? 20:21:05 lament: my friends... there are whole irc networks full of german users 20:21:18 scary 20:21:26 don't your friends know english? :) 20:21:36 lament: my german friends 20:22:04 and some of them arn't good at english.. 20:22:25 and some of them are really bad 20:22:47 sad 20:24:13 oh and i can read the original documents about Konrad Zuses plan-kalkül 20:24:39 damn you! 20:24:41 the worlds first structured programming language with functions, variables... 20:25:07 and i can write plan-kalkül with my keyboard 20:26:35 but i don't understand the plan-kalkül 20:28:20 that's sad 20:29:03 he starts to talk about plangebäude and plangruppen-bezeichnungen without telling me what the hell plangebäude are? 20:29:30 plangebäude == plan-buildings 20:29:50 plangruppen-bezeichnungen == plan group discriptions 20:31:47 -!- CXI has quit (Read error: 104 (Connection reset by peer)). 20:32:01 hmm ok maybe i should just read on 20:44:08 -!- CXI has joined. 20:44:40 -!- CXI has quit (Read error: 104 (Connection reset by peer)). 20:46:13 -!- CXI has joined. 20:47:22 -!- ZeroOne_ has changed nick to ZeroOne. 20:48:53 -!- CXI has changed nick to CXI_hatesxchat. 20:52:42 jimbo0000: maybe i write a wood-water-gate simmualtor 20:54:45 i know how to build: a And gate.. a And gate with one inverted input... a Not(repowering) gate (using an And inverted one input gate and a Power line) a Buffer(repowering) gate (using an And gate and a Power line) a Xor gate (Using 2 And inv. input and a Or gate) and a Or gate 20:57:33 a simulator... what kind of sim? graphical? physical? 20:57:47 <{^Raven^}> jix: every logic gate can be constructed from NAND gates if you want to get primitive 20:58:08 {^Raven^}: but i want to save wood 20:58:42 and Or,And and And with one inverted input are the simplest gates i know (for building them with wood and for water) 21:00:20 save wood, good for the environment. is there a way to save water too? 21:00:45 yes 21:00:57 you only need as much water as you need to fill the whole "circuit" 21:01:19 and if you save wood and space you save water too 21:01:59 so how did you mean a 'simulator'? 21:02:32 you can see the water flowing in the wooden pipes and the wooden gates moving etc... 21:05:41 mmm sounds like it might look nice in 3d 21:05:54 ok added a 2-bit mux (wood saving) 21:06:56 how many degrees of freedom do all these gates have? and whats the topography of the ground and water channels? 21:09:45 hm? 21:10:07 degrees of freedom? 21:10:19 well, what kind of moving parts are the gates comprised of, are they just solid pieces that rotate? 21:10:19 designd a woodsaving RS-Latch 21:10:42 and as for the water, i guess it needs some kind of gradient to flow, maybe a slight hill? 21:10:51 they are pipes and shelves with holes that can move 21:11:40 jimbo0000: i will include druck(don't know the english word) calculations 21:12:22 pressure? 21:13:09 yea, babelfish says pressure 21:13:33 so these pipes will be closed, with pressure driving the mechanism? 21:13:39 fun event: build those wood and water gates in real life on carts with hoses and stuff. then you could do a live-action esolang thing where you code by pushing the carts around and making connections. 21:13:39 yes 21:14:56 <{^Raven^}> maybe start an amish computing group ;) 21:15:04 {^Raven^}: lol 21:15:22 it'd be a great event at an esolangcon. bring swimwear. :) 21:15:59 <{^Raven^}> especially is the patricipants were used to represent bits ;) 21:16:26 stdout could be a large firehose and the screen could be the audience. 21:16:51 but i think the marble approuch is easier to build 21:17:01 <{^Raven^}> of course that would me a long persistance display 21:23:12 /away 21:28:25 BigZaphod: awesome 21:31:39 -!- CXI_hatesxchat has quit (Read error: 104 (Connection reset by peer)). 21:32:34 -!- comet_11 has joined. 21:42:22 -!- comet_11 has changed nick to CXII. 21:53:52 -!- CXII has changed nick to CXI. 21:59:03 /back 22:11:22 -!- jix has quit (Remote closed the connection). 22:33:47 -!- calamari has joined. 22:33:53 hi 22:39:55 <{^Raven^}> hi calamari ;) 22:41:17 hi raven 22:41:30 I haven't had a chance to look at bfbasic.. working even now 22:41:59 * {^Raven^} goes 'eep'! 22:42:38 yeah.. I do research work at the university, and a paper deadline is approaching quickly 22:43:40 there is one upcoming conference in Scotland, but I dunno if I'll have my name on that paper 22:44:17 <{^Raven^}> sounds potentially very cool, can I ask the subject you are researching? 22:46:38 sure.. we are working on a package installation tool called sotrk. Right now it runs on a research network called PlanetLab, but we are extending it to work on Vservers, bsdjails, etc 22:47:13 Stork shares packages between clients on the machine, reducing disk space usage and possibly memory usage as well 22:47:50 Planet Lab.. I tried to get in on that network once, but since I'm not currentl affiliated with any university.. *sigh* 22:47:52 It also has a keyfile system to allow anyone to contribute packages 22:48:30 I'm not a huge planet lab fan, but hey, I've learned a lot working on this thing :) 22:49:00 calamari: well, never used it, but it looked neat. I was working on a p2p app and that seemed liek a great way to test it. although development has stalled as of late. 22:50:11 zaphod: the problem with planetlab is that it is continuously overloaded.. but yeah, it's cool in certain ways. I think it's neat how you can appear to have root on a machine when you really dont 22:50:49 I think companies can sign up for planetlab, but it costs $ 22:51:28 oops, sotrk -> stork ;) 22:51:44 hehe, anyways back to work for me 22:51:56 <{^Raven^}> have fun calamari 22:51:56 calamari: have a good one 23:18:35 <{^Raven^}> BigZaphod: how long did taxi take to create? That is one twisted language. 23:18:51 About a week. 23:19:21 I've found a few bugs here and there over the last couple days, though. Uploaded a new version (if you're playing with it). 23:22:10 <{^Raven^}> The source code makes for interesting reading, i especially like the error messages 23:22:10 -!- calamari has quit ("bbl"). 23:23:00 :) 23:23:11 I'm working on a bf interpreter written in taxi.. 23:23:19 lots of pain.. 23:33:09 {^Raven^}: have you tried to do anything with it? 23:33:48 <{^Raven^}> have pondered 99 bottles of beer, but as a thought experiment it was not good 23:34:27 * {^Raven^} still gets lost in GTA:VC 23:34:31 I think 99 wouldn't be too bad once you dug in and got used to it. 23:35:02 lol.. yeah, I've developed a rather heightened sense of left and right now. 23:36:00 I have 283 lines of taxi source which manages to read a single line from stdin and break it down into the bf tokens and tests for each symbol correctly.. now I just have to, ya know, make the symbols do stuff. 23:36:11 the looping frightens me, though. 23:36:17 <{^Raven^}> diagonal directions, hills and valleys would be a suggestion for Taxi++ 23:36:48 <{^Raven^}> a BF terp sounds scary, but atm you're probably the only person capable 23:37:56 probably atm, yeah. with whirl it is funny because I can hardly do anything with it even though I made it. tokigun is by far the biggest whirl expert I know of. 23:40:31 this bf interpreter is quite slow.. does no computation yet but it still manages to take several seconds to process a 50 or 60 character input string. that's on my 1.66ghz powerbook. scary. 23:41:38 <{^Raven^}> your taxi interpreter could pre-parse and compile programs into something faster to interpret 23:43:05 no doubt. it half does at the moment. it parses all the commands up front and builds a list with the command code, but the data is kept as strings and everything is looked up while it is running. 23:43:45 plus it does all the math for determining left and right at run time as well, which in theory it wouldn't need to. 23:44:20 <{^Raven^}> you could tokenise the strings to single byte values 23:45:02 <{^Raven^}> and precompute destinations before execution 23:45:26 yeah that would probably help a lot. 23:46:06 <{^Raven^}> even with brainfuck such things can make a huge difference to execution speed 23:47:01 of course if the language was slightly more sane to begin with, that'd help too. ;) 23:48:24 one of these days I want to try to make a compiler for one of my languages using http://llvm.cs.uiuc.edu/ or something. never done that before. 23:51:18 ( assuming I'm even understanding LLVM correctly :) ) 23:52:06 <{^Raven^}> that looks like a very interesting tool chain 23:55:17 I read someplace it is quite easy to use for compiling simple languages or something. figured it'd make a perfect tool for a fun esolang someday. 23:55:56 somewhere I ran across a sample that implemented a forth variant compiler using LLVM. 23:56:05 looked pretty cool. 23:56:46 * {^Raven^} will learn some more about llvm 23:57:28 * {^Raven^} needs to create an esolang 23:57:46 hi all 23:57:53 hi yrz\werk. 23:57:55 someone checked out hcbf? 23:57:59 <{^Raven^}> hullo 23:58:17 i didn't post the interpreter yet 23:58:31 hypercubes hurt my brain as I always try to visualize them. 23:58:33 but i don't know *WHERE* to host the tar.gz 23:58:50 BigZaphod: no way to visualize. 23:59:10 yrz\werk: my brain refuses to listen to me when I say such things. 23:59:14 just *abstract* 23:59:37 BigZaphod: will help you if i change it to be 5-n ? 23:59:49 oops 23:59:52 5d