00:11:15 -!- DHeadshot has joined. 00:17:52 -!- augur has quit (Remote host closed the connection). 00:20:42 -!- SgeoOnLessDenseW has changed nick to Sgeo. 00:20:57 If a shirt says to machine wash warm, there's no harm in machine wash cold'ing it, is there? 00:21:11 correct 00:21:32 except that certain stains won't come out as well on cold (but that has nothing to do with the particular fabric type) 00:21:38 and other stains will come out better on cold 00:22:07 i'm a simple man with simple clothes and I wash them all together on warm and it's working out p. well 00:22:34 All my shirts except one say machine wash cold 00:22:41 So I'll go ahead and machine wash cold 00:25:09 good judgment call 00:30:17 Huh. About 3/4 of my shirts say warm and 1/4 say cold. 00:31:17 shachaf: I'm trying to figure out what "I,I drop shipping" might mean. 00:31:23 Then wash it separately. 00:31:44 Is "drop" the verb or the noun? Is "I" the first-person singular pronoun? Is "I,I" an ordered pair? 00:32:29 Is this "shipping" as in the conveyance of goods, or as in the... what do you call it. 00:32:45 The imagination of relationships? 00:32:58 istr being told here recently that I,I means "i have nothing to say, i just like saying" 00:33:13 or thereabouts 00:33:17 "I have nothing to say, I just like saying drop shipping"? 00:33:22 yeah 00:33:31 Like "I just like saying 'drop shipping'"? 00:33:36 Makes sense, I guess. 00:33:42 the "say" possibly was something else. 00:33:49 but not much more meaningful. 00:34:16 tswett: well the louisiana purchase _did_ look a bit like drop shipping 00:34:34 What is drop shipping, anyway? 00:34:39 Is it when you convey goods by dropping them? 00:35:21 "Drop shipping is a supply chain management technique in which the retailer does not keep goods in stock, but instead transfers customer orders and shipment details to either the manufacturer or a wholesaler, who then ships the goods directly to the customer." hth 00:36:55 ts ts ts ts ts ts ts ts ts DROP SHIPPING WUBBBBBBBwubwubwubKZZZZZZZkzZWUBWUBWUBwubwubwub 00:37:16 is kmc quoting lyrics again 00:37:24 dubstep: a lyric 00:49:26 I,I I,I 00:54:30 forkIO $ join . atomically $ x >>= readTVar >>= \x -> check (x==0) >> return (putStrLn "Is zero.") Either the STM implementation knows to not resume the thread until the TVar changes, or it doesn't check very often 00:54:45 it knows 00:54:51 Cool 00:54:51 that's the essential idea of STM 00:55:02 -!- variable has changed nick to constant. 00:55:15 Well, the condition is pure 00:55:17 :t atomically 00:55:19 Not in scope: `atomically' 00:55:30 So there shouldn't be any reason why it shouldn't know 00:56:24 Doesn't know the specific TVar under question, or does it treat all TVars touched by that time as suspect? 00:56:38 well, it doesn't even care about "check". 00:56:44 it cares about "readTVar" 00:57:08 i don't know that I'd say it's the 'essential idea', but it's p. important 00:57:31 i thought the essential idea of STM was the check state -> do transacation -> check consistency thing 00:57:34 or something 00:57:37 @hoogle atomically 00:57:38 GHC.Conc.Sync atomically :: STM a -> IO a 00:57:38 GHC.Conc atomically :: STM a -> IO a 00:57:38 Control.Monad.STM atomically :: STM a -> IO a 00:57:39 elliott: also why are you still +o don't you know that it raises the Channel Temperature™ 00:57:41 well the "essential idea" is composition 00:57:48 Bike: it depends on whether you mean the user's or implementor's point of view 00:57:51 kmc: oerjan hasn't added me to the access list yet! 00:57:53 kmc: oh you think that's dumb too huh 00:57:59 need to be prepared for them trolls 00:58:07 :o) 00:58:07 Bike: channel temp? nah, it's probably fine advice 00:58:14 o 00:58:41 mainly I like it when people aren't +o all the time because then when they give themselves +o it's like WOAH SHIT JUST GOT REAL 00:58:41 elliott: wait i thought you were +o to handle Gregor's voice 00:58:48 haha, true 00:58:57 i always imagine it as the sound of a pump action shotgun being cocked 00:59:00 XD 00:59:09 motherfucker you'd best step off 00:59:18 like a sheriff walking out from around the corner, holding his handgun 00:59:20 "settle down, boys" 00:59:39 like in a cowboy movie 01:00:37 oerjan: yes. 01:00:44 oerjan: consider: someone might come in and demand Gregor have an incorrect voice state. 01:00:53 that would be rather disruptive 01:01:02 yes 01:01:16 i think this is stretching things a bit. 01:01:29 no, it's a reasonable concern 01:01:37 oerjan: i have special domain-specific knowledge that i bring to this team 01:01:47 kmc: i like it most when multiple ops go +o within seconds of each other 01:01:56 and then there's the slight tension as they try to predict whether the other one will act first 01:01:59 is that like a mexican standoff 01:02:01 so it takes a few seconds longer for anything to happen 01:02:28 you need less scrupulous ops 01:02:29 kmc: it's like a mexican standoff except they're all shooting the sae guy 01:02:34 aka a firing squad maybe 01:02:40 yeah 01:02:42 a nervous firing squad 01:03:15 Nervous Firing Squad, kmc's other band 01:03:48 kmc has a lot of bands 01:04:31 i recently read that quisling's firing squad had to replace one member who lost his nerves 01:06:19 are we talking literal nerves 01:06:23 "whoops they fell out" 01:06:34 i do not think so 01:06:44 demyelinating diseases are no laughing matter 01:07:26 i do not think they would admit people with such a disease into the police. 01:08:00 ableist 01:08:08 Bike: what if I laugh in the face of death, generally speaking 01:08:33 and what if he then answers DO SOMETHING ABOUT YOUR HALITOSIS 01:18:16 "In a February 2005 article in The Times, Julie Burchill argued that use of the word is a form of "social racism", and that such "sneering" reveals more about the shortcomings of the "chav-haters" than those of their supposed victims." -- WP:Chav 01:18:20 seriously 01:18:25 is that the level we're at 01:18:33 that we're calling it 'social racism' now 01:18:51 like, by analogy with 'gender racism'? 01:18:53 it's like classism, except... 01:19:03 NOBODY GETS HURT 01:19:03 and sexual orientation racism? 01:19:46 or race racism 01:19:47 "Gay" is the best race. 01:20:00 does 'classism' just sound too old-fashioned as a word 01:20:06 BBC tells me that Britain has 7 classes now 01:20:08 it sounds marxist 01:20:12 each classier than the others 01:20:34 istr there was something very stupid in that article but i forget what it was 01:20:36 "Actually the whole point of an interpreter was portability and abstraction" talking about programming languages is suffering 01:20:48 also I learned that the Daily Mail has a section called "Femail" which is all about condescending to women and is even worse than the regular Daily Mail 01:20:56 that's an impressive feat 01:21:01 i know, right? 01:21:15 i'm sceptical 01:21:26 maybe it's not really worse, because it's more vapid and pointless 01:21:34 i dunno 01:21:40 i mean the rest of the daily mail is technically responsible for the ongoing measles epidemic in swansea 01:21:44 what 01:21:50 well i have to check it out now 01:21:53 Phantom_Hoover: oh? 01:21:57 well they were one of the big promulgators of the mmr scare 01:22:02 ugh 01:22:07 anti-vacciners? 01:22:09 mercury vaccines or something else? 01:22:13 no 01:22:20 mercury vaccines is an american thing 01:22:43 the british version is that MMR is what gives your children autism 01:22:47 «'I wish IVF had never been invented' It's brought joy to so many. But, as the scientist behind IVF dies, Samantha Brick says it's given her nothing but heartache...» what the heck 01:22:55 Phantom_Hoover: that's a big thing in america too 01:23:03 they claim the mercury causes autism somehow 01:23:14 oh, yeah, wakefield 01:23:16 yes, autism is obviously a popular choice 01:23:18 fuck that guy 01:23:38 (not dr wakefield any more, he got banned from doctoring) 01:23:42 and autism is as bad as hitler and it's worth subjecting your kids to dangerous diseases with a good chance of killing or cripplingn them because /at least it's not autism/ 01:23:50 * Fiora fume -_- 01:23:56 «'I've only had three boyfriends! I'm not interested in serial dating' says actress Tamsin Egerton despite rumours linking her to Singularity co-star Josh Hartnett» good lord 01:24:08 Last thing I heard was that vitamin d deficiency during pregnancy causes autism 01:24:14 i guess being a parent of an autistic kid is terrifying and heartbreaking and you'll grasp desparately for anyone to blame or any supposed cure 01:24:54 i think autism is "heartbreaking" mainly because most people have no fucking idea what it is 01:24:55 anxiety over autism scares in pregnancy causes autism 01:25:05 kmc: they definitely should never, like, ask the kids how they feel 01:25:18 well at one end of the spectrum you can't right 01:25:22 because the true victims are the poor parents 01:25:23 because the kids never talk, ever 01:25:23 "YouTube star who rose to fame after hilarious drunk makeup tutorial now has more than one billion hits and 8.2 million subscribers" 01:25:27 Fiora: um i heard autistic kids don't have emotions 01:25:29 100% science fact 01:25:44 from the institute of official science 01:25:49 i mean it's not like 'autistic' means 'kinda socially awkward guy on reddit' 01:25:56 He loves impersonal sex, should I worry? 01:26:09 impersonal sex 01:26:14 impersonational sex 01:26:16 is that like sheet with a hole sex 01:26:21 ghost sex 01:26:22 sorry, I have feelings about this <_> 01:26:37 kmc: well it's disingenuous to imply that "autism" in general refers to extreme cases 01:26:38 ok i'm doing it i'm going to read this article 01:26:41 or at least look at it. 01:26:55 elliott: sure, I think we can agree that it's a spectrum and people are complicated and Blah Blah 01:27:40 "My partner of four years often asks me to lie still in bed, as if I’m asleep, while he makes love to me. He is particularly turned on if I’m lying on my tummy. 01:27:41 and in general it is widely interpreted as "autistic people cannot X" when what it actually means is "autistic people X differently but my perspective is too blinkered to understand it, isn't it tragic" 01:27:43 Read more: http://www.dailymail.co.uk/femail/article-2305384/Rowan-Pellings-sex-advice-column-He-loves-impersonal-sex.html#ixzz2QUW4WnFA 01:27:49 elliott: yeah 01:27:54 it doesn't even mean that 01:27:58 all the same nerds focus on the least extreme manifestations, ime 01:27:58 I know a couple of guys with aspergers 01:28:02 it means "some people described as autistic do X differently" 01:28:11 "autism" is a description, not a disease 01:28:11 I think 01:28:23 I'm magnetic to people with aspergers for some reason 01:28:35 you may already be... an internet user 01:28:36 imo most psychiatric 'diseases' are essentially 'descriptions', i'm not sure how you would distinguish them 01:28:40 Fiora: yeah, I was generalising (I have a professional™ official™ aspergers diagnosis™) 01:28:42 Also, I can't tell they have aspergers unless they tell me 01:28:47 http://fioraaeterna.tumblr.com/post/47935156276/hedgehoglike-this-post-is-some-personal <-- this is a good post 01:28:50 or maybe it was one of the fancier autism diagnoses, I don't actually remember 01:28:57 generalising, simplifying, whatever 01:28:58 elliott: I'm PDD-NOS, yay 01:28:59 "same thing" 01:29:00 Fiora, egotist 01:29:03 kmc: certainly they're not something you can "cure". 01:29:21 especially something developmental, come on people. 01:29:22 -!- Tod-Autojoined2 has changed nick to TodPunk. 01:29:22 it depends, mostly not tho 01:29:36 it means development is different. you can't just erase years of that. 01:30:14 "The key thing is that you say your boyfriend is a kind, salt-of-the-earth type — not a brooding Marquis de Sade. 01:30:17 Read more: http://www.dailymail.co.uk/femail/article-2305384/Rowan-Pellings-sex-advice-column-He-loves-impersonal-sex.html#ixzz2QUWiWiFo 01:30:20 ugh fuck 01:30:24 what have i done 01:30:36 right i'm done now 01:30:39 back to the mental 01:30:43 Fiora, i like how ~the autism spectrum~ is, like, a general breakdown of human psychological traits 01:30:55 well it is 01:31:07 Phantom_Hoover: that's because "autism" is a description/pathology of human psychological traits <.< 01:31:39 or rather the point of the Pink Floyd diagram is to show how the developmental differences result in different levels for psychological traits 01:31:40 it seems so hopelessly general... 01:31:54 mental illness is like that 01:32:12 you threaten suicide so they put you on meds that have suicidal ideation as a side effect 01:32:12 whats cool to me is that some genes reliably result in autism 01:32:15 minds are weird 01:32:17 * Sgeo was diagnosed with Asperger's. At least, according to my dad. 01:32:27 It was kept a secret from me for a long time. 01:32:30 I think generally "autism" is diagnosed by some more specific symptoms, rather than generalized things? like stimming and the sensitivities and so on 01:32:37 Bike: i like how the daily mail has javascript to make people link to the daily mail when they quote them mockingly 01:32:37 Sgeo, oh my god 01:32:56 I'm not an expert though or anything 01:33:04 elliott: i have contributed a twentieth of a cent to their coffers ;_; 01:33:54 Sgeo: ... 01:34:03 the major thing to remember about diagnoses i think is that there's a criterion, explicit or implicit (because you wouldn't seek mental help), of "impairs normal function" 01:34:23 if you see dancing elephants but still have a fairly normal life you might never walk to the doctor and find out 01:34:51 Bike: sort of gets trickier when there are children involved (which i think is the case for the majority of autism diagnoses?) 01:34:53 Bike, there is a rich vein of Sgeo coming to the surface 01:35:13 diagnostic criteria aren't some kind of rubric to fulfill, they're basic guidelines for psychiatric professionals to figure out what's good for an individual patient 01:35:20 suggest we focus on this 01:35:21 elliott: oh, sure. 01:35:26 'Autism' was on ... some paperwork, and when I saw it, my parents said something about them lying to the school to make sure I had services. I thought I only had ADHD. I guess they were both lying to the school and to me... 01:35:29 Autism, by merit of being a developmental disorder, tends to have much greater *impact* when you're younger. 01:35:39 Sgeo..... 01:35:41 I'm really not comfortable making fun of Sgeo for being autistic, if that's what you're alluding to. 01:35:48 no, Bike 01:35:54 that... is not what i am alluding to 01:35:57 ok 01:36:04 Like, now I broadly resemble normality for certain definitions thereof. 01:36:12 But when I was 3 I couldn't speak. At all. 01:36:21 I didn't speak until I was um... about 3 and a half, I think 01:36:24 I'm comfortable making fun of Sgeo but I don't know any jokes 01:37:30 i like how the world's largest autism charity literally wants to get rid of autistic people 01:37:37 THX 4 THA SUPPORT 01:37:41 i think i could talk when i was two but i was, like, raised by a crazy nanny from the highlands 01:37:43 elliott: yeah ;-; 01:37:47 Yeah, those guys are assholes. 01:37:57 -!- conehead has quit (Ping timeout: 276 seconds). 01:37:58 and they literally have no autistic people working for them 01:38:07 As a matter of policy no less. 01:38:15 wow 01:38:25 Fiora: can't have crazies working for your serious charity obvs 01:38:26 I had an aspy friend who did stuff for them, I think 01:38:40 and just for the record vaccinations have no relation to autism 01:38:45 of course not <_> 01:38:48 thanks doesthiswork 01:38:53 i wasn't sure 01:39:11 doesthiswork: But but thimerosol! 01:39:28 thiomersal you UNEDUCATED FUCK 01:39:33 Does Autism Speaks actually promote anti-vax garbage? 01:39:39 Sgeo: No. 01:39:50 They're assholes, not utterly ignorant assholes. :P 01:40:20 pikhq_: http://en.wikipedia.org/wiki/Autism_Speaks#Position_on_vaccines 01:40:22 well, http://en.wikipedia.org/wiki/Autism_Speaks#Position_on_vaccines 01:40:29 (they're utterly ignorant assholes) 01:40:32 wow Bike how dare you 01:40:32 Oh, never mind. 01:40:34 stealing my link 01:40:37 fuck off elliott 01:40:38 Phantom_Hoover: several hundred messages ago is too far to read 01:40:40 can i kick you for that (i am asking because i am responsible) 01:40:42 Well, fuck them. 01:40:50 elliott: what's my optimal kicked status 01:40:55 I read about Autism Speaks somewhere, and someone made up "Neurotypical Speaks". 01:41:03 wow, that sounds even worse! 01:41:11 Bike: like maybe half kicked? 01:41:12 can we achieve that. 01:41:15 hm 01:41:17 There was a parody site called ISN'T somewhere 01:41:18 only one way to find out 01:42:20 Bike: woooow 01:42:23 they're even worse than I imagined 01:42:42 http://www.sentex.net/~nexus23/naa_03.html here have a large repository of complaining about such things 01:42:44 hey guys i havent been paying attention whatd i miss 01:42:56 Autism and nothing but. 01:42:57 shittiness 01:43:17 hey 01:43:21 the daily mail also 01:43:30 Sounds more like wasting money than spreading the bad idea? 01:43:31 oh wait you were here for that 01:43:33 Phantom_Hoover: wow, i've never seen "behaviourism" used in that sense... 01:43:33 n/m 01:43:52 pikhq_: sounds miserable 01:44:04 Sgeo: as it alludes to, having a big organization taking that shit seriously gives parents more cause to believe that shit. 01:44:04 Perhaps we should discuss butts instead. 01:44:07 even worse 01:44:12 let's go back to autism :-) 01:44:20 buttism 01:44:33 maybe the wonderful stereotypes, like how autistic people don't have empathy 01:44:52 Oh, those are *grand*. 01:50:21 -!- Jafet has quit (Read error: Connection reset by peer). 01:50:51 @ask fizzie is oklopol real 01:50:51 Consider it noted. 01:51:44 -!- Jafet has joined. 01:53:03 oklofok: hi 01:53:50 folk?? 01:54:18 whoah, oklofok backwards is kofolko 01:56:39 and oklopol backwards is lopolko! who'dve guessed 01:56:48 folk and polka 01:56:50 blowin' my mind here 01:56:59 Well, I'm stupid 01:57:13 Bike: man have you even been around when oklofok has been active. you're missing out on so much cultural enrichment 01:57:13 Unlikely 01:57:18 How do I make a LIFO data structure in haskell? 01:57:34 ...a stack? 01:57:40 wait no that's backwards isn't it 01:57:41 No, stacks are fifo 01:57:43 god i hate the lifo fifo thing 01:57:58 You can use lists for fifo 01:58:55 http://cvs.haskell.org/Hugs/pages/libraries/base/Data-Sequence.html has enough for queueing, i guess 01:59:30 yeah Seq is a fine queue 01:59:36 i mean wouldn't it be basically the same as in any language 01:59:37 even a fine deque 01:59:59 Bike: well in most languages the expectation is that you'd be mutating a structure, not producing a new one 02:00:08 yeah but past that. 02:00:19 you can make mutating data structures in Haskell, and you can (and should) make persistent immutable data structures in other languages 02:00:23 but the default is different 02:00:28 Bike: ok bike. i know you're a bicycle 02:00:34 hello 02:00:34 but if the url has /Hugs/ in it 02:00:36 Bike: it's a pretty deep difference 02:00:38 you're linking to something from 2006 02:00:47 see Okasaki, _Purely Functional Data Structures_ 02:01:02 http://hackage.haskell.org/packages/archive/containers/0.5.2.1/doc/html/Data-Sequence.html 02:01:07 elliott: it's two seconds of googling. 02:01:30 you should see the number of people that join #haskell and ask about why they can't find a function in some random ancient version of a package's docs :( 02:01:38 * elliott old, weary 02:01:41 No, stacks are fifo <-- um no you _are_ getting this backwards. 02:01:44 if you want amortized time guarantees on persistent data structures then you actually need laziness in order to avoid duplicating work between different 'timelines' 02:01:55 it's kind of neat 02:02:16 oerjan: If I push something onto a stack 02:02:17 elliott: hello, so has glasgow university gone anywhere with that language implementation? 02:02:19 And then pop 02:02:24 I get exactly what I just pushed 02:02:25 FIFO 02:02:31 FreeFull: you push 1, you push 2 02:02:32 FreeFull: try pushing two things 02:02:32 you pop, you get 2 02:02:36 i heard it was lazy 02:02:38 you pop, you get 1 02:02:46 you pushed 1 first and it came out last, hence FILO 02:03:02 Bike: they got sold out to microsoft at some point 02:03:04 elliott: Oh, right 02:03:06 seriously though what's the point of the fifo thing, i learned that in boringclass but i don't think it particularly helped 02:03:08 push 1 -> push 2 -> pop (1) -> pop (2) would be FIFO, because you pushed 1 first and got it out first 02:03:10 Jafet: micro$oft 02:03:37 Bike: FIFOs are for buffers and pipes and stuff 02:03:39 Microdollaroft 02:04:06 I know the point. I don't know why you'd move out that description from just general data structure everything. 02:04:07 And simple caches 02:04:21 Ok, so stacks are LIFOs, what's a simple FIFO 02:04:28 a queue 02:04:34 (ue?) 02:04:52 qeuue 02:04:56 > (++"ue") `iterate` "Q" 02:04:57 ["Q","Que","Queue","Queueue","Queueueue","Queueueueue","Queueueueueue","Que... 02:04:59 q 02:06:04 > iterate (++"ue") "Hue" 02:06:05 ["Hue","Hueue","Hueueue","Hueueueue","Hueueueueue","Hueueueueueue","Hueueue... 02:06:19 -!- augur has joined. 02:06:24 -!- augur has quit (Remote host closed the connection). 02:06:45 I mean, a cons list is a simple LIFO 02:07:04 yes 02:07:19 a singly linked list is basically a stack 02:07:23 But I can't think of how you'd declare a datastructure that'd be a FIFO 02:07:35 doubly linked list, keep both ends 02:07:54 yeah, you can't make an efficient immutable structure that way though 02:07:58 you have to copy the whole thing on each step 02:08:12 a classic immutable/persistent queue structure is composed of two lists 02:08:17 i haven't used enough queues to care about how to do it immutably :c 02:08:19 I don't want to use a list and do two reverses each time or whatever 02:08:43 http://stackoverflow.com/questions/69192/how-to-implement-a-queue-using-two-stacks 02:08:59 or you could fill a circular buffer 02:09:15 that basically does an O(n) reverse only once every n operations, so it's amortized O(1) 02:09:36 but this doesn't hold up when you're allowed to hang onto an 'old version' of the structure and use it over and over 02:09:40 FreeFull: the finger tree used for immutable (de)que(ues) in Data.Sequence are quite insanely clever, much more complicated than a list. but i've read they're still quite efficient. 02:09:44 working around that is basically what Okasaki's book is about 02:09:49 *trees 02:09:54 for the double list queue, then for more complicated things 02:09:58 Finger trees are crazy 02:10:01 edwardk has a good talk about finger trees 02:10:39 i think the problem with finger trees is that they are boring 02:10:47 they're so easy 02:10:47 they are good at everything but they're never excitingly good at anything 02:10:56 elliott: Monads are boring and look at all the hype 02:11:04 :/ 02:11:29 elliott: dunno I think the annotated ropes in trifecta or whatever are p. exciting 02:11:44 well i mean like from an efficiency pov 02:11:49 finger tree sequences of big unboxed chunks of text, annotated with source positions and what not 02:13:36 elliott: i was surprised to read that finger trees are more efficient than that pair of lists thing 02:14:06 for zippers? 02:14:15 for queues 02:14:22 ah 02:14:33 but basically for anything not efficient with a single list 02:15:57 elliott just can't stand the numbing genericity 02:16:10 which means that there's basically little reason to avoid Data.Sequence 02:16:59 once a single list doesn't fit 02:17:10 I should learn what finger trees are 02:17:12 -!- conehead has joined. 02:17:59 Sgeo: http://apfelmus.nfshost.com/articles/monoid-fingertree.html 02:20:08 apfelmus is pretty awesome 02:20:15 I should read more of eir articles 02:21:13 what's "apfelmus" mean 02:22:54 what's "Bike" mean 02:23:04 it's an abbreviation for "bicycle" 02:23:11 so called because it has two cycling wheels 02:23:25 Mother of God... 02:23:27 what's "monqy" mean 02:23:33 what's "Sgeo" mean 02:23:41 `? monqy 02:23:46 dunno about no sgeos, though. 02:23:48 The friendship monqy is an ancient Chinese mystery; ask itidus21 for details. 02:23:58 haskell report says 'The results of exceptional conditions (such as overflow or underflow) on the fixed-precision numeric types are undefined; an implementation may choose error (_|_, semantically), a truncated value, or a special value such as infinity, indefinite, etc.' 02:24:03 Gregor: did i just blow your mind 02:24:07 does this allow actually Undefined Behavior in the C sense 02:24:12 kmc: ieee floats are for suckas 02:24:13 Bike: Yup. 02:24:20 kmc: i think that's just implementation-defined behaviour 02:24:28 breaking type safety, preceeding code optimized out, flying monkeys out of ass, etc 02:24:33 yeah, I think so too 02:24:39 Haskell Report is frustratingly vague sometimes 02:24:41 kmc: that is very interesting though -- it means Int32 can contain a value representing infinity 02:24:44 kmc: well it has a pretty simple list there though 02:24:46 how weird is that 02:24:54 truncation, bottom, a special 02:25:01 Bike: "etc." 02:25:07 "etc" 02:25:11 pretty sure that's referring to the special values 02:25:18 (language lawyer GO) 02:25:22 ianal 02:26:12 «(slang) A promiscuous woman; from “the town bike (everybody rides her)”.» btw this is me 02:26:18 I, anal 02:26:19 ^5 02:26:29 «(Scotland, Northern England) A nest of wasps or hornets.» wait no this one 02:26:44 a promiscuous nest of wasps 02:26:53 yes. that is me. 02:26:54 perfect 02:26:57 http://orangecounty.craigslist.org/zip/3739834928.html 02:26:59 Gregor: what do you feel your optimal voiced status is right now 02:27:18 That's weird though, I woulda thought "bike" would come up in that 18th-century Scottish insect biology book i read 02:27:54 elliott: +½v 02:28:00 Gregor: hmm 02:28:11 Gregor: does that mean I should devoice you for a while and then turn it back on? 02:28:30 Maybe you could find someone who's like the anti-gregor, but not entirely, and voice that personinstead of Gregor. 02:28:31 You could mute hackego 02:28:33 set it up so blah blah blah radioactive devoices him 02:28:44 then don't look at the user list for a while 02:28:51 -!- conehead_ has joined. 02:29:00 kmc: gallons of bees. 02:30:10 Bike: wouldn't that be -1v 02:30:19 or something 02:30:23 elliott: Well, how low-quality microwaves at half power level work is by rapidly toggling between fully on and fully off. 02:30:33 -!- Koen__ has quit (Quit: The struct held his beloved integer in his strong, protecting arms, his eyes like sapphire orbs staring into her own. "W-will you... Will you union me?"). 02:30:36 Gregor: right but... we can't go too rapid 02:30:36 So I think my +v status should be toggling, say... oh, fifty times a second? 02:30:37 elliott: no he's not /entirely/ anti gregor 02:30:39 it would be a bit spammy! 02:30:44 wait i guess you'd need to keep gregor voiced too 02:30:46 voice someone who is half like gregor 02:30:48 gosh this is hard 02:30:54 hm 02:30:57 who is kind of like gregor 02:30:59 -!- conehead has quit (Ping timeout: 252 seconds). 02:31:00 -!- conehead_ has changed nick to conehead. 02:31:02 pikhq? 02:31:04 conehead 02:31:11 kmc 02:31:13 what's "apfelmus" mean <-- mashed apples hth 02:31:14 ? 02:31:30 pikhq works sure 02:31:35 who's not at all like gregor 02:31:37 how do you feel about being voiced, conehead 02:31:51 elliott: listofoptions 02:31:55 (wow, /names is weird) 02:32:02 I would find it incredibly strange 02:32:06 I suggest jix. 02:32:06 hm 02:32:10 oh good idea 02:32:12 elliott, Phantom_Hoover: here's case law regarding employers testing for 'intelligence': http://en.wikipedia.org/wiki/Griggs_v._Duke_Power_Co. 02:32:13 -!- elliott has set channel mode: +v jix. 02:32:38 yes, i feel peace and balance 02:32:49 we can all breathe easy 02:32:52 kmc: lol that quote. 02:33:08 looks like it's a pretty narrow prohibition, only for 'artificial, arbitrary, and unnecessary barriers to employment when the barriers operate invidiously to discriminate on the basis of racial or other impermissible classification' 02:33:25 `seen jix 02:33:28 @wn invidiously 02:33:29 *** "invidiously" wn "WordNet (r) 3.0 (2006)" 02:33:29 invidiously 02:33:29 adv 1: in a manner arousing resentment 02:33:31 not lately; try `seen jix ever 02:33:34 `seen jix ever 02:33:46 2012-06-29 15:54:12: zzo38: but if you keep the addition and comparision instructions (maybe with an annotation to mark them as belonging together (if llvm does support this)) you wouldn't break existing passes 02:33:57 kmc: probably it's not that common to bother administrating IQ tests 02:34:21 2012? that's pretty long time ago. 02:34:50 kmc: i actually like that majority opinion quite a bit 02:34:56 it would be pretty amusing for someone to claim that e.g. algorithms / puzzle questions in programmer interviews are "artificial, arbitrary, and unnecessary" 02:35:20 Arousing Resentment is definitely going to be the name of my next band 02:35:24 «good intent or absence of discriminatory intent does not redeem employment procedures or testing mechanisms that operate as "built-in headwinds" for minority groups and are unrelated to measuring job capability» 02:35:24 but are they invidious 02:36:12 i do think the traditional programming interview is hostile to some underrepresented groups 02:36:16 how do you measure arbitrary 02:36:21 not sure if a legal injunction is the right remedy 02:36:29 mnoqy: in milliarbitrons 02:36:37 probably a culture change 02:36:44 probably a programming interview is hard with no hands or mouth 02:36:45 maybe just get employers out of their own asses? 02:37:17 iunno i'm unemployed why would i talk about this 02:37:42 * Sgeo thinks that "it's not what you know it's who you know" should really be fixed 02:37:51 is that a thing 02:37:56 you're like a job expert now right 02:38:02 it is 02:38:26 oh it's definitely a thing. 02:38:30 How many problems would go away if job interviews were conducted over a chat medium? 02:38:37 why do you think you need to provide references? 02:38:39 With no name but instead an identifier code 02:38:46 i would like to proffer the controversial opinion that all of the ills of the world should be corrected, esp. as pertaining to globalised capitalism 02:38:51 often some level is, but you really need to know if you can work with this person in person 02:38:57 don't hate me for having unpopular opinions!!! 02:39:12 elliott: do you have a newsletter i can subscribe to 02:39:25 Bike: irc://irc.freenode.net/esoteric 02:39:34 do you have a radio program 02:39:41 Sgeo: of course that wouldn't fix the proble of people from some backgrounds not applying at all 02:40:03 i considered making another connection to freenode but that would be a shitty joke. 02:40:05 * Sgeo ... has never thought of that 02:40:14 advertize it as being a fun time for everyone? see everything has a solution 02:40:21 Sgeo: i bet CableVision doesn't get a lot of nicaraguan applicants, you know? 02:40:26 you can make, like, a mural 02:40:30 Just of eliminating subconsious discrimination during the interview process 02:40:33 chat is also not necessarily better for everyone 02:40:33 representing people of every minority group 02:40:46 just as in-person interviews with a white board are not necessarily good for everyone 02:40:50 and in rainbow letters you can say 02:40:50 like 02:40:54 `rainbow DIVERSITY 02:41:07 i have no idea how hackego works. srry 02:41:08 Bike: re hostile to some groups, I think one problem is that programming jobs are typically advertised as "ARE YOU THE BADDEST MOTHERFUCKING HAXOR OF ALL TIME?!? WELL PROVE IT!" and this is a huge turn-off to anyone who's already dealing with impostor syndrome due to membership in a underrepresented group 02:41:18 "it doesn't matter if you're weird. we love everyone." 02:41:22 elliott, hmm. Was thinkng too that maybe some sort of intermediary. So that broken English, if it is still understandable, is not discriminated against 02:41:25 No output. 02:41:30 kmc: ha, ha, twenty somethings? 02:41:40 `run echo diversity | rainbow 02:41:41 ​diversity 02:41:46 peopl;e can type perfectly broken just look at anyone ever who types broken 02:41:51 that's pretty blue, hackego. 02:41:55 Sgeo: do you have a perfectly spherical cow to go with your unbiased, incorruptible intermediary :P 02:41:57 so the remedy there is both fixing the culture to remove this dumb marketing, but also fixing the educational pipeline so that confidence is more fairly distributed 02:42:31 Sgeo: i hope you don't need to be told how negative non-prestige English can be seen, no matter how understandable 02:42:37 kmc: i'm the baddest motherfucking haxor of all time. god damn i am bad at hacking. please hire me for sucking 02:43:02 Bike, hence a person in between who fixes non-prestige English into prestige English 02:43:10 that 02:43:10 "fixes" 02:43:12 i feel like impostor system is symptomatic of a bunch of broader cultural factors than just general equality 02:43:13 this is one reason why i <3 OpenHatch, they organize a lot of events that are about helping new people contribute to open source, in a super welcoming environment 02:43:14 but if it's not marketed for rockstars & ninjas who will we get off on making fun of 02:43:18 https://openhatch.org/ 02:43:19 good people 02:43:22 wow that's just a weird thing there, i don't even know how to respond to that. 02:43:26 anyway i repeat my previous line 02:43:27 you should all donate and get the baby penguin shirt 02:43:31 mnoqy: imo The Masses 02:43:49 (fuckers the lot) 02:43:52 shachaf: you should send Sgeo that story 02:43:54 hm, you may be onto something 02:43:54 a perfectly impartial white-person-ifier to go in the middle is... not what i would call a solution 02:44:10 especially since it's not as if all problems are going to magically go away post-interview 02:44:12 imo just wear whiteface to job interviews, problem solved right 02:44:41 send in a robot to interview for you. robots can sound white right 02:44:51 wow that would be depressing. also i suppose it's sort of the norm, for certain values of "whiteface" 02:44:54 stuff white robots like 02:45:05 (btw stuff white people like is super racist, which sucks because it's funny :/) 02:45:18 there's this tumblr blog "nasty shit white people eat" 02:45:28 and i've seen at least four posts that are native Mexican or whatever 02:45:45 fighting the good fight 02:46:02 (i'm not sure if i'd eat burritos with mashed potatoes in them unprompted, though) 02:46:15 internet wars about whether racism against whites is racism are pretty pathetic, imo 02:46:39 kmc, what story? 02:46:49 i don't have the link 02:46:56 mnoqy: it's not that it's racist against whites 02:47:09 racism against everyone else too 02:47:11 it's that it's implicitly racist against non-whites by claiming that reading and culture and such are white things 02:47:14 racism in the large 02:47:26 kmc: oh my. 02:47:28 oh is it one of those blogs 02:47:34 see i was expecting it to be like 02:47:42 (stuff white people like) picture of idk something gross 02:48:03 its a "arent we white people so funny" thing 02:48:04 it's really "stuff upper middle class urbanites like" 02:48:10 ah 02:48:19 isn't that "classist" though 02:48:23 heh heh words 02:48:24 prolly 02:48:29 no mnoqy 02:48:32 it's social racist 02:48:32 can't it just be shitty. it's shitty how about that 02:48:36 lol. 02:48:43 Short of... some sort of panel doing interviews instead of a single person... actually, maybe that's a good idea? 02:48:47 -!- Phantom_Hoover has quit (Remote host closed the connection). 02:48:56 does anyone know why white people smell like dogs when they get wet? google doesn't help me here 02:48:56 Sgeo: i believe that's the procedure for grad school 02:48:59 "that works well, right" 02:49:13 Sgeo: i don't really get this sole focus on the interview process 02:49:14 doesthiswork: chemistry and also biology, probably 02:49:43 doesthiswork: it's an adaptation of our savannah ancestors to drive off predators 02:49:47 Gregor: maybe de-voice jix by now? do you think it's been long enough 02:50:00 Bike: thank you, now I know 02:50:14 anyway the culture thing reminds me that the "[x] people lack history" is probably the racist thing that most infuriates me (as a white person this is an important opinion to have etc etc) 02:50:26 Seems TChan was what I wanted all along anyway 02:50:38 FreeFull: good choice 02:50:44 if you want a mutable channel for use inside STM 02:50:59 if you're not using STM then there's plain Chan 02:51:19 if you find that every line is (atomically $ somePrimitiveTChanOperation) then consider using plain Chan 02:51:20 I am using STM 02:51:23 Bike: do people say that 02:51:24 ok cool beans 02:52:01 mnoqy: back in the colonial days it was pretty common of europeans to claim that africa had been basically the same for thousands of years and had had nothing worth writing down 02:52:10 I'm sure I'm not the first to say this but sinfest just isn't funny anymore 02:52:17 what's sinfest 02:52:39 A webcomic about a webcomic author struggling to deal with his past transgressions 02:52:40 http://www.sinfest.net/archive_page.php?comicID=1] 02:52:50 http://www.sinfest.net/archive_page.php?comicID=1 02:53:18 thanks for... offering your opinion 02:53:22 i think? 02:53:23 when does it get funny 02:53:30 doesthiswork: When was sinfest funny? 02:53:38 mnoqy: 17 02:53:39 where does "sinfest" appear 02:53:42 the first few are pretty funny 02:53:42 Bike: thanks 02:54:19 Bike: that wasn't funny 02:54:27 were you pulling a joke on me 02:54:34 Yes. 02:54:36 LOL 02:54:39 dang it!!! 02:54:54 bike: achebe reported an anecdote indicating that the english people still don't think africa has history. 02:55:22 doesthiswork: yeah it's definitely still around, it was just more explicit back then (as usual with racism, i guess) 02:55:30 as Bike pointed out, many wikipedia history articles are like "natives lived here for thousands of years AND THEN WHITE PEOPLE SHOWED UP " 02:55:32 so are we racisting about "these people are racist" now 02:55:50 what 02:55:51 "we" as a humanity 02:56:00 racisting all night long, baby. 02:56:07 I've always been racist about those people 02:56:19 and "people" as in like singular of "peoples" 02:56:39 yeah i have no idea what you're saying monqy, srry 02:56:48 :(' 02:57:29 according the strunk the proper plural of person is persons 02:57:34 @tell taneb you like english right http://25.media.tumblr.com/341dfc90a788592e8634c9942b186d42/tumblr_ml9yj4I2aA1qhcj5zo1_500.gif 02:57:34 Consider it noted. 02:58:04 what does that have to do with english 02:58:13 his name is english. 02:58:13 lord english maybe? 02:58:15 cute wiggle though 02:58:58 "Rollership/ The revolutionary way/ evolution/ magazine empire /pirate radio/ television channel/ gallery/ encyclopedia/ library/ The Utopians Guide to the Galaxy/ encyclopedia kosmica/ sonic screwdriver of knowledge...about 10,700entries." 02:59:22 put down the bong Bike 02:59:51 holy shit this blog has a hit counter 03:00:09 holy shit this bong has a hit counter 03:00:21 it's so high 03:00:53 https://twitter.com/OTPGlobal/status/266077784974163968/photo/1/large i've hit the jackpot here 03:01:09 i wrote a quick post about some leaked diplomatic cables from ulaanbaatar and now i am stoned as hell 03:01:38 what 03:01:46 stupid future 03:02:04 they're even against water fluoridation 03:02:07 Bike: what a picture 03:02:22 http://25.media.tumblr.com/b60cae94c4bd65d1f61e7b8a21e60915/tumblr_ml8tlzyv3D1qkwdrko1_1280.jpg wake up sheeple 03:04:41 i like how the swastika is on top of hitler 03:04:51 thus combining the potent comparisons of nazism, and nazism 03:05:21 well what if you didn't recognize him. it could be any old guy. but nope with this it's BAM nazifella 03:05:42 double nazism just to be sure 03:06:32 oh yeah the anti-flouride person who posted to the noisebridge list claimed that ALCOA was a subsidiary of I.G. Farben 03:06:41 which would be... remarkable 03:06:58 I don't know what either of those things is 03:07:05 me neither 03:07:16 Alcoa is a big aluminum company in the US 03:07:30 this person had another post that said that now your potatoes could be handled by people wearing protective gear whether you like it or not which obviously tops anything else so i stopped 03:07:36 do americans really pronounce aluminium as aloominum 03:07:46 like i know they do in bugs bunny cartoons 03:07:49 but like in real life? 03:07:55 we do. 03:08:05 goddamn. 03:08:06 well, i do, and i am america 03:08:06 I.G. Farben was a German chemical conglomorate that was involved in numerous crimes against humanity during the Third Reich and was disbanded by the allied occupation govt (we used their big headquarters building as the occupation hq) 03:08:22 but i spell it "aluminium" because that's the IUPAC recommendation 03:08:27 i'm just a shitfucker, i think 03:08:36 kmc: i like the idea that they were disbanded just so the building could be used 03:08:39 "alright, out" 03:08:43 they had a bunch of chemical plants using slave labour (one down the road from Auschwitz-Birkenau) 03:09:07 also they manufactured zyklon b 03:09:44 I think it's "interesting" how there are like japanese health companies founded by unit 731 members, though 03:09:50 ;_; 03:10:29 also some of the Americans who testified at the Nuremberg Trials ended up running parts of MKULTRA and other unethical human experimentation programs 03:11:12 victors' justice :/ 03:12:44 https://soundcloud.com/eutechnik/dialup 03:13:23 Sgeo: http://windytan.blogspot.com/2012/11/the-sound-of-dialup-pictured.html 03:13:54 Listen to my link anyway >.> 03:13:58 i did 03:15:28 dyuu dyuuty, NRRRRRRR 03:16:18 but i don't want to do my duty bike 03:16:45 If I have a transaction where I have modifyTVar count (subtract 1) followed by a blocking call, and other transactions depend on count being larger than 0, should I block before the modifyTVar or will I not get in trouble and the transaction will retry? 03:17:09 the whole transaction happens atomically 03:17:19 it's impossible for code outside that transaction to observe the intermediate state 03:17:29 what do you mean by 'blocking call' though 03:17:31 The blocking only occurs if count is 0 03:17:58 kmc: The thread stops doing anything until something is put in a TChan 03:18:09 that's fine though 03:18:10 And count is incremented too 03:18:25 like i said, other code can't observe the intermediate state 03:18:38 you can think of it like, if it reaches that point and finds the TChan is empty, it aborts the transaction and retries from the beginning 03:18:40 kmc: think you'll ever come back to haskell-land? 03:18:44 except it's more efficient than that 03:18:48 copumpkin: dunno 03:19:10 FreeFull: and I'm not sure if this kind of operational thinking is useful, or if one should just take the guarantees of 'atomically' as given 03:19:12 Why, what is kmc doing? 03:19:22 Sgeo: I haven't done much haskelly stuff lately 03:19:23 talking about haskell outside of #haskell? 03:19:30 i'm probably not returning to #haskell unless it's changed a lot 03:19:31 kmc: Ah, so it retries once the TChan has something, assuming another transaction doesn't make the TChan empty again 03:19:51 not that it's necessarily horrible and nobody should go there, but, i've put in my time :) 03:20:09 So I should just learn not to worry 03:20:27 yeah, the beauty of STM :) 03:20:30 and check (c > 0) is unnecessary 03:20:38 I mean count 03:20:51 kmc, what do you think about School of Haskell> 03:20:52 ? 03:20:54 kmc: i think #haskell is on the road to recovery a bit 03:21:09 FreeFull: if it helps you can look at the implementation of TChan in terms of TVars: http://lambda.haskell.org/hp-tmp/docs/2011.2.0.0/packages/stm-2.2.0.1/doc/html/src/Control-Concurrent-STM-TChan.html 03:21:09 or at least I'd like to think it is and try to make it so 03:21:13 'might not help tho' 03:21:15 elliott: how so? 03:22:03 well, my impression is that some of the common problems are recognised better and that there are people sick enough of them to try and shut them down when they appear. also, there are more active ops now 03:22:10 cool 03:22:16 it can still be pretty awful mind :P 03:22:16 also you're an op 03:22:26 yes, as I said, it can still be pretty awful 03:22:30 elliott rules with an iron fist 03:22:49 /cs clear users 03:22:53 i've restrained myself from kicking like five people!! 03:22:56 i am a zen master 03:23:06 how many of them are cheater 03:23:26 i said people, not nicks 03:23:53 how many of them are the people behind cheater 03:23:57 kmc: Hmm, I didn't expect TVarList 03:24:41 it's the same deal as plain chan I think: http://lambda.haskell.org/hp-tmp/docs/2011.2.0.0/ghc-doc/libraries/base-4.3.1.0/src/Control-Concurrent-Chan.html 03:24:54 two 'pointers' into a linked list of vars 03:25:02 one for reading, one for writing 03:25:45 by 'linked list of vars' i mean data ChItem a = ChItem a (MVar (ChItem a)) 03:26:35 I guess it's more efficient 03:26:52 than what? 03:27:15 two TVars of normal lists 03:27:31 mm 03:27:36 and it gives you the blocking behavior you need 03:27:42 where reads from an empty queue block 03:28:13 it's not always more efficient though... I know Simon Marlow profiled a bunch of different data structures for the GHC IO manager and found that an IORef holding a pure data structure was best 03:28:26 partly due to the fact that atomicModifyIORef is a lockless pointer swap 03:28:42 that's also why you can't really have a strict atomicModifyIORef 03:29:41 You could make the blocking behaviour explicit in readTChan anyway 03:29:46 probably, yeah 03:30:01 It does have TNil -> retry 03:30:03 it's easy in STM because you can just 'retry' whenever 03:30:04 yeah 03:30:08 it's harder for plain Chan i think 03:30:15 is today americans doing their taxes day 03:30:19 yep 03:30:20 there seems to be a lot of that going on 03:30:28 what's a tax. what's a taxes 03:30:38 it has to be in the mail by the end of Monday 03:30:41 I finished my taxes today yay 03:30:47 I am an adult 03:30:49 I swear 03:30:59 kmc: Don't MVars have blocking behaviour too 03:31:11 yes 03:31:15 Fiora++ 03:31:30 Seems to be what Chan relies on 03:31:59 i don't even know what doing taxes entails 03:32:04 except for lots of forms and presumably being bored 03:32:09 i am innocent and pure 03:32:16 I think I actually finished writing the code a while ago 03:32:21 Let's see what ghci thinks 03:33:13 Had one error 03:34:19 elliott: it involves ticking a lot of boxes for random crap 03:34:20 No, I did not renovate a septic system last year. No, I did not invent any medical devices. No, I did not donate more than 30% of my adjusted gross income to a cemetery. 03:34:32 man I did ALL those things 03:34:56 come to america then 03:34:58 we like your kind 03:35:16 imo i don't like your kind 03:35:25 :< 03:35:36 @elliott 03:35:36 Unknown command, try @list 03:35:38 * sucks, * -> * is better 03:36:03 oh i get it 03:36:05 Making new TChans and stuff somehow makes me uneasy inside, despite knowing the garbage collector will get rid of anything once it's inaccessible 03:36:09 by your kind i mean generalised america i think 03:36:12 MAKING A STATEMENT 03:36:13 imo ?? 03:36:20 I blame being used to C memory alloc =P 03:36:57 My brain just goes "Ooh, I'm making a new thing, gotta free it once I'm done" 03:37:03 yeah :/ 03:38:14 Ok, hit only one problem =P 03:38:17 Forgot to increment count 03:38:47 Testing code always a good idea 03:38:48 you need to put count in the type system hth 03:38:57 * oerjan runs away 03:39:04 Fiora: just got confirmation that the carry flag is used in the sbcl runtime for marking multiple values 03:39:19 Bike talked to the sbcl officials 03:39:34 oerjan: how will gregor's voice be maintained if my connection drops???? 03:39:50 just talked to the "wtf is going on" officials 03:39:54 elliott: poorly. 03:39:57 Perfect, now it works 03:40:03 oerjan: IMO this is unacceptable 03:40:36 oerjan: I wonder how a type system would interact with STM 03:40:44 I'm forced to agree with elliott, the voice status of that greg guy is fucking paramount 03:40:56 Anyway, my code works now 03:42:10 FreeFull: it was hafajoke, although i'm not sure it's impossible 03:42:18 who is greg 03:42:21 and why doesn't he have voice 03:42:30 THE PEOPLE WANT TO KNOW OERJAN 03:42:33 http://i.minus.com/ikfmGW73AeBn0.gif this is greg 03:42:34 oerjan: I would try it if I was working in idris right now 03:42:43 http://dpaste.org/myaGO/ What I was working on 03:42:54 Exercise from some pdf on the web 03:43:37 -!- ChanServ has set channel mode: -o elliott. 03:44:18 elliott: FIXED 03:45:45 oerjan: no, this is awful. i was trying to maintain +½v harmony. 03:45:52 now the lack of oscillation capability results in +2v. 03:46:01 this solution was approved by Gregor himself 03:46:04 no i like this 03:46:09 jix should just be voiced forever 03:46:18 elliott: /msg chanserv access list #esoteric hth 03:46:37 (without the hth) 03:46:39 oh man 03:46:44 your beautiful 03:46:47 -!- ChanServ has set channel mode: -v jix. 03:47:07 what 03:47:09 elliott no 03:47:10 NO 03:47:17 -!- ChanServ has set channel mode: +v Bike. 03:47:27 fuck 03:47:35 oerjan: i find this method of enforcing universal balance worryingly indirect. i may have to take drastic measures and make you a wiki admin. 03:48:07 man i love places with different power distributions in related places 03:48:34 that is a strangely abstract statement 03:48:43 well 03:48:56 are you referring to the fact that the Northeast Corridor uses 60 Hz power north of the Hell Gate Bridge and 25 Hz power south of it? 03:48:59 like on another channel i've been forbidden from ever having ops, but i have mod status on a channel site 03:49:04 yes that's what i meant 03:49:08 wtf is Hell Gate. 03:49:14 http://en.wikipedia.org/wiki/Hell_Gate_Bridge 03:49:16 it's a gate 03:49:17 to hell 03:49:26 it's a narrow tidal strait in the East River in New York City in the United States 03:49:32 uh it says bridge right there 03:49:36 oh, is it shitty to navigate? 03:49:39 yeah 03:49:46 'The name "Hell Gate" is a corruption of the Dutch phrase Hellegat, which could mean either "hell's hole" or "bright gate/passage"' 03:49:54 slightly ambiguous 03:49:55 i love dutch. 03:50:17 The bridge would be the last New York City bridge to collapse if humans disappeared, taking at least a millennium to do so, according to the February 2005 issue of Discover magazine. Most other bridges would fall in about 300 years.[6] 03:50:24 In 1851 the U.S. Army Corps of Engineers began to clear obstacles from the strait with explosives; the process would last seventy years 03:50:27 that must be fun to watch 03:50:42 weakass bridges 03:51:55 [.. CSX ..] 03:52:01 hm what do you do if you want to set a temporary ban for join/quit spam 03:52:06 but are afraid you'll forget to remove it 03:52:16 use a client that doesn't suck hth 03:52:21 i use irssi 03:52:23 sorry i failed 03:53:03 elliott: /knockout? 03:53:30 whoah. 03:53:43 is there a way to do it without the kick 03:53:46 kicks are so hostile. 03:54:06 uhhhhh probably but i don't know it 03:54:18 refer to previous comment about being forbbiden from ops 03:55:01 knockout gas 03:55:13 okay well i just set it. 03:55:14 imo VX 03:55:22 Bike, remind me to remove it in like half an hour. 03:55:27 alright got it 03:55:33 i will be your irssi 03:55:33 fentanyl gas 03:57:48 fentanyl gas in your ass 03:58:23 Bike: why were you forbidden from ops 03:58:38 i want to find out. oerjan op Bike 03:58:41 Should I try to get an hour of sleep? 03:58:58 elliott: i think i may be "the elliott" in this other channel, so to speak 03:59:22 shocking 03:59:28 wow excuse me 03:59:35 "the elliott" is a positive phrase denoting coolness & affability 03:59:41 yes i'm those 03:59:45 & running yer fuckin wiki for you ungrateful assholes 03:59:47 but also inexplicably banned from ops by "the oerjan" 03:59:48 :( 03:59:57 i wish you could have seen the wiki before i got my hands on it, Bike!! 04:00:02 the recent changes was like 04:00:04 when was that? 04:00:06 literally filled with spam deletions 04:00:08 like 04:00:12 it was all deleted by ais523 who is a workaholic 04:00:16 i mean i've read esolang articles for years 04:00:23 but the actual deletion logs clogged out everything 04:00:44 and nobody else offered to take it over but elliott, saviour & defender of all that is good 04:00:44 elliott: so pretty much like now, right? 04:01:12 oerjan: that's it. 04:01:17 oerjan: you know what's going to happen now, don't you. 04:01:22 i'm afraid so. 04:01:27 even i know what's going to happen now and i'm high 04:01:34 on flouride 04:01:39 I don't know 04:01:41 oerjan: is this your secret plan to get wiki adminship 04:01:47 what's going to happen :( 04:01:53 but i'm afraid i cannot really help against the block logs clogging recent changes. 04:01:54 i'm seeing through the meta-layers here, oerjan 04:02:18 coppro: the goat will release the fourth seal 04:02:28 Bike: btw February 2012 apparently 04:02:30 is when I took over 04:02:37 mount g will erupt with the screams of demons, who will cover the earth like locusts 04:02:57 a third of Man will die in unimaginable pain in the ensuing war 04:03:25 Bike: i suggest not reading revelations hth 04:03:39 oerjan: actually i know what's going to happen. you're going to op me and i am going to kick you for that insult 04:04:03 oerjan i bet that would h more if you were a wiki admin 04:04:13 I like STM so far 04:04:18 No funny in-between states 04:04:24 Bike: but only elliott can upgrade the wiki hth 04:05:02 -!- ChanServ has set channel mode: +v oerjan. 04:05:04 take that. 04:05:30 * elliott master of rebellion 04:05:39 oh damn! daaaaamn! daaaaaaaaaaaaaaamn 04:05:49 when ops is outlawed only outlaws will have ops 04:06:13 kmc: i believe that's the premise of ircnet 04:07:34 ChanServ is the worst outlaw 04:13:24 Bike: has it been half an hour yet 04:13:43 no 04:14:09 doesn't it undermine the point of me being your irssi if you have to check 04:14:34 On channel names starting with + no modes (including ops) are allowed. 04:15:32 Bike: i'm anxious!!!!!!!!! 04:15:42 There are also channel types ! meaning that the servers add a hidden prefix to disallow takeovers due to server splits, and & meaning that the channel is local to one server and is not repeated. 04:16:28 Channel type # might be vulnerable to takeovers due to netsplits, but !&+ are all immune to that problem, for different reasons. 04:23:11 elliott: ok go for it quick!! 04:27:14 Maybe HTTP code 418 should be defined as a more generalized than "I'm a teapot"? 04:27:31 Bike: sorry, i'm going by whenever copumpkin removes it in -blah now 04:27:32 you were usurped 04:27:39 ? 04:27:55 supdawg 04:28:08 :( 04:28:13 -!- Bike has left. 04:28:31 copumpkin: i was using bike as an egg timer to remove that joinquit spam ban in #haskell 04:28:40 oh 04:28:44 my slaves all serve me!! 04:31:00 itt zzo38 is a teapot 04:52:36 zzo38: Nah, it should be more specific. 04:52:44 "I'm a little teapot". 04:52:46 Clearly. 04:52:52 kmc: What story? 04:54:49 -!- Bike has joined. 04:56:18 Bike: that is so cool 04:56:20 -!- TeruFSX has quit (Ping timeout: 256 seconds). 04:57:04 yeah 04:57:05 elliott: How come you're not an op? 04:57:17 it's also pretty obvious from looking at disassemblies of trivial functions 04:57:22 so, i'm dumb, etc 04:57:24 shachaf: ask oerjan. 04:57:45 Is it because you were abusing op powers and also giving the wrong people voice? 04:57:45 Fiora: Bike: ok what are you talking about 04:57:52 hi copumpkin 04:57:53 shachaf: i still have voice powers 04:57:55 um. an sbcl thing 04:57:56 a lisp implementaton 04:57:57 hi 04:57:59 oh that 04:58:02 nothing interesting to you! 04:58:08 hey i don't hate sbcl! 04:58:12 maybe kmc means i should send Sgeo a link to that story 04:58:15 don't paint me as some kind of extremist! 04:58:19 but you haven't even read it yet 04:58:36 some kind of sbclist 04:58:51 hm this leads to a question 04:58:58 is the ghc source comprehensible by mortals 04:59:02 sure 04:59:06 it's pretty short 04:59:12 right i thought so 04:59:14 the typechecker is just a few thousand lines of code or whatever 04:59:26 the whole thing including all the ridiculous OS support twiddles and so on is 100k lines I think? 04:59:40 but the part that does the actual compiling isn't quite as scary. 04:59:41 That's rather a lot better than GCC. 04:59:42 Is that including the RTS? 04:59:48 shachaf: I think so, yeah 04:59:50 I'd be surprised if its C++ parser is that size. 04:59:51 maybe includes base too 04:59:54 Bike: http://www.aosabook.org/en/ghc.html 05:00:09 hm i forgot how to get line counts of directories, i suck at unix 05:00:15 oh huh 05:00:18 elliott: according to that it was 140,000 compiler and 50,000 rts 05:00:20 shachaf: i still haven't read that book :( 05:00:28 okay fair enough 05:00:34 but a lot of that is the code generator backends 05:00:47 well did those even "exist in 200111" 05:00:55 the actual "haskell" parts are like 4k+4k+24k+7k 05:01:11 so like 39k. 05:01:13 let's say: 40k. 05:01:22 in the grim darkness of glasgow 05:01:34 "GHC has a complex build system, which today comprises about 6,000 lines of GNU make code." 05:01:40 lol 05:01:41 more like wrong-cambridge 05:01:53 does anyone actually understand makefiles anymore 05:02:04 -!- augur has joined. 05:02:22 anyway i asked because sbcl's source code is basically incomprehensible. parts of it are older than me, it's a weird feeling 05:02:28 Bike: I speak Make. 05:02:36 ok but ur a freek 05:03:45 Bike: well parts of GHC might be older than you. 05:03:46 how old are you 05:04:12 GHC is from, like, 1990. 05:04:13 younger than i am : " ( 05:04:14 oh ghc is like 1990 too 05:04:19 god everything is old 05:04:25 i should use something hip and new 05:04:25 "Peyton Jones, as well as Simon Marlow, later moved to Microsoft Research in Cambridge, England, where they continue to be primarily responsible for developing GHC." 05:04:28 Bike: ur old !!!!!! ! 05:04:29 wikipedia is out of date!!!!!! 05:04:50 elliott: smarlow is retired and he's still primarily responsible for developing ghc 05:04:51 peyton is a weird name 05:05:12 marlow well he should write plays 05:05:43 hey who wants to know the "full name" of spj 05:05:50 simon phaskell jones 05:05:53 simon "phat" jones 05:06:01 ps it's actually slpj 05:06:27 answer? 05:06:27 Simon Loftus Peyton Jones 05:06:36 peyton is still weirdest 05:06:44 you're weirder hth 05:06:55 a lofty name 05:07:08 oerjan: devoice thyself 05:07:32 devoerjan 05:07:33 -!- ChanServ has set channel mode: -v oerjan. 05:07:45 YESSIR 05:07:57 -!- ChanServ has set channel mode: +v oerjan. 05:08:01 oh no. there are gremlins. 05:08:11 gremliotts 05:08:30 oerjan: you know, all I need is +ARfiorst. 05:08:31 oerjan n o 05:08:40 mnoqy: do you need +ARfiorst 05:08:44 shachaf: btw i didn't really intend to deop elliott but chanserv did it automatically when i gave him the +v flag 05:08:46 >???? ??? 05:08:58 oerjan: i can think of a fine way to make up for that mistake!!! 05:09:01 mnoqy: you're the best 05:09:10 ?????? ? 05:09:24 -!- shachaf has set topic: everyone's caught on to everything you do | is mnoqy rye? 'course he is! | Underhanded C Contest: http://underhanded.xcott.com/?page_id=5 | http://codu.org/logs/_esoteric/. 05:09:54 rye? 05:09:57 rye 05:10:31 does the mn in mnoqy stand for minnesota 05:10:35 +RfiorAst 05:10:37 minnesota oqy 05:10:48 no 05:11:20 oqay 05:11:25 hey have you considered that 05:11:30 /nick monqay 05:11:34 /nick mnoqay 05:11:48 m "no" qy 05:11:48 maybe it needs to be sorted 05:12:02 mnoqy: very good mr mister! very good 05:12:49 elliøtt 05:12:56 `? ørjan 05:12:58 ​Ørjan is oerjan's good twin. He's banned in the IRC RFC for being an invalid character. Sometimes he publishes papers. 05:13:17 oerjan: Where does Ørjan live? 05:13:52 i do not know 05:14:24 he keeps moving to escape my assassins, the impolite scoundrel 05:15:51 Well, there's norway he's in the same country as you. 05:16:28 Presumably the good Ørjan lives either in the North or South, while the wicked oerjan lives in the West or East. 05:16:29 fizzie: You have 1 new message. '/msg lambdabot @messages' to read it. 05:18:11 or both? 05:18:22 @tell Phantom_Hoover oklopol is real if you just believe. 05:18:22 Consider it noted. 05:18:37 fizzie: i have been stripped of my rightful Gregor-neutralising powers 05:18:53 Terrible. 05:19:12 -!- ChanServ has set channel mode: +v fizzie. 05:19:18 it truly is. 05:19:32 thankfully, oerjan = sqrt(fizzie) + Gregor / i. 05:19:37 so balance is temporarily kept. 05:19:47 ChanServ: Why do you keep DOING it. 05:19:50 (this is the mathematics of universal balance.) 05:20:02 whoa 05:20:05 that equation is deep 05:20:23 euler's formula has nothing on that 05:20:26 * Bike counts on his fingers 05:20:31 elliott, what should I call that wonderful formula? 05:20:41 that means like... what does that mean 05:20:44 i think there's a one 05:20:53 coppro: the truth 05:20:58 elliott: deep, man 05:27:33 Hmm, people actually say "god bless you" when you sneeze? 05:27:45 I don't know that I've heard the three-word version before. 05:28:10 saint francis of assissi bless you 05:37:02 fizzie: happy birthday! 05:37:21 It's fizzie++ ? 05:37:26 is fizzie 30 now 05:37:45 assuming he didn't lie in the logs yesterday 05:38:20 and everyone knows fizzie never lies 05:39:50 -!- doesthiswork has left. 05:40:09 i don't know how many years he is, though 05:41:35 i shall celebrate by making oerjan a wiki admin 05:41:56 how about celebrating by making me a wiki dictator 05:43:35 -!- oerjan has quit (Quit: Wikiwiki). 05:48:12 @wiki oerjan 05:48:13 http://www.haskell.org/haskellwiki/oerjan 05:48:34 so wikipedia's favicon changed. 05:48:41 the fucking apocalypse 05:49:02 Bike: wait, is *that* how the world ends? 05:49:13 i thought i heard something about fire and/or ice 05:49:57 not with a bang but with a favicon 05:50:49 haha 05:51:23 http://www.marxists.org/favicon.ico 05:51:43 is it bad that i'm used to that one 05:52:41 What's the deal with everyone using .ico format? 05:52:47 I thought that was a Windows thing 05:53:07 I never use favicons so I won't care 05:53:09 some browsers (cough cough IE) only accept .ico format for favicons 05:53:28 But yes .ico is mainly Windows 05:53:29 even ie v. 9 05:53:34 ?? 05:53:36 Sgeo: and originally you could only specify one by putting it at /favicon.ico 05:53:44 ?? ?? ?? ?? ?? ?? ?where quonochrom 05:53:45 monochrom says: There are truths, damn truths, and Kripke structures. 05:53:47 but now there's a tag for it, and you can use any format with most browsers 05:54:02 kmc: are you going to icfp 2013 05:54:10 ?where quonochrom 05:54:10 ?quote monochrom 05:54:11 nah 05:54:17 @where quonochrom 05:54:17 ?quote monochrom 05:54:19 disappointed. 05:54:37 are you doing icfpcontest 2013 05:55:02 prob not 05:55:07 i haven't done one yet 05:55:38 -!- FreeFull has quit (Quit: Cya later). 05:56:07 -!- Bike has quit (Ping timeout: 256 seconds). 05:56:17 ~freefull@defocus/sausage-lover 05:56:28 the sausage king of Chicago 05:57:32 -!- Bike has joined. 05:57:59 http://www.teapartyinspace.org/ y'all ready for this 05:59:36 god dammit Bike 05:59:40 i am trying to go to sleep 06:00:22 maybe you should have told me to tell you to sleep first 06:00:33 instead of that how would you like to read comments of the worst commenter on reddit 06:00:47 that's a pretty bad commenter 06:00:50 (the sad part is that he's not the worst commenter on reddit) 06:00:51 i'm actually curious 06:00:54 oh 06:01:08 ok Part Two is this a programming/haskell thing or more broad, badcommenter-wise 06:01:19 yes and yes 06:01:34 how ambiguous. 06:02:50 -!- Bike_ has joined. 06:06:06 -!- Bike has quit (Ping timeout: 264 seconds). 06:13:22 -!- Bike_ has changed nick to Bike. 06:14:38 @tell oerjan TANK U 06:14:38 Consider it noted. 06:14:46 (And 30 is right.) 06:15:26 (Maybe "right" is not the right word. "Correct.") 06:15:44 @hug fizzie 06:15:44 http://hackage.haskell.org/trac/ghc/newticket?type=bug 06:16:07 Nice command. 06:16:10 fizzie: you know what makes you feel youthful? making other people ops. science fact. 06:16:34 fizzie: Happy fizzie++ ! 06:18:00 Yay! 06:18:09 oh, it's your birthday? :o 06:18:11 happy birthday! 06:18:26 fizzie: i have an alternate request: make it not quarter past seven. 06:18:32 fizzie: choose whichever you prefer 06:18:35 Fiora: It's why I started looking at all those birth-date coincidencies in the first place. 06:18:47 elliott: Okay, it's now quarter past nine. (Here.) 06:18:51 happy fizzie day 06:18:52 ohhhhh! 06:18:54 happy fizzie day :3 06:19:20 fizzie: THAT IS THE WRONG WAY 06:19:22 I know there's all kind of crisises supposed to happen at even years, does 30 have one of them? 06:19:43 prolly 06:20:13 I don't know what the signs are, though. 06:20:24 crisis: you discover you are a speech recognition researcher 06:20:36 Well, "check." 06:20:45 oh no speech recognition 06:20:49 `quote speech recognition 06:20:51 672) fizzie: What kind of speech recognition do you do? If you only need to recognize famous speeches, like Churchill or something, it should be pretty easy. 06:21:23 that made me laugh a lot, weirdly 06:21:33 I'm going to celebrate fizzie day by having an old man put scissors in my mouth, it sounds like the best. (They're removing some stitches.) 06:21:35 thanks shachaf, for the good times & laughter 06:21:45 `run quote monqy | shuf 06:21:47 427) itidus20: i saw a dancing cgi skeleton named malaria. i danced and played with him. \ 508) monqy: help how do I use lambdabot to send messages to people. [...around half an hour later...] @messages quicksilver said 1y 2m 18d 19h 54m 29s ago: you use @tell \ 385) it was a wonderful dream 06:21:57 `run quote shachaf | shuf 06:21:58 697) elliott: Anyway, if you wrote a Haskell book, I would read it and possibly provide classical criticism. That is to say, non-constructive. \ 942) shachaf: LC_ALL=de_DE.utf-8 errno -l Veraltete NFS-Dateizugriffsnummer Eingabe-/Ausgabefehler "Unterbrechung während des Betriebssystemaufrufs" i thin 06:22:10 ? 06:22:12 `quote 942 06:22:13 942) shachaf: LC_ALL=de_DE.utf-8 errno -l Veraltete NFS-Dateizugriffsnummer Eingabe-/Ausgabefehler "Unterbrechung während des Betriebssystemaufrufs" i think that was in the Ring Cycle 06:22:27 Oh, it has "shachaf:" 06:22:29 for some reason it reminds me of this book of Famous Speeches at biztown 06:22:35 `run quote shachaf | shuf 06:22:37 628) You should get kmc in this channel. kmc has good quotes. `quote kmc 686) COCKS [...] truly cocks Well, in theory. \ 889) shachaf: contrary to common belief, #esoteric is not really "a channel for crazy people", but has (ostensibly) a topic... is beaky from finland? \ 865) G 06:22:48 `run quote Bike | shuf 06:22:49 shufchaf 06:22:50 857) "damn, my port of ghc to php isn't properly taking javascript booleans into account" \ 1006) Bike: I think you're ready to learn about lens. oh god fiora help somebody help anybody \ 917) Taneb: STOP TRYING TO GET LENS INTO EVERYTHING Bike: You should use lens! NEVER "You should get kmc in this channel" oh if only we had known! 06:23:10 eventually it transpires that i am lens 06:23:23 fizzie: isn't the rule that like, the even ones are good, the odd ones are bad 06:24:22 Fiora: I don't think I've heard of that one. I suppose it means the actual birth is one of the good ones. 06:24:32 i'm only here because of cheater really 06:24:33 * Fiora was making a bad joke, sorry 06:24:37 The Look Around You episode about Lens was great. 06:24:41 was that a star trek joke fiora 06:24:47 .... <.< 06:24:50 if not: i'm sorry that i'm apparently a trekkie 06:24:58 DONT BE SORRY 06:25:04 Ohhh, I also know the Star Trek joke. 06:25:09 For some reason, I just didn't connect. 06:25:21 Fiora: you're not allowed to tell people to not be sorry 06:25:25 It sounded so plausible as a real rule. 06:25:27 Fiora: you apologisze too much for that 06:25:29 but people tell me not to be sorry 06:25:38 Fiora: yes but you apologisze too much 06:25:59 -!- doesthiswork has joined. 06:26:44 >_< 06:26:46 i would like to go on the record as not caring whether people are sorry 06:27:16 `run echo ' i would like to go on the record as not caring whether people are sorry' >> record 06:27:20 No output. 06:27:25 `rm record 06:27:27 it's an imaginary record 06:27:28 No output. 06:27:34 like the kind you put music on 06:27:41 um those aren't imaginary 06:27:44 I guess you could say it's now a broken record 06:28:14 that was so bad I think it broke my kidneys. 06:28:17 who knew they were so sensitive to jokes 06:29:04 my kidneys for one are all about jokes. 06:30:16 fiora just apologized for something someone else did, elsewhere 06:30:21 you're dropping the ball here fiora 06:30:26 I'm sorryyyyy 06:30:33 Fiora................................................. 06:30:44 what >_< 06:30:45 also didn't you read the no compete when you joined this channel 06:30:48 you can't be in any other channel 06:30:57 s-sorry... 06:30:57 dropping the very apologetic ball 06:31:06 I guess I can leave if it bothers you... 06:31:20 no, you have to stay. 06:31:28 you gotta stay 06:31:35 this channel is now about you 06:31:38 it's the rules. 06:31:45 eeeek 06:31:45 without you it would collapse around itself 06:31:50 I don't understand... 06:31:56 in which #esoteric becomes a bad trip 06:32:03 don't scare off Fiora............. 06:32:08 Fiora: basically it's cool 06:32:13 you're cool. it's all good. 06:32:17 Fiora: sorry, sorry 06:32:18 -!- ChanServ has set channel mode: +v kmc. 06:32:19 don't leave 06:32:21 um. ??? 06:32:40 why am i voiced 06:32:48 kmc: see window 1 for explanation 06:32:52 kmc: nobody knows 06:33:00 it just happens without explanation. 06:33:14 elliott's gone made with power 06:33:16 next thing you know clog will be voiced. 06:33:21 -!- ChanServ has set channel mode: +v glogbot. 06:33:55 Bike: would you say he's a made man 06:34:06 i uh, i don't get it. 06:34:11 so i probably would not say that. 06:34:16 Does clog log clog 06:34:26 Bike: the joke is that you said made 06:34:35 oh hey i did 06:34:35 Jafet: I believe it clogs the clog log 06:34:38 wow i'm good at typing 06:35:14 http://24.media.tumblr.com/5d10cd5263f612c74b6a3d974f031091/tumblr_ml98evQd7s1r4kgqlo2_1280.png 06:35:39 welp 06:35:41 Soon, everyone is voiced, after which being unvoiced will probably start being the cool thing. 06:36:03 fizzie: no. being opped will be the cool thing 06:36:05 fizzie: hey i read a book about that 06:36:06 or maybe....... 06:36:07 being a wiki admin 06:36:13 Being unvoiced was always cooler than being voiced. 06:36:23 -!- ChanServ has set channel mode: +v ion. 06:36:26 A number of channels use +v as the idiot flag. 06:36:27 HA HA 06:36:29 :-) 06:36:37 anyway one of the authors of this paper is named "Rafal Czajkowski" holy shit 06:36:44 czajkowski people 06:36:46 elliott: hey got any "wisecracks" for us 06:36:52 i don't know how poland ever had problems with names like that 06:36:57 i didn't even voice ion 06:36:58 it's spreading 06:37:00 is that a polish name i don't even know 06:37:02 fizzie: imo op me 06:37:20 Wait, elliott has chanserv mode +v now? 06:37:23 wow it really is polish 06:37:24 elliott: Sorry, that's more of an oerjan thing. :/ 06:37:25 What does that mean? 06:37:41 fizzie: no no. oerjan just ops me *temporarily*. I didn't mean anything like that. 06:37:51 shachaf: it means he's gone made with voice-/devoice- related power. 06:37:53 shachaf: It means one can /chanserv voice/devoice #esoteric dude, I think. 06:38:03 wow that wasn't even intentional that time 06:38:17 it wasn't the first time either, but i mean, still 06:38:27 " Zbigniew Czajkowski, Polish fencing master; known as "father of the Polish School of Fencing" and coach of champions" 06:39:59 Any relation with Rafal? 06:40:00 coach of champions, what a title 06:40:26 coach of coaches of champions 06:40:32 is copolishness a relation 06:40:39 The Couch of Champions. 06:40:42 what about reverse polishness 06:41:09 'inverse polish' is probably illegal 06:42:26 fizzie: consider this: when lament comes a-knocking and the kids are asleep, who will re-ban dbelange...?????? 06:42:33 who will make sure Gregor stays voiced 06:42:44 imagine the national catastrophe (natastrophe) that could occur 06:42:47 who the hell is lament and: why 06:42:51 Gregor doesn't need voice 06:43:34 Bike: well do you remember lmt 06:43:37 from a few weeks ago or whatever 06:43:38 ENOTSUP 95 Operation not supported 06:43:40 SUP? 06:44:09 um... a bit 06:44:31 `quote lament 06:44:33 66) Where's the link to the log? THERE'S NO LOG. YOUR REQUEST IS SUSPICIOUS AND HAS BEEN LOGGED. \ 276) elliott: well what i would do if i were omniscient and omnipotent would be to create an immortal woman with perfect tits and bang her for the rest of eternity 06:44:52 Bike: he unbanned dbelange and then invited him. and also was generally lament 06:44:59 oh! i talked with that person about salvia 06:45:01 This is the message of 'pataprogramming (linked from Wikipedia): http://www.illposed.com/philosophy/pataprogramming.html 06:45:02 right yes 06:45:06 mmmm lots of new user accounts on thew iki today(its still the 14th....:]) 06:45:08 he is an old channel op who has spent the past years hating #esoteric and only coming back to kick a lot of people and stuff 06:45:14 p great 06:45:36 awesome 06:45:37 ion: EL2HLT 51 Learn to halt, man 06:45:38 plenty of accounts yesterday too 06:45:39 i love history.. 06:45:44 .... 06:46:04 -!- ChanServ has set channel mode: +v Bike. 06:46:05 whoa, someone made a brainfuck derivative derivative 06:46:13 is that a record 06:46:18 mnoqy: is "derivative" contravariant........................ 06:46:22 is it a good one? 06:46:28 haha j/k but seriously i wanna see it. 06:46:36 mnoqy: arguably almost every bf derivative is a derivative of the original bf derivative . . . . . . . . 06:46:44 http://esolangs.org/wiki/Noodle_Soup 06:46:59 -!- carado has joined. 06:47:02 good old transitive property. 06:47:14 transitive property of derivatives 06:47:16 jesus fucking christ it's almost 8 am 06:47:30 that's... not what multiprogramming means, is it 06:47:41 That Jesus F. Christ 06:47:44 hey someone should make a "bf derivative" as in bf options or something 06:48:04 i guess multiple interpretations of the same code could be kind of interesting if it wasn't dum 06:48:07 * Fiora buys bf call options 06:48:13 or as in differentiation but i don't know how to differentiate a language 06:48:19 ok the wiki says that is what multiprogramming means. 06:48:22 shachaf: parser combinators 06:48:25 EDOTDOT 73 http://youtu.be/4Z2Z23SAFVA 06:48:31 Fiora: why are they called call option instead of buying-options 06:48:44 ummmm maybe ask wikipedia 06:49:15 shachaf: Tricky. Main problem is, derivatives are continuous while languages are discrete. 06:49:21 http://esolangs.org/wiki/Revolution_9 why does this exist 06:49:29 pikhq_: um, derivatives don't have to be continuous......... 06:49:36 Noodle Soup looks like a derivative of ROP 06:49:37 pikhq_: like derivatives of types!! 06:49:48 pikhq_: https://en.wikipedia.org/wiki/Derivation_(abstract_algebra) 06:49:51 Languages don't have to be discrete 06:50:17 shachaf: I wasassuming you meant "as per the calculus of derivatives and integrals"; excuse me. 06:50:21 Fiora: okay from now on i'm calling them buying-options and selling-options 06:50:34 elliott: you're a wiki admin right. -> http://esolangs.org/wiki/Revolution_9 <- check it 06:50:41 pikhq_: as usual in math it's pretty common to make shit up notice it's pretty similar and call it the same thing 06:50:47 the same fucking thing 06:50:50 mnoqy: already chequed it 06:50:59 turn me on, dead man 06:51:20 elliott elliott "ur being overly british" "its written check even in britainland.." 06:51:38 office of the exchecker 06:51:39 you gotta watch those biritihisihims 06:52:11 who remembers http://esolangs.org/wiki/FiM%2B%2B from october 06:52:15 apparently it has its own wiki now 06:53:02 wh- oh, tv show 06:53:15 i hear people like it? 06:53:16 after being unable to find pre-existing programming language based on My Little Pony. 06:53:22 never seen it, myself 06:54:05 mnoqy can i have your autograph 06:54:08 um 06:54:30 how--oh i guess i have a tablet i can just plug it in -untangle- 06:54:38 hang on hang on 06:54:50 if you're plugging in your tablet i want a self portrait of something 06:55:13 ok uhh 06:55:22 how about one for bike 06:55:28 ooh good one 06:55:33 draw a self portrait of Bike 06:55:42 draw me an op campaign poster please 06:55:45 Bike: You're in for a treat. 06:55:52 elliott: no be quiet it's self self portrait time 06:55:59 bike's never seen a self-portrait has he 06:56:10 i can draw a self-portrait of elliott's op campaign 06:56:11 well, i have 06:56:15 er wait 06:56:20 am i monqy? 06:56:26 mnoqy: no don't do that 06:56:33 mnoqy: elliott must never become op 06:56:41 ok 06:56:44 Bike: i hope not 06:57:03 yeah me too, he's cooler than I. 06:57:23 mnoqy is the terminal object in the poset category of coolness 06:57:25 mnoqy: i want that self portrait 06:57:30 i don't care what shachaf says 07:00:47 monqy ARE WE GETTING THAT SELF PORTRAIT OR NOT 07:01:01 sorry for shouting and/or yelling 07:01:03 im so anxious 07:01:10 sorry sorry gimp's just being awful 07:01:15 it used to be so much less bad! 07:01:29 gimp was always gimp was always bad 07:01:53 mnoqy: Your nick reminds me of the scroll labeled MNOSOI SHIT i got in crawl once. 07:01:53 well have you seen it's new pen and pencil tools it's impossible to get them working right all the options are funky 07:02:25 ion: thanks 07:02:45 mnoqy: i believe in you 07:02:47 that one is in ``fuk da sac'' right 07:02:52 elliott: yeah 07:03:09 mnoqy: you can do anything if you put your mind to it!! 07:04:16 elliott: I disapprove of your choice of quotation characters. 07:04:25 it encodes a specific meaning 07:04:43 ion: you‘re the “stupid quotes„ guy right 07:05:57 coughs 07:06:07 -!- ChanServ has set channel mode: -v Bike. 07:06:37 mnoqy: hey do you still have that self portrait of me 07:06:52 yeah i have all of them i'll rev the links up 07:07:02 oh here it is 07:07:04 no stop i'm trying to sleep 07:07:04 http://dl.dropboxusercontent.com/u/13786158/shachaf.png 07:07:34 oh nuts i dont have them all in a directory i have to fix that 07:07:40 http://dl.dropboxusercontent.com/u/13786158/monqy.png 07:07:58 dont forget http://dl.dropboxusercontent.com/u/13786158/eliot.png 07:08:15 shəchef 07:08:23 need to revise monqy.png to be misspelled now 07:08:55 these are good. 07:09:19 elliott: um shachaf.png isn't misspelled 07:09:23 ive moved all of them into the portraits directory 07:09:24 so why should monqy.png be 07:09:43 e.g. https://dl.dropboxusercontent.com/u/13786158/portraits/monqy.png 07:09:53 e.g. http://dl.dropboxusercontent.com/u/13786158/portraits/shachaf.png 07:09:56 "now organized" 07:10:06 and i got a good "dynamics" set up in gimp 07:10:14 now i just have to remember how to draw 07:12:08 Do you have a “workflow”? 07:12:18 totes 07:12:19 (Those are some amazing portraits.) 07:14:05 fizzie: doesn't eliot.png look like the face of someone you can trust 07:14:24 someone i can trust to ruin the channel hth 07:14:40 elliott: Well, yes, but I don't trust myself to make sensible decisions. 07:14:58 (What sort of email reply subject line prefix is "AW:" supposed to be?) 07:15:02 fizzie: I do! I believe in you. 07:15:08 fizzie: believe that you can believe in me. 07:15:25 fizzie: You should op me. 07:15:52 Oh, "Antwort". 07:16:00 German? 07:16:03 Yes. 07:16:16 Well, it was from Switzerland, but they do a kind of German there. 07:16:48 I thought proper German? 07:17:19 The big three are called DACH or something for Germany, Austria and Switzerland 07:18:09 I am under the impression that "Swiss German" is somewhat dialecty. 07:18:37 -!- ChanServ has set channel mode: -v glogbot. 07:18:39 -!- ChanServ has set channel mode: -v ion. 07:18:40 -!- ChanServ has set channel mode: -v kmc. 07:18:43 it is time for austerity. 07:18:57 the swiss are all about the dialectic 07:19:43 The Swiss are very dielectric. (It's all that mountain air.) 07:19:44 * impomatic has a website in German. Unfortunately I only speak a bit of German. Fine for email, not so good when people phone :-( 07:27:14 -!- epicmonkey has joined. 07:27:52 https://dl.dropboxusercontent.com/u/13786158/portraits/bike.png 07:28:27 i shall treasure it 07:28:30 thank you very much 07:28:39 @hug mnoqy 07:28:40 http://hackage.haskell.org/trac/ghc/newticket?type=bug 07:28:47 mnoqy: you are the best 07:33:35 Isn't that a Trike? 07:33:46 isn;t that what Bike is 07:33:48 (1) no (2) don't ruin the moment 07:33:54 ==Bike 07:34:22 Sorry, my mistake. Definitely a Bike :-) 07:34:23 that circle on the left isn't even connected how could it be a wheel 07:40:43 Fiora: ? 07:43:24 elliott: https://dl.dropboxusercontent.com/u/13786158/portraits/el-op.png 07:43:55 mnoqy++ 07:45:03 elliott's op campaign is a talented artist 07:45:14 elliott for nethack player 07:45:17 and/or crawl player 07:48:42 `welcome FireFly 07:48:47 FireFly: Welcome to the international hub for esoteric programming language design and deployment! For more information, check out our wiki: http://esolangs.org/wiki/Main_Page. (For the other kind of esoterica, try #esoteric on irc.dal.net.) 07:49:05 wrong channel.... 07:49:10 -!- epicmonkey has quit (Ping timeout: 245 seconds). 07:49:22 but thanks 07:49:23 Well, this is the channel with the `welcome bot. 07:49:29 Fair 07:53:25 -!- mnoqy has quit (Quit: hello). 08:16:14 -!- doesthiswork has quit (Quit: Leaving.). 08:44:22 -!- DHeadshot has quit (Ping timeout: 258 seconds). 08:50:08 -!- Bike has quit (Ping timeout: 260 seconds). 08:50:50 -!- Koen_ has joined. 08:57:06 ion: hion 08:57:41 shachaf: hachaf 08:57:52 Isn't #-blah bad? 08:58:18 #-badh 09:05:10 -!- hogeyui has quit (Quit: Tiarra 0.1+svn-36726: SIGTERM received; exit). 09:08:05 -!- epicmonkey has joined. 09:08:39 -!- hogeyui has joined. 09:09:10 ion ion ion ion 09:10:28 (unwords . replicate 4) "shachaf" 09:10:53 > replicateM 4 "ion" 09:10:55 ["iiii","iiio","iiin","iioi","iioo","iion","iini","iino","iinn","ioii","ioi... 09:22:27 fi:ioni == en:ion. 09:22:48 fizzie: how about you op me for a little bit 09:24:22 You'd just kickban everyone, make the topic a link of your for-profit porn site, set up a ritual sacrifice altar in the middle of the channel, I know that. 09:24:26 (As opposed to your non-profit porn site.) 09:34:20 No, I already said what I'd do. 09:34:24 Op me and see! 09:35:12 I did not read that, I'm on a laggy mobile internet. 09:35:52 It was yesterday. 09:38:06 Still, opping all kinds of random "plebs" is more of an oerjan thing, isn't it? 09:38:09 I get a bad rash if I touch the privilege controls. 09:38:43 Don't worry, I'd deop myself within a minute. 09:40:42 Could you recap (in ten words or so) what you were going to do, first? I forgot what it was, if ever I knew. 09:40:56 I was going to: deop myself (but first deop elliott) 09:41:55 Well, I guess that's safe enough, and pointless enough to be accepted by the Spirit of #esoteric. 09:41:59 -!- ChanServ has set channel mode: +o shachaf. 09:42:05 -!- shachaf has set channel mode: -o elliott. 09:42:07 -!- shachaf has set channel mode: -o shachaf. 09:42:12 Thanks. 09:44:45 Hmm,I should've done it in one go. 09:44:54 -oo elliott shachaf 09:44:57 Oh well. 09:55:32 fizzie: Did you hear the new name of this channel? 09:55:36 esoteirc 09:55:43 Because it's esoteric, but it's irc. 09:56:02 That I heard. 09:56:27 fizzie: How should I learn Finnish? 09:57:13 I've heard there's a tutorial-kind of book called "Learn You a Finnish for Great Good!", it's got an elephant on the cover. (I may be mixing things up.) 09:57:47 Hmm. I think you are. 09:57:57 But have no fears. We may still be able to get something useful out of this. 09:57:58 -!- hagb4rd2 has quit (Ping timeout: 258 seconds). 09:58:01 fizzie: How should I learn Haskell? 09:59:36 Learn Haskell by practice; that is best way. 09:59:45 shachaf: Well, I've heard one way is to go live among native Haskell speakers for a while, but that's of course kind of boring. My (Finnish) friend's Chinese wife goes to some sort of daily Haskell course. But I don't really know these things. 09:59:48 zzo38: (Shh. I actually want to learn Finnish.) 10:00:14 Maybe you should also learn Finnish by practice too, then. 10:01:04 `run ls wisdom | grep oe 10:01:06 No output. 10:01:17 `run ls wisdom | grep '' 10:01:19 As the wisdom directory contains many files named after nicks, listing it in public annoys people. Try `pastewisdom instead. 10:01:32 `run /bin/ls wisdom | grep oe 10:01:34 doesthiswork \ oerjan 10:01:41 `? doesthiswork 10:01:43 no 10:01:57 `run echo yes > wisdom/døsthiswork 10:02:00 No output. 10:02:17 `? oerjan 10:02:19 Your evil overlord oerjan is a lazy expert in future computation. Also a lying Norwegian who hates Roald Dahl. 10:02:20 `? Ørjan 10:02:22 ​Ørjan is oerjan's good twin. He's banned in the IRC RFC for being an invalid character. Sometimes he publishes papers. 10:03:30 `? groups 10:03:31 groups? ¯\(°_o)/¯ 10:03:34 `? group 10:03:36 group? ¯\(°_o)/¯ 10:03:51 -!- hagb4rd has joined. 10:05:17 -!- conehead has quit (Quit: Computer has gone to sleep.). 10:05:57 Grüp theory. 10:07:38 `? œrjan 10:07:40 ​œrjan? ¯\(°_o)/¯ 10:10:03 `run echo 'oerjan øerjan œrjan' | iconv -t ascii//translit 10:10:05 oerjan ?erjan oerjan 10:10:07 Aw. 10:10:26 (Also, "øerjan"...) 10:24:48 -!- ais523 has joined. 10:25:00 @messages? 10:25:01 Sorry, no messages today. 10:25:09 checking for messages helps keep them away 10:28:40 hi ais523 10:28:43 Any exciting news? 10:28:59 hmm 10:29:04 does it have to be recent news? 10:29:13 I suppose not. 10:29:17 I'm sure things have happened, and some people consider them exciting 10:29:25 Answer as you see fit. 10:29:37 the further back you go, the more likely you are to find things that are very exciting, to a lot of people 10:29:41 I will allow you to use your good judgment. 10:29:44 but hmm 10:30:04 I've been having quite a good night/day so far, but the details are reasonably mundane from most people's point of view 10:30:06 It is possible to treat the standard genetic code as a programming language; the following translates to the peptide HELLQWQRLD. TACGTACTTAATAATGTTACCGTTGCAAATCTAATC Can this be modified to code pyrrolysine somehow? 10:30:09 I got a lot of writing done 10:30:27 and I made some changes to my Pokémon team that have been performing better than expected 10:30:32 (although now I have to learn how to play it again) 10:32:32 (This was found on Wikipedia, except for my question) 10:34:36 It says pyrrolysine is usually interpreted as stop codons. Do you know how to fix it so that it does not do so, and can therefore make "HELLOWORLD" instead of "HELLQWQRLD", or are there other problems with that too? 10:36:09 -!- Zerker has joined. 10:43:07 -!- copumpkin has quit (Ping timeout: 252 seconds). 10:43:47 -!- copumpkin has joined. 10:48:05 A @message a day keeps the doctor away. 10:49:21 -!- Zerker has quit (Remote host closed the connection). 10:50:04 -!- Zerker has joined. 10:51:02 See http://en.wikipedia.org/wiki/User:DanielCristofani/Hello_world_program_in_esoteric_languages2 10:55:45 Sometimes I wonder why none of the Befunge Hello Worlds one sees ever use the canonical printing idiom >:#,_ but instead a loop that "looks like" a loop. (I guess it's to illustrate that part of the language.) 10:56:45 what's the point of a befunge Hello World! program if the loop doesn't look like a loop 10:56:51 IT'S BEFUNGE, MATE 10:57:13 If it works in Unefunge it's not a good illustration of Befunge 10:58:09 But it's the IDIOT. I mean, idiom. 11:00:44 fizzie: http://www.quote-egnufeb-quote-greaterthan-colon-hash-comma-underscore-at.info/ uses a oneliner 11:00:58 possibly because it'd be hard to parse if it had to use -newline- too 11:24:28 ais523: You're the guy that thought up Checkout right? Are there any available graphics cards for which it can be assembled, or would there need to be a compiler to GLSL/CUDA or similar convolution? 11:25:02 Zerker: GPU asm tends to be proprietary, although I think Intel would be happy to give you a reference manual for theirs 11:25:08 I'm surprised Checkout gets so much attention, really 11:25:27 compiling to CUDA or OpenCL or something would probably make the most sense, though 11:25:31 it'd be more portbale 11:25:33 *portable 11:25:38 GPGPU is 11:26:00 back when I was working on GPU computation a few years ago, the tools weren't very mature 11:26:06 cool, and checkout promises efficiency ^-^ 11:26:32 OpenCL was pretty rudimentary; CUDA's proprietary tools were good but going backwards 11:26:54 they used to include a simulator to emulate the GPU on the CPU so you could debug it 11:27:00 but they removed it when they added on-GPU debugging 11:27:39 the problem is, turns out you can't put a debugger on the GPU when it's trying to handle rendering the desktop at the same time 11:28:07 haha, I see why that may be problematic 11:28:24 Run all dev tools on a remote X server? 11:28:55 we did the reverse, in the end 11:29:02 put the graphics card in the server and ssh'd in 11:30:15 Ah, so the debugger was sane enough not to attempt to draw itself 11:30:43 that possibility hadn't even occured to me 11:30:57 and even now you've mentioned it, I'm having problems visualising it 11:31:21 (as a window in aforementioned "desktop" environment) 11:32:05 well what would be saner would be to just have the debugger take over the entire screen 11:32:06 Though directly could be fun too 11:32:09 like full-screen games do 11:32:19 that way the GPU isn't trying to handle two things at once while stuck at a breakpoint 11:33:22 Except it would still have to draw the debugger. While freezing all the registers etc. you're looking at…parallelism is neat :P 11:33:39 yeah 11:33:51 now, GPUs can run multiple completely unrelated tasks in parallel 11:33:58 that's how the GPGPU stuff works in the first place 11:34:10 just when we were working on it, they couldn't do that in debug mode, for whatever reason 11:34:50 presumably because breakpointing the GPU can't stop just one equivalent-of-process (I've forgotten the word for it), it has to stop the whole GPU 11:35:09 kernels? 11:35:58 So the Checkout "in parallel, do the same exact thing except with one varying integer" is no longer an accurate representation? 11:36:00 Fiora: that's it 11:36:11 Zerker: that is accurate, at the lowest levels 11:36:16 GPUs are parallel on multiple levels 11:36:23 thus the multiple tiers of Checkout 11:36:58 So how hard is it to get to these lower levels on e.g. an RPi? >:D 11:37:12 kernels are like level 5 units; the one varying integer thing is a warp, at level 1 11:37:28 I thought only some times could you actually run multiple kernels? 11:37:29 err, level 2 is a warp 11:37:31 level 1 is a thread 11:37:31 I think it was CUDA 2.0 or something 11:37:38 Fiora: that's computational kernels 11:37:42 ah 11:37:49 the ones doing rendering have always been able to run in parallel with that 11:38:05 because NVidia's customers would complain if they had to use a serial console to run their CUDA programs 11:40:42 And if you can, why would you instead compile to a higher-level language that would just get expanded back out? 11:42:16 well compiling to subsets of a higher-level language can be one way to get portability without sacrificing speed 11:42:18 have you seen asm.js? 11:43:44 -!- impomatic has quit (Ping timeout: 260 seconds). 11:44:22 -!- Snowyowl has joined. 11:49:06 Reminds me of a lisp VM implemented for PIC controllers, how aggressively can it be optimized though? 11:49:26 well the idea of asm.js is a bit of an abstraction inversion 11:49:38 it's basically asm compiled to JavaScript in a particularly mechanical way 11:49:48 the idea being that JavaScript interpreters can recognise it and compile it back to asm 11:50:00 and even the ones that don't recognise it are likely to do a good job of optimising it 11:50:15 you could potentially use a similar technique for Checkout, compiling it to OpenCL 11:50:26 and then having the OpenCL compiled to platform-specific GPU asm that's similar to the original 11:52:28 How good are the platform-specific GPUs at optimizing OpenCL? 11:53:03 I don't know 11:53:16 in general, GPU optimization seems very random sometimes 11:53:27 one of my favourite GPU stories is a scheduler bug 11:53:43 basically, if you asked for 256 threads to run, it ran them in 8 warps of 32 11:53:52 if you asked for 257 threads to run, it ran them in 257 warps of 1 11:54:03 eeee 11:54:11 because it couldn't make the number of threads in a warp differ from warp to warp 11:54:21 also it had to be a power of 2 11:55:01 * Zerker stops checking for primeness 11:55:08 it's prime 11:55:36 it is indeed prime 11:55:40 `factor 257 11:55:40 I don't understand enough about GPUs to know why this is a bug. 11:55:41 257: 257 11:56:05 Snowyowl: imagine you have a dualcore processor, and if you have an even number of processes, it uses both cores 11:56:08 I'm guessing 8x32, and then 1, would have worked better? 11:56:11 but if you have an odd number, it only uses one 11:56:13 Zerker: yes 11:56:41 ah 11:57:24 Is there even any situation where it shouldn't basically step through the binary representation of ? 11:57:26 Zerker: anyway that bug is fixed on more recent GPUs, it was fixed on the newer ones we tested, just not the older ones 11:57:49 so different computers in the lab gave completely different results when drawing a block size vs. performance graph 12:00:54 `factor 11111111111111111111111111111111111111111111111111111111111111111111111 12:00:55 factor: `11111111111111111111111111111111111111111111111111111111111111111111111' is too large 12:01:06 `factor 0 12:01:08 0: 12:01:21 nonsense, that's the prime factorisation of 1 12:01:27 `factor 1 12:01:28 1: 12:01:42 * Snowyowl fumes 12:02:45 * Zerker is amused by 0: emoticon 12:03:49 3: 3 is a nicer emoticon 12:04:19 :3 12:05:23 Certainly, but unfortunately isn't recognized as such by my IRC client; however, https://www.dropbox.com/s/nj2nhkln011suny/2013-04-15%2005.02.46.png 12:15:17 `quotes 12:15:18 753) gah this language is of the devil oklopol: you're meant to use your powers for _good_ 12:23:25 -!- carado_ has joined. 12:23:28 -!- Zerker has quit (Remote host closed the connection). 12:24:13 !roll 2d6 12:25:32 -!- Phantom_Hoover has joined. 12:31:23 -!- TeruFSX has joined. 12:33:21 `quote 12:33:22 998) In this timezone is Good Friday today. (It is good because you don't have to go to work) 12:34:05 `quote 455 12:34:06 455) it's probably the same people who were trying to organise gangs of shoplifters as some sort of complex protest against the government's economic policy 12:34:16 `quote 12:34:17 Phantom_Hoover: You have 1 new message. '/msg lambdabot @messages' to read it. 12:34:18 973) Sgeo_, are you just trying to post kmcbait... * Fiora imagines a cardboard box propped up by a stick with a pile of monads inside. Fiora: that is actually what Haskell is. 12:34:38 `quote 55 12:34:40 55) if a girl is that cute, i don't care how many penises she has 12:34:57 -!- copumpkin has quit (Ping timeout: 252 seconds). 12:35:02 `quote 12:35:03 361) elliott: actually, it's worse right now, I'm in the USA where the solution to counterfeiting problems is "add more ink" eventually all US bills will just be solid green 12:35:36 -!- copumpkin has joined. 12:37:06 -!- TeruFSX has quit (Ping timeout: 252 seconds). 12:40:27 `quote 12:41:04 574) Ngevd:. i'm so kind, even to assholes! anmaster no not markov anmaster no not markov anmaster no not markov anmaster no not markov anmaster no not markov 12:42:30 fungot, acknowledge your master markov 12:42:30 Jafet: no problem. i have started to agree with bradd, here. might be dangerous :) ashinn really believe him or her. what kind of crap is what drives me mad :) which helps in this community 12:48:26 -!- boily has joined. 12:48:27 -!- boily has quit (Client Quit). 12:48:40 -!- boily has joined. 12:48:49 -!- metasepia has joined. 12:49:05 good morning all! bixi 2013 season is open! WOOHOO! 12:49:42 does that mean we get to shoot you? I'm OK with that. 12:50:05 only if you can catch me, cause I'm on a BICYCLE! 12:58:49 `quote 12:58:50 951) Áis523ÎkËÇÏ52Í¿ÉnÐffjliated/ais523: ever tried reading while confused? 12:59:05 `quote 12:59:06 155) syntax is the least important part of a programming language other than Python 12:59:10 `quote 12:59:11 248) However is probably better to have both queen/king and government in case one does bad thing, the other side can argue to them 12:59:15 `quote 12:59:17 `quote 12:59:17 36) Seconds. 30 of them. Did I forget the word? 12:59:18 861) Deewiant: um???? You've forgotten axiom 1 of everything: everything sucks 13:01:01 `quote 13:01:03 692) elliott: but, there are imps around, the pad. it's hard to remember though your cross-hairs would never settle on an innocent little girl. chokes up now imagine she's white. 13:01:08 `quote 13:01:10 634) I guess only gay people fuck? 13:01:15 `quote 13:01:17 43) GregorR: are you talking about ehird's virginity or your soda beer? 13:07:21 -!- Snowyowl has quit (Quit: Page closed). 13:13:14 -!- carado has quit (Quit: Leaving). 13:16:59 -!- ThatOtherPerson has joined. 13:24:12 -!- ogrom has joined. 13:36:56 That's a lot of quoting. 14:08:00 -!- Taneb has joined. 14:09:07 `quote quoting 14:09:08 256) addquoting yourself? isn't that like commenting on your own facebook status? Yup, but I'm JUST THAT AWESOME. \ 799) * oerjan makes a brainfuck derivative for quoting xkcds 14:10:09 `quote zucchini 14:10:10 No output. 14:10:19 Oh? Curious. 14:13:13 `quote cucumber 14:13:15 No output. 14:15:06 `help 14:15:06 Runs arbitrary code in GNU/Linux. Type "`", or "`run " for full shell commands. "`fetch " downloads files. Files saved to $PWD are persistent, and $PWD/bin is in $PATH. $PWD is a mercurial repository, "`revert " can be used to revert to a revision. See http://codu.org/projects/hackbot/fshg/ 14:15:19 `pastquote zucchini 14:15:21 ​/home/hackbot/hackbot.hg/multibot_cmds/lib/limits: line 5: exec: pastquote: not found 14:15:36 `pastlog zuchini 14:15:49 No output. 14:15:56 `pastlog zucchini 14:16:03 2006-08-04.txt:22:02:12: These are the voyages ... of the starship zucchini. 14:16:17 not quite what I had in mind, but it'll do. 14:27:05 `quote ThatOtherPerson 14:27:06 1022) Do you have a girlfriend, fungot? ThatOtherPerson: there's two. 14:27:50 ah, I recall that. lucky fungot. 14:27:51 boily: and -o1 fnord calls turns it on :) 19:10 tagy se on ihan tossa vieressä! fnord.!. see srfi 1's take 14:58:52 -!- ais523 has quit (Ping timeout: 258 seconds). 14:59:05 -!- FreeFull has joined. 15:02:24 -!- ThatOtherPerson has quit (Quit: Leaving). 15:02:50 MEANWHILE ON TWITTER: https://twitter.com/CharlieShrem/status/323792771745984512 15:13:44 Boris Johnson wants to build a statue of Thatcher in Trafalgar Square? 15:13:45 really? 15:15:24 He is very Tory 15:16:34 I'd rather have a statue of Gordon Brown than Margaret Thatcher 15:17:09 I wouldn't care for either. 15:17:31 I mean, if I had to choose between the two 15:17:42 i'd rather have a statue of boris johnson 15:17:48 I'm with kmc here 15:17:52 because then it would just be a joke and not a slap in the face 15:17:54 i really don't get the hate for brown tbh 15:18:27 it seems like his main crime as a leader was not being photogenic enough 15:19:27 I think people think he slacked off too much 15:20:41 -!- ThatOtherPerson has joined. 15:22:44 I think he was more of an unpopular chancellor of the exchequer 15:29:13 -!- carado_ has quit (Ping timeout: 246 seconds). 15:34:41 gah i thought 8GB of RAM would be enough for this laptop 15:34:46 since the previous one only had 3GB 15:35:24 -!- impomatic has joined. 16:13:31 -!- nooodl has joined. 16:13:36 -!- ais523 has joined. 16:17:44 -!- carado has joined. 16:27:18 -!- conehead has joined. 16:28:50 -!- AnotherTest has joined. 16:36:05 -!- augur has quit (Remote host closed the connection). 16:39:38 -!- Koen_ has quit (Read error: Operation timed out). 16:41:00 -!- Koen_ has joined. 17:07:44 -!- Bike_ has joined. 17:09:05 -!- Bike_ has changed nick to Bike. 17:10:03 -!- sebbu has quit (Read error: Connection reset by peer). 17:10:26 -!- sebbu has joined. 17:11:03 -!- sebbu has quit (Changing host). 17:11:03 -!- sebbu has joined. 17:17:34 -!- sirdancealo2 has quit (Read error: Operation timed out). 17:21:49 -!- augur has joined. 17:23:00 I can't help but notice that people seem to be finding their voices. 17:23:36 do you mean like the little mermaid? 17:24:01 Well, also fizzie and Gregor 17:24:19 pretty sure gregor's a mermaid. 17:24:19 Bike: You have 1 new message. '/msg lambdabot @messages' to read it. 17:25:08 * Gregor searches him/herself for sexual organs. 17:26:35 a merman 17:32:53 -!- sirdancealo2 has joined. 17:33:26 -!- ais523 has quit. 17:33:39 -!- ThatOtherPerson has quit (Quit: Leaving). 17:36:31 Merfish. Oh wait. 17:37:26 Are merpeople werefish? 17:37:47 Or the other way around. 17:40:12 Hmm. "Were" is Old English for a male human. 17:40:17 Are there wyfwolfs? 17:43:08 * Phantom_Hoover remembers that when he quit last night Sgeo was explaining how to fix racism 17:43:14 * Phantom_Hoover logreads 17:45:00 I just got 100% on Guitar Hero 3 Medium Difficulty Knights of Cydonia 17:45:25 quick wiqui question: what the liquid brimstone is that revolution 9 page? 17:46:03 fizzie: i would like you to see https://dl.dropboxusercontent.com/u/13786158/portraits/el-op.png 17:48:18 boily: it is what we have to expect more of if Gregor ever gets devoiced inappropriately. 17:51:04 why can't I be devoiced inappropriately? 17:53:28 -!- ChanServ has set channel mode: -v coppro. 17:56:18 elliott: that was clearly appropriate 17:57:01 it's not appropriate to devoice someone without voice 17:57:33 Taneb: congratst 17:57:59 kmc, I've been trying to do that for ages 18:09:23 -!- epicmonkey has quit (Ping timeout: 258 seconds). 18:10:08 elliott, oh my god 18:10:14 your handwriting is the girliest ever 18:10:56 I presume "eliot" is my imaginary second middle name 18:11:35 Phantom_Hoover: wtf 18:11:37 it's monqy's handwriting 18:11:40 come on 18:12:37 i thought it was elliott's op campaign's handwriting 18:15:21 -!- pib2013 has quit (Remote host closed the connection). 18:19:59 -!- mnoqy has joined. 18:20:01 oh 18:20:12 mnoqy, you have the girliest handwriting ever 18:20:19 hi 18:20:51 mnoqy: you should draw a self portrait of Phantom_Hoover 18:21:01 shachaf: sure 18:21:06 im eating brunch now though 18:21:25 shachaf: how can you self-portrait of somebody else? 18:22:14 boily: um, by drawing it? 18:22:24 boily: i didn't say a *self* self-portrait 18:23:29 oh, my mistake. 18:24:29 -!- ThatOtherPerson has joined. 18:30:58 If mnoqy's rye, I'm barley. 18:31:26 hi 18:31:36 barley legal? 18:31:38 corn I be a cereal too? I ear that it's a-maize-ing. 18:32:41 The good ol' boys were drinking Whisky in mnoqy 18:53:57 -!- augur has quit (Read error: Connection reset by peer). 18:54:26 -!- augur has joined. 19:15:02 -!- sirdancealo2 has quit (Ping timeout: 245 seconds). 19:19:01 -!- sirdancealo2 has joined. 19:19:01 -!- epicmonkey has joined. 19:19:34 -!- AnotherTest has quit (Quit: Leaving.). 19:20:12 -!- constant has changed nick to function. 19:30:40 -!- ThatOtherPerson has quit (Quit: Leaving). 19:40:20 * impomatic pops in quickly to see if anyone's talking about esoteric programming... 19:41:18 -!- augur has quit (Remote host closed the connection). 19:42:56 hi impomatic 19:45:21 Hi kmc :-) 19:45:43 -!- augur has joined. 19:57:01 Phantom_Hoover, help 19:57:09 People on Facebook are talking about bitcoin 19:57:10 Well 19:57:17 Person on Facebook is talking about bitcoin 20:01:09 -!- Taneb has quit (Quit: Leaving). 20:07:15 my twitter feed is all bitcoin all the time 20:07:27 except that today it's all about bombs that went off at the boston marathon :/ 20:08:04 Hmmm... I missed that. 20:08:09 * impomatic goes to read the news 20:08:16 pretty fucked up 20:08:22 i think everyone I know is safe 20:11:04 copumpkin: you're in CT these days right? 20:11:11 -!- mnoqy has quit (Quit: hello). 20:11:39 sounds like your colleages in back bay might have been evacuated, hope nothing worse than that 20:13:47 -!- ogrom has quit (Quit: Left). 20:17:10 wait 20:17:16 why is taneb asking me for help 20:17:25 am i like the designated expert on making fun of bitcoin 20:17:27 you're The Bitcoin Person now 20:17:28 sorry 20:18:50 I wonder which is worse: being the canadian person, or the bitcoin person. 20:19:58 bitcoin person 20:20:05 Prboably being the Canadian bitcoin person 20:20:53 also: fuck, watching four lions is going to be even more uncomfortable now 20:23:42 ~duck four lions 20:23:43 Four Lions (2010) is a British dark comedy film. 20:25:01 -!- bengt_ has quit (Ping timeout: 245 seconds). 20:25:06 apparently "jihad satire" is a genre 20:25:39 "According to Psychology Today," blugh 20:27:19 -!- bengt_ has joined. 20:32:55 -!- zzo38 has quit (Remote host closed the connection). 20:35:38 -!- Bike_ has joined. 20:36:30 -!- Bike has quit (Disconnected by services). 20:36:31 -!- Bike_ has changed nick to Bike. 20:37:12 -!- Nisstyre has quit (Quit: Leaving). 20:37:51 Bike, it's a very good film actually. 20:38:07 cool 20:40:03 -!- pib1978 has joined. 20:41:41 -!- bengt_ has quit (Ping timeout: 245 seconds). 20:43:20 -!- bengt_ has joined. 20:47:19 -!- copumpkin has quit (Ping timeout: 252 seconds). 20:47:59 -!- copumpkin has joined. 21:06:41 -!- quintopia has quit (Read error: Operation timed out). 21:06:49 -!- quintopia has joined. 21:10:01 -!- bengt_ has quit (Ping timeout: 245 seconds). 21:11:59 -!- augur has quit (Remote host closed the connection). 21:14:49 -!- bengt_ has joined. 21:20:46 -!- TeruFSX has joined. 21:27:10 -!- epicmonkey has quit (Ping timeout: 258 seconds). 21:32:35 http://en.wikipedia.org/wiki/File:Eminent_Domain_50_States.jpg 21:32:40 loving that description 21:32:47 i guess npov doesn't extend to images 21:32:56 -!- bengt_ has quit (Ping timeout: 245 seconds). 21:33:17 heh 21:33:31 also loving that it's a jpeg 21:33:50 -!- bengt_ has joined. 21:34:15 Phantom_Hoover: http://commons.wikimedia.org/w/index.php?title=File:SIR_448_at_Great_Kills_Station.jpg&oldid=61691747 21:34:22 would it being taken down for copyright be ironic 21:34:38 ...yes 21:34:40 yes it would 21:35:04 kmc: holy shit 21:36:26 it's not false, it's just not an accurate description of the picture 21:37:34 also yes there's a stop on the line named Great Kills 21:37:39 blame the dutch 21:37:48 fucking dutch 21:37:52 New Dorp 21:37:53 almost as bad as the swedes 21:38:08 low countries more like blow countries 21:38:28 amsterdam more like hamsterspam 21:38:34 -!- epicmonkey has joined. 21:42:09 -!- calamari has joined. 21:48:35 -!- function has changed nick to trout. 21:48:42 :t trout 21:48:44 Not in scope: `trout' 21:48:52 boily: ? 21:49:23 you were a function, therefore you had a type. ischiomorphism seems to have destroyed it, sadly. 21:50:43 i want a haskell library for ichthyomorphisms 21:51:26 Control.Monad.Blowfish 21:51:56 ~duck ichtyology 21:51:57 Ichthyology is the branch of zoology devoted to the study of fish. 21:52:13 cryptoichthyology 21:52:14 s/ischio/ichtyo/ 21:52:53 i guess nessie isn't technically a fish 21:52:57 with a fish operator: >~)))°> 21:53:54 what is it then 21:54:01 amphibian? 21:54:21 monster 21:54:46 monster is not a kingdom 21:54:48 a dinosaur 21:55:15 monstriae 21:55:18 huh, i didn't know dinosauria was actually a clade 21:55:34 also: neither is amphibian 21:55:43 yeah 21:56:10 it's not like a billion different genera names don't mean "monster" or "monstrous" anyway 21:56:32 genus that's the singular get it together bike 22:03:21 -!- bengt_ has quit (Ping timeout: 245 seconds). 22:04:31 -!- augur has joined. 22:06:51 -!- bengt_ has joined. 22:12:28 -!- EgoBot has quit (Read error: Connection reset by peer). 22:13:21 -!- bengt_ has quit (Ping timeout: 245 seconds). 22:13:28 -!- EgoBot has joined. 22:14:03 -!- calamari has quit (Quit: Bye). 22:14:23 -!- bengt_ has joined. 22:18:46 -!- bengt_ has quit (Ping timeout: 245 seconds). 22:21:52 -!- bengt_ has joined. 22:22:55 -!- boily has quit (Quit: Poulet!). 22:22:59 -!- metasepia has quit (Remote host closed the connection). 22:32:52 -!- ChanServ has set channel mode: -v fizzie. 22:33:17 It hasn't been fizzie day here for a while, I think I can get rid of the "idiot flag". 22:37:12 is that another name for the bozo bit? 22:38:46 -!- bengt_ has quit (Ping timeout: 245 seconds). 22:39:15 What is "the bozo bit"? 22:40:24 -!- ChanServ has set channel mode: +v fizzie. 22:41:20 -!- bengt_ has joined. 22:42:52 -!- carado has quit (Ping timeout: 246 seconds). 22:43:47 oh nice 22:43:50 -!- epicmonkey has quit (Ping timeout: 258 seconds). 22:43:56 linode credit card numbers have leaked 22:43:58 wooooooo 22:44:02 maybe i should find another vps provider 22:44:30 do you even 22:44:33 I'm at tilaa.com now, because they had such a nonsense explanation for the name. 22:44:34 have a credit card 22:44:49 And esp. for the logo. 22:45:09 why are they called tilaa 22:46:34 Because it's the Finnish word (more or less) for "space". (Like, empty space; not space space.) 22:46:52 And their logo is a wolf, because the wolf is the king of wide open spaces. 22:46:57 Phantom_Hoover: well it might be a debit card thing 22:46:58 Or something like that. 22:46:58 i don't know 22:47:07 all i know is it's a piece of plastic and used as a credit card for linode 22:47:10 (They're not a Finnish company or anything.) 22:47:27 fizzie: you used prgmr previously right? 22:47:32 Yes. 22:48:21 https://support.tilaa.com/entries/22447921-What-does-Tilaa-mean- https://support.tilaa.com/entries/22467097-What-does-the-wolf-in-your-logo-have-to-do-with-Tilaa- 22:48:21 -!- bengt_ has quit (Ping timeout: 245 seconds). 22:48:36 "In Finland, the wolf is the ruler of the open space." 22:48:45 It is kind of "what." 22:49:24 I don't even know if they have any Finnish employees. 22:49:42 Maybe they just randomly picked Finland to mock. 22:49:51 -!- bengt_ has joined. 22:50:21 -!- Bike has quit (Ping timeout: 252 seconds). 22:52:08 -!- Bike has joined. 22:56:16 -!- bengt_ has quit (Ping timeout: 245 seconds). 22:57:50 -!- bengt_ has joined. 22:57:58 -!- Nisstyre-laptop has joined. 23:05:28 -!- nooodl has quit (Ping timeout: 256 seconds). 23:27:56 -!- TeruFSX has quit (Ping timeout: 245 seconds). 23:35:10 Is there any good reason for forms to be able to POST to other domains? 23:35:51 free speech 23:47:57 Sgeo: have you read The Tangled Web? 23:48:00 really good book on websec 23:48:07 i don't know if it has the answer to that question 23:48:12 but it's informative and quite entertaining 23:48:45 Remind me to buy that next week when I have money 23:48:50 -!- btiffin has joined. 23:49:31 form is just a gui to make a http request 23:50:43 But it doesn't obey same origin policy the way XMLHttpRequest does 23:50:49 Same origin policy is so inconsistent .-. 23:50:55 Forms existed befor same origin policy did. 23:51:05 And they can't possibly remove stuff because then things would break. 23:51:29 telnet doesnt obey same origin policy 23:53:24 yeah 23:53:33 also cookies don't follow SOP, they have their own slightly different policy 23:54:01 the crunchiness policy 23:54:25 just don't get pickles in your cookies 23:54:36 websec slash cooking advice 23:54:41 don't put pickles in your cookies 23:54:44 always salt your hash 23:55:09 Sgeo: do you know about CSRF and how to prevent it? 23:55:56 I know of one way that's supposed to prevent it... a token given to any page that needs to POST stuff, and the token needs to be given back 23:56:11 yeah 23:56:21 but typically, the server doesn't know or care what the 'right' token is 23:56:23 But wouldn't requiring something like X-Requested-With: blah or requiring Content-Type to be application/json work? 23:56:38 it just verifies that the token submitted as part of the form matches the token in a cookie 23:56:58 a CSRF attacker controls the former, and the latter is part of the ambient authority that they're trying to exploit but can't use directly 23:57:04 can't see directly, anyway 23:58:08 yeah, sometimes you put the token in a custom header instead of a field element 23:58:19 but either way it has to match that cookie 23:58:37 this gives rise to a sort of variation on a session fixation attack, call it a csrf token fixation attack 23:59:02 say that lolbutts.github.com is controlled by an attacker 23:59:15 they can set a cookie for *.github.com that contains a csrf token of their choice 23:59:34 then use it to CSR-forge requests to the main github app 23:59:45 How do you CSR-forge a custom header anyway?