< 1388103834 241448 :MindlessDrone!~MindlessD@HSI-KBW-37-49-6-33.hsi14.kabel-badenwuerttemberg.de QUIT :Quit: MindlessDrone < 1388103990 45821 :yorick!~yorick@oftn/member/yorick QUIT :Remote host closed the connection < 1388104750 31291 :w00tles!~textual@87-104-164-168-dynamic-customer.profibernet.dk QUIT :Quit: quit < 1388105157 464004 :tromp_!~tromp@ool-4570a22a.dyn.optonline.net QUIT :Read error: Connection reset by peer < 1388105188 750037 :tromp_!~tromp@ool-4570a22a.dyn.optonline.net JOIN :#esoteric < 1388105222 775937 :olsner!~salparot@78-72-235-77-no50.business.telia.com JOIN :#esoteric < 1388105555 754362 :olsner!~salparot@78-72-235-77-no50.business.telia.com QUIT :Ping timeout: 252 seconds < 1388106055 975287 :Bike!~Glossina@71-222-50-135.ptld.qwest.net PRIVMSG #esoteric :meanwhile in r/bitcoin http://mibpaste.com/uXYrCS < 1388106122 566386 :Jafet!~jafet@unaffiliated/jafet PRIVMSG #esoteric :http://superuser.com/questions/693440/why-does-an-exe-file-not-appear-as-ones-and-zeros-in-a-text-editor-such-as-notep < 1388106144 397612 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :the top answer's going to be sensible, isn't it < 1388106179 634636 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :yep < 1388106226 759410 :nooodl!~nooodl@91.177.112.9 PRIVMSG #esoteric :imo too sensible < 1388106242 200604 :nooodl!~nooodl@91.177.112.9 PRIVMSG #esoteric :These answers are very long. / The simple answer is: Notepad tries to see the 0s and 1s as text, which is its job. It doesn't realize they are not text and just displays what it can, which is a big jumble of letters that make no sense. < 1388106252 735318 :Bike!~Glossina@71-222-50-135.ptld.qwest.net PRIVMSG #esoteric :nice painting. < 1388106254 392735 :nooodl!~nooodl@91.177.112.9 PRIVMSG #esoteric :^ that's probably enough < 1388106266 64434 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :1s, 0s, and whitespace < 1388106274 106926 :nooodl!~nooodl@91.177.112.9 PRIVMSG #esoteric :most of all it did not need an arthur dove painting to bring the point across < 1388106290 627347 :Bike!~Glossina@71-222-50-135.ptld.qwest.net PRIVMSG #esoteric :yeah it did < 1388106296 437489 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :I was hoping there'd be a plausible-looking answer that's completely wrong near the top < 1388106306 213264 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :but it's superuser, not yahoo! answers < 1388106315 527426 :nooodl!~nooodl@91.177.112.9 PRIVMSG #esoteric :anyway there is some nonexciting esolanging happening http://esolangs.org/wiki/Gs2#Commands "wip" < 1388106322 641465 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :I saw that in recent changes < 1388106334 546227 :nooodl!~nooodl@91.177.112.9 PRIVMSG #esoteric :the from/to columns are uh halfway between forth stack diagram things and type signatures < 1388106341 910966 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric :http://mushroomobserver.org/image/show_image/393975?_js=on&_new=true&obs=156302&q=1hq7D weird-ass mutant mushroom, via douglass_ < 1388106347 660875 :nooodl!~nooodl@91.177.112.9 PRIVMSG #esoteric :i should've maybe figured out which one i wanna use < 1388106369 102051 :Bike!~Glossina@71-222-50-135.ptld.qwest.net PRIVMSG #esoteric :kmc: nice fronds babe < 1388106373 498043 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric ::3 < 1388106374 791316 :Bike!~Glossina@71-222-50-135.ptld.qwest.net PRIVMSG #esoteric :what the hell are those < 1388106584 533432 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :one time i tried to download a .exe file from some strange server but instead of 0s and 1s it had 0s and 2s < 1388106602 122595 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :almost broke my computer. F- would not download again < 1388106607 914498 :Bike!~Glossina@71-222-50-135.ptld.qwest.net PRIVMSG #esoteric :futurama joke < 1388106615 735622 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :help < 1388106631 991069 :Bike!~Glossina@71-222-50-135.ptld.qwest.net PRIVMSG #esoteric :futumura joke?? < 1388106642 28330 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :where < 1388106666 766163 :tromp__!~tromp@ool-4570a22a.dyn.optonline.net JOIN :#esoteric < 1388106691 918172 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric :my file had p's and q's < 1388106693 608818 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :http://tech.karbassi.com/2008/01/15/futurama-benders-big-score-binary-joke/ ?? < 1388106702 394988 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :"Now, if you take the whole thing by itself, it’s not a 16-bit code, but 32-bit. I believe IBM made a few super computers that handle 32-bit binary." < 1388106707 528966 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric :super < 1388106776 758361 :tromp_!~tromp@ool-4570a22a.dyn.optonline.net QUIT :Ping timeout: 252 seconds < 1388107022 571132 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :shachaf: I like sentences like "I believe IBM made a few super computers that handle 32-bit binary." because they're true, and yet make the speaker sound horrifically uninformed < 1388107300 921514 :oerjan!oerjan@sprocket.nvg.ntnu.no QUIT :Quit: Knyte < 1388108404 511807 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :ais523: Do you have a collection of them? < 1388108413 238178 :ais523!~ais523@unaffiliated/ais523 PRIVMSG #esoteric :no < 1388108940 244989 :zzo38!~zzo38@24-207-57-25.eastlink.ca PRIVMSG #esoteric :Do you know about iNES mapper 90? It has many strange things that don't make sense, such as: bit reversed mode for PRG bank numbers, the ability to change $6000-$7FFF between open bus and ROM (not RAM), two different ways to set nametable mirroring (which one is used is both software-controlled and controlled by a jumper), IRQ "funky mode", ability to set direction of IRQ counter. < 1388108959 874497 :Bike!~Glossina@71-222-50-135.ptld.qwest.net PRIVMSG #esoteric :tell me more about the funk. < 1388108999 783177 :Sprocklem!~Sprocklem@S010674440130be65.cg.shawcable.net JOIN :#esoteric < 1388109015 756424 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric :is the jumper user-accessible on the cart? < 1388109020 29064 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric :also what is nametable mirroring? < 1388109135 662704 :zzo38!~zzo38@24-207-57-25.eastlink.ca PRIVMSG #esoteric :Nametable mirroring in the Famicom is used to determine how the CIRAM is mirrored, which changes the arrangement of the four background screens; for example, if the right screen and left screen are the same, or if the top screen and bottom screen are the same instead. However there are more complicated kinds two, these are just the two simple kinds of nametable mirroring. < 1388109173 943198 :zzo38!~zzo38@24-207-57-25.eastlink.ca PRIVMSG #esoteric :I don't know if the jumper is user-accessible. I also don't know how the "funky mode" works. < 1388109873 474218 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric :`unidecode Ɛ < 1388109875 425595 :HackEgo!dlopen@libdl.so PRIVMSG #esoteric :​[U+0190 LATIN CAPITAL LETTER OPEN E] < 1388110467 984048 :Bike!~Glossina@71-222-50-135.ptld.qwest.net QUIT :Ping timeout: 272 seconds < 1388110565 458650 :Sorella!~quildreen@oftn/member/Sorella QUIT :Remote host closed the connection < 1388110578 854801 :Bike!~Glossina@216-161-90-94.ptld.qwest.net JOIN :#esoteric < 1388111869 777903 :Sprocklem!~Sprocklem@S010674440130be65.cg.shawcable.net QUIT :Ping timeout: 252 seconds < 1388113675 809882 :^v!~NotPing@c-71-238-153-166.hsd1.mi.comcast.net QUIT :Quit: http://i.imgur.com/MHuW96t.gif < 1388114139 392662 :conehead!~conehead@unaffiliated/conehead JOIN :#esoteric < 1388115276 356979 :nooodl!~nooodl@91.177.112.9 QUIT :Quit: Ik ga weg < 1388115602 622544 :zzo38!~zzo38@24-207-57-25.eastlink.ca PRIVMSG #esoteric :I am in progress typing of Dungeons&Dragons game. I did play the game yesterday, in fact. But now there is a problem, but I do have a plan. < 1388117494 602098 :coppro!raedford@taurine.csclub.uwaterloo.ca PRIVMSG #esoteric :that... < 1388117514 922014 :zzo38!~zzo38@24-207-57-25.eastlink.ca PRIVMSG #esoteric :What about that? < 1388117526 898864 :coppro!raedford@taurine.csclub.uwaterloo.ca PRIVMSG #esoteric :I'm trying to parse the first sentence < 1388118294 309472 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric :zzo38 Teaches Typing < 1388118504 476253 :pikhq_!~pikhq@2602:100:4751:9692:a60:6eff:fece:493 JOIN :#esoteric < 1388118563 717704 :pikhq!~pikhq@2602:100:4751:9692:a60:6eff:fece:493 QUIT :Ping timeout: 240 seconds < 1388119405 920599 :carado!~user4539@2a01:e35:8b61:e430:6ef0:49ff:fe73:1fd0 QUIT :Ping timeout: 246 seconds < 1388119681 141093 :mauke!~mauke@p3m/member/mauke QUIT :Disconnected by services < 1388119691 296838 :mauke!~mauke@p3m/member/mauke JOIN :#esoteric < 1388119804 898886 :preflex!~preflex@unaffiliated/mauke/bot/preflex QUIT :Ping timeout: 246 seconds < 1388119840 283006 :tromp__!~tromp@ool-4570a22a.dyn.optonline.net QUIT :Remote host closed the connection < 1388119892 205889 :preflex!~preflex@unaffiliated/mauke/bot/preflex JOIN :#esoteric < 1388120915 375942 :Sgeo!~quassel@ool-44c2df0c.dyn.optonline.net PRIVMSG #esoteric ::( at unmarked cabs < 1388120938 60749 :zzo38!~zzo38@24-207-57-25.eastlink.ca PRIVMSG #esoteric :Unlike chess, planning ahead is much more difficult because of unknown information, but is just as important! < 1388120967 122297 :zzo38!~zzo38@24-207-57-25.eastlink.ca PRIVMSG #esoteric :But, like in correspondence chess, there is enough time between sessions to think of it. < 1388120970 451449 :quintopia!~quintopia@unaffiliated/quintopia PRIVMSG #esoteric :zzo38: how many non-attacking bishops can you place on a chessboard? < 1388121017 665162 :Sgeo!~quassel@ool-44c2df0c.dyn.optonline.net PRIVMSG #esoteric :ACTION assumes the answer is greater than -1 < 1388121029 305954 :zzo38!~zzo38@24-207-57-25.eastlink.ca PRIVMSG #esoteric :quintopia: Do you mean like the queen puzzle, but only with diagonal moves? < 1388121040 152579 :quintopia!~quintopia@unaffiliated/quintopia PRIVMSG #esoteric :yes < 1388121047 253437 :zzo38!~zzo38@24-207-57-25.eastlink.ca PRIVMSG #esoteric :I don't know. < 1388121074 781763 :conehead!~conehead@unaffiliated/conehead QUIT :Quit: Computer has gone to sleep. < 1388121102 98182 :zzo38!~zzo38@24-207-57-25.eastlink.ca PRIVMSG #esoteric :You could make the split between the dark squares and light squares, so I would think the answer would be some even number. < 1388121127 342594 :quintopia!~quintopia@unaffiliated/quintopia PRIVMSG #esoteric :it is an even number :D < 1388121149 403045 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric :Sgeo: what about unmarked cabs < 1388121150 711188 :zzo38!~zzo38@24-207-57-25.eastlink.ca PRIVMSG #esoteric :OK, I got that much correct! < 1388121156 858525 :quintopia!~quintopia@unaffiliated/quintopia PRIVMSG #esoteric :also, you can fill an entire rank or file safely, so it's more than 8! < 1388121164 60637 :coppro!raedford@taurine.csclub.uwaterloo.ca PRIVMSG #esoteric :quintopia: no it's not < 1388121168 925104 :coppro!raedford@taurine.csclub.uwaterloo.ca PRIVMSG #esoteric :there are only 64 squares on a chessborad < 1388121169 113220 :quintopia!~quintopia@unaffiliated/quintopia PRIVMSG #esoteric :(in fact, that's a good path to a solution) < 1388121171 599030 :coppro!raedford@taurine.csclub.uwaterloo.ca PRIVMSG #esoteric :*chessboard < 1388121173 264306 :Sgeo!~quassel@ool-44c2df0c.dyn.optonline.net PRIVMSG #esoteric :kmc: cab company I was unfamiliar with sent a cab that was not obviously a cab < 1388121175 239119 :coppro!raedford@taurine.csclub.uwaterloo.ca PRIVMSG #esoteric :and 64 <<<<<< 8! < 1388121184 15045 :Sgeo!~quassel@ool-44c2df0c.dyn.optonline.net PRIVMSG #esoteric :Made me nervous so called company to check that it was in fact my cab < 1388121194 604929 :quintopia!~quintopia@unaffiliated/quintopia PRIVMSG #esoteric :coppro: hmm good point. < 1388121207 706718 :quintopia!~quintopia@unaffiliated/quintopia PRIVMSG #esoteric :also, you can fill an entire rank or file safely, so it's more than 8!/7! < 1388121235 542978 :Sgeo!~quassel@ool-44c2df0c.dyn.optonline.net PRIVMSG #esoteric :Also, unrelated to it being unmarked, the driver had me input the address into the GPS. If I were tech-illiterate, that would have really sucked < 1388121266 565783 :zzo38!~zzo38@24-207-57-25.eastlink.ca PRIVMSG #esoteric :Yes I realized that too, although I just instead to consider only the dark squares, and then the same solution can be mirrored for white-colored squares. < 1388121267 204844 :coppro!raedford@taurine.csclub.uwaterloo.ca PRIVMSG #esoteric :quintopia: is it 14? < 1388121268 923110 :quintopia!~quintopia@unaffiliated/quintopia PRIVMSG #esoteric :Sgeo: what a shit taxi company < 1388121287 648865 :Sgeo!~quassel@ool-44c2df0c.dyn.optonline.net PRIVMSG #esoteric :Not helpful: Driver not speaking English, so GPS was also in another language < 1388121288 826004 :quintopia!~quintopia@unaffiliated/quintopia PRIVMSG #esoteric :coppro: good jerb < 1388121293 878932 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :Sgeo: was it numbered 1729 < 1388121313 497923 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :Sgeo: that's a bad omen < 1388121331 455407 :quintopia!~quintopia@unaffiliated/quintopia PRIVMSG #esoteric :coppro: don't ask me to prove it, but i can see why it's intuitively optimal < 1388121352 944050 :coppro!raedford@taurine.csclub.uwaterloo.ca PRIVMSG #esoteric :quithe proof is easy < 1388121360 958574 :coppro!raedford@taurine.csclub.uwaterloo.ca PRIVMSG #esoteric :*quintopia: the < 1388121395 394341 :coppro!raedford@taurine.csclub.uwaterloo.ca PRIVMSG #esoteric :each color has 7 diagonals parallel to its main diagonal, so max 7 of each color < 1388121397 114478 :quintopia!~quintopia@unaffiliated/quintopia PRIVMSG #esoteric :coppro: is it? not every bishop attacks the same number of squares < 1388121401 539327 :Sgeo!~quassel@ool-44c2df0c.dyn.optonline.net PRIVMSG #esoteric :Also, ended up waiting over an hour for a bus because the bus I wanted was 10 minutes early < 1388121408 759614 :coppro!raedford@taurine.csclub.uwaterloo.ca PRIVMSG #esoteric :Sgeo: I hate that < 1388121418 660412 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :perhaps the bus was on time and the world was 10 minutes late < 1388121441 993568 :Sgeo!~quassel@ool-44c2df0c.dyn.optonline.net PRIVMSG #esoteric :I like trains. Trains don't show up so early you miss them < 1388121459 631064 :Sgeo!~quassel@ool-44c2df0c.dyn.optonline.net PRIVMSG #esoteric :Train stations also have nice billboards indicating when the train is late < 1388121488 578638 :coppro!raedford@taurine.csclub.uwaterloo.ca PRIVMSG #esoteric :trains might show up early in rare circumstances. But they don't leave early < 1388121502 954561 :coppro!raedford@taurine.csclub.uwaterloo.ca PRIVMSG #esoteric :unlike busses, have of whom don't know what a timepoint is < 1388121511 123961 :coppro!raedford@taurine.csclub.uwaterloo.ca PRIVMSG #esoteric :(their drivers don't know either) < 1388121512 278425 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric :*storms into cab with knife* drive this train to cuba! < 1388121520 350883 :quintopia!~quintopia@unaffiliated/quintopia PRIVMSG #esoteric :coppro: ah, so it does. i didn't know off the top of my head the number of diagonals of one color in one direction < 1388121569 477830 :coppro!raedford@taurine.csclub.uwaterloo.ca PRIVMSG #esoteric :I looked < 1388121574 618200 :coppro!raedford@taurine.csclub.uwaterloo.ca PRIVMSG #esoteric :cheating, I know < 1388121584 788971 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric :Sgeo: http://instagram.com/p/gWkKveSLwH/ < 1388121613 485042 :Sgeo!~quassel@ool-44c2df0c.dyn.optonline.net PRIVMSG #esoteric :Nowhen in particular too < 1388121922 759901 :tromp_!~tromp@ool-4570a22a.dyn.optonline.net JOIN :#esoteric < 1388122486 980013 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric :zzo38: http://jerkcity.com/_jerkcity5444.html < 1388122589 348519 :zzo38!~zzo38@24-207-57-25.eastlink.ca PRIVMSG #esoteric :kmc: Why does the filename start with an underscore? < 1388122603 303550 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric :that is a fine question < 1388122607 324656 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric :compare & contrast with http://jerkcity.com/jerkcity5444.html < 1388122616 633517 :Bike!~Glossina@216-161-90-94.ptld.qwest.net PRIVMSG #esoteric :this is the web, it's a /resource/, not a file < 1388122645 505505 :zzo38!~zzo38@24-207-57-25.eastlink.ca PRIVMSG #esoteric :O, that's what it means! < 1388123204 970464 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric :http://i.imgur.com/9skH9Qc.png < 1388123217 620731 :Sgeo!~quassel@ool-44c2df0c.dyn.optonline.net PRIVMSG #esoteric :zzo38: pretty sure Bike was making a sarcastic comment about web development < 1388123249 995044 :Bike!~Glossina@216-161-90-94.ptld.qwest.net PRIVMSG #esoteric :kmc: ain't that the truth < 1388123306 314194 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric :Bike: can you figure out why i was searching for Oryza ruderalis? < 1388123683 758287 :tromp_!~tromp@ool-4570a22a.dyn.optonline.net QUIT :Ping timeout: 252 seconds < 1388124033 200838 :glogbackup!~glogbacku@192.3.160.190 QUIT :Remote host closed the connection < 1388124033 891312 :Frooxius!~Frooxius@cust-101.ktknet.cz QUIT :Ping timeout: 272 seconds < 1388124262 295395 :nisstyre!~yours@oftn/member/Nisstyre QUIT :Ping timeout: 272 seconds < 1388124569 259870 :nisstyre!~yours@oftn/member/Nisstyre JOIN :#esoteric < 1388126411 763041 :copumpkin!~copumpkin@unaffiliated/copumpkin QUIT :Ping timeout: 252 seconds < 1388126542 300295 :zzo38!~zzo38@24-207-57-25.eastlink.ca PRIVMSG #esoteric :`danddreclist 47 < 1388126546 385397 :HackEgo!dlopen@libdl.so PRIVMSG #esoteric :danddreclist 47: shachaf nooodl boily \ http://zzo38computer.org/dnd/recording/level20.tex < 1388126677 942617 :zzo38!~zzo38@24-207-57-25.eastlink.ca PRIVMSG #esoteric :There it is! < 1388126798 242806 :zzo38!~zzo38@24-207-57-25.eastlink.ca PRIVMSG #esoteric :I did think of the plan what to do next, although I think I will require someone to enchant an object with a spell to recall it to someone's hand if they speak the command word. < 1388126853 957757 :zzo38!~zzo38@24-207-57-25.eastlink.ca PRIVMSG #esoteric :(It doesn't matter what the object is, as long as it can support things sitting on top.) < 1388126901 776866 :zzo38!~zzo38@24-207-57-25.eastlink.ca PRIVMSG #esoteric :I did think of other ways not involving magical things, but they either involve combination locks, which they don't have, or otherwise will be too slow. < 1388128324 948495 :augur!~augur@c-71-57-182-133.hsd1.fl.comcast.net QUIT :Read error: Connection reset by peer < 1388128351 5452 :augur!~augur@c-71-57-182-133.hsd1.fl.comcast.net JOIN :#esoteric < 1388128701 961486 :Frooxius!~Frooxius@cust-101.ktknet.cz JOIN :#esoteric < 1388128757 878007 :w00tles!~textual@87-104-164-168-dynamic-customer.profibernet.dk JOIN :#esoteric < 1388129752 393119 :Bike_!~Glossina@216-161-90-94.ptld.qwest.net JOIN :#esoteric < 1388129880 841660 :copumpkin!~copumpkin@unaffiliated/copumpkin JOIN :#esoteric < 1388130162 291969 :Bike!~Glossina@216-161-90-94.ptld.qwest.net QUIT :*.net *.split < 1388130162 731224 :realzies!~pinky@unaffiliated/realazthat QUIT :*.net *.split < 1388130163 330891 :iamcal!sid1110@gateway/web/irccloud.com/x-cmwfqsmhyzgpwtbz QUIT :*.net *.split < 1388130360 22825 :sebbu!~sebbu@unaffiliated/sebbu QUIT :Ping timeout: 240 seconds < 1388130573 390022 :realzies!~pinky@unaffiliated/realazthat JOIN :#esoteric < 1388130580 653218 :w00tles!~textual@87-104-164-168-dynamic-customer.profibernet.dk QUIT :Quit: quit < 1388131015 843894 :w00tles!~textual@87-104-164-168-dynamic-customer.profibernet.dk JOIN :#esoteric < 1388131538 779192 :iamcal!sid1110@gateway/web/irccloud.com/x-cmwfqsmhyzgpwtbz JOIN :#esoteric < 1388132611 446648 :ais523!~ais523@unaffiliated/ais523 QUIT : < 1388132828 307452 :w00tles!~textual@87-104-164-168-dynamic-customer.profibernet.dk QUIT :Quit: quit < 1388133015 843773 :w00tles!~textual@87-104-164-168-dynamic-customer.profibernet.dk JOIN :#esoteric < 1388133500 796400 :zzo38!~zzo38@24-207-57-25.eastlink.ca QUIT :Remote host closed the connection < 1388133779 389123 :forzartus!~forzartus@83.145.93.98 JOIN :#esoteric < 1388133846 869199 :forzartus!~forzartus@83.145.93.98 PART :#esoteric < 1388135774 92376 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :https://en.wikipedia.org/wiki/Diameter#Diameter_symbol literally has detailed instructions on which keys to press in order to enter the wrong codepoint < 1388136115 94707 :ion!ion@heh.fi PRIVMSG #esoteric :hah < 1388136392 262081 :w00tles!~textual@87-104-164-168-dynamic-customer.profibernet.dk QUIT :Quit: quit < 1388136415 936928 :w00tles!~w00tles@87-104-164-168-dynamic-customer.profibernet.dk JOIN :#esoteric < 1388136422 475450 :w00tles!~w00tles@87-104-164-168-dynamic-customer.profibernet.dk QUIT :Max SendQ exceeded < 1388136465 493920 :w00tles!~w00tles@87-104-164-168-dynamic-customer.profibernet.dk JOIN :#esoteric < 1388136689 773235 :ter2!~tertu@65-128-138-136.mpls.qwest.net JOIN :#esoteric < 1388136905 755824 :tertu!~tertu@65-128-138-136.mpls.qwest.net QUIT :Ping timeout: 252 seconds < 1388136967 123616 :oerjan!oerjan@sprocket.nvg.ntnu.no JOIN :#esoteric < 1388137366 293092 :sebbu!~sebbu@ADijon-152-1-15-110.w83-194.abo.wanadoo.fr JOIN :#esoteric < 1388137404 479759 :sebbu!~sebbu@ADijon-152-1-15-110.w83-194.abo.wanadoo.fr QUIT :Changing host < 1388137404 679018 :sebbu!~sebbu@unaffiliated/sebbu JOIN :#esoteric < 1388137532 761407 :ter2!~tertu@65-128-138-136.mpls.qwest.net QUIT :Ping timeout: 252 seconds < 1388137734 986931 :FreeFull!~freefull@defocus/sausage-lover PRIVMSG #esoteric :shachaf: On linux, altgr + o will give you ø, which is the letter rather than the diameter symbol < 1388137906 206799 :AnotherTest!~turingcom@94-224-30-45.access.telenet.be JOIN :#esoteric < 1388137944 265168 :Jafet!~jafet@unaffiliated/jafet PRIVMSG #esoteric :Codepoints don't really exist, only glyphs. (Some of the emoji glyphs are almost in the flesh.) < 1388139654 364011 :oerjan!oerjan@sprocket.nvg.ntnu.no PRIVMSG #esoteric : zzo38: how many non-attacking bishops can you place on a chessboard? <-- obvious upper bound, check. simple way of achieving it, check. < 1388139658 424422 :oerjan!oerjan@sprocket.nvg.ntnu.no PRIVMSG #esoteric :(mate) < 1388139683 302418 :oerjan!oerjan@sprocket.nvg.ntnu.no PRIVMSG #esoteric :ok, once you've split white and black squares. < 1388139822 997234 :Jafet!~jafet@unaffiliated/jafet PRIVMSG #esoteric :Sorry, but your reply is a bit stale. < 1388139906 339620 :oerjan!oerjan@sprocket.nvg.ntnu.no PRIVMSG #esoteric :well i had to reply before getting to the spoilers, OBVIOYSLY < 1388139930 108115 :oerjan!oerjan@sprocket.nvg.ntnu.no PRIVMSG #esoteric :(obvious to boily) < 1388141600 893860 :nooodl!~nooodl@91.177.112.9 JOIN :#esoteric < 1388141713 861447 :b_jonas!~x@russell2.math.bme.hu PRIVMSG #esoteric :oerjan: huh? that doesn't have an obvious upper bound < 1388141721 761019 :b_jonas!~x@russell2.math.bme.hu PRIVMSG #esoteric :oerjan: not a sharp one at least < 1388141728 572002 :b_jonas!~x@russell2.math.bme.hu PRIVMSG #esoteric :the upper bound is really non-obvious < 1388141748 557882 :b_jonas!~x@russell2.math.bme.hu PRIVMSG #esoteric :the lower bound is, mind you < 1388141748 761474 :oerjan!oerjan@sprocket.nvg.ntnu.no PRIVMSG #esoteric :no it's not, once you count the diagonals < 1388141775 405443 :b_jonas!~x@russell2.math.bme.hu PRIVMSG #esoteric :(unlike the rook and queen versions, which do have obvious sharp upper bounds) < 1388141841 615515 :oerjan!oerjan@sprocket.nvg.ntnu.no PRIVMSG #esoteric : each color has 7 diagonals parallel to its main diagonal, so max 7 of each color < 1388141858 394820 :oerjan!oerjan@sprocket.nvg.ntnu.no PRIVMSG #esoteric :i thought of the same thing before reading it < 1388141927 647681 :FreeFull!~freefull@defocus/sausage-lover PRIVMSG #esoteric :It depends on the size of the chessboard < 1388141947 843937 :FreeFull!~freefull@defocus/sausage-lover PRIVMSG #esoteric :Let me look up a standard sized one < 1388141965 732770 :FreeFull!~freefull@defocus/sausage-lover PRIVMSG #esoteric :Hmm, standard is 8*8 < 1388142004 983987 :FreeFull!~freefull@defocus/sausage-lover PRIVMSG #esoteric :You can place at least 14 non-attacking bishops < 1388142034 221710 :FreeFull!~freefull@defocus/sausage-lover PRIVMSG #esoteric :I don't know if you can place more < 1388142047 164960 :oerjan!oerjan@sprocket.nvg.ntnu.no PRIVMSG #esoteric :no you can't < 1388142124 224268 :FreeFull!~freefull@defocus/sausage-lover PRIVMSG #esoteric :You can fill up one side and then almost fill up the opposite side except for the corners < 1388142144 960948 :oerjan!oerjan@sprocket.nvg.ntnu.no PRIVMSG #esoteric :you can place 14 such that there is precisely one on each downwards white diagonal and one on each upwards black diagonal. < 1388142184 734357 :oerjan!oerjan@sprocket.nvg.ntnu.no PRIVMSG #esoteric :e.g. in the way you said (which is also the way i found) < 1388142264 611275 :FreeFull!~freefull@defocus/sausage-lover PRIVMSG #esoteric :Technically, you could just completely fill the chessboard with white bishops < 1388142278 226434 :FreeFull!~freefull@defocus/sausage-lover PRIVMSG #esoteric :Since they are the same colour, they won't attack each other < 1388142307 705380 :FreeFull!~freefull@defocus/sausage-lover PRIVMSG #esoteric :I don't think that's what was meant though < 1388142346 523815 :oerjan!oerjan@sprocket.nvg.ntnu.no PRIVMSG #esoteric :you don't say < 1388142395 709141 :FreeFull!~freefull@defocus/sausage-lover PRIVMSG #esoteric :Assuming all bishops can attach each other, 14 < 1388142428 562506 :impomatic!~digital_w@150.20.208.46.dyn.plus.net JOIN :#esoteric < 1388142549 920637 :oerjan!oerjan@sprocket.nvg.ntnu.no PRIVMSG #esoteric :bishops are scheming bastards < 1388142563 781993 :FreeFull!~freefull@defocus/sausage-lover PRIVMSG #esoteric :attack < 1388142607 922681 :Sorella!~quildreen@201.80.214.167 JOIN :#esoteric < 1388142637 134997 :oerjan!oerjan@sprocket.nvg.ntnu.no PRIVMSG #esoteric :perhaps bishops of the same color _can_ attack each other, and that's why they're safely kept on different colors. < 1388142647 350725 :Sorella!~quildreen@201.80.214.167 QUIT :Changing host < 1388142647 551715 :Sorella!~quildreen@oftn/member/Sorella JOIN :#esoteric < 1388142695 58784 :MindlessDrone!~MindlessD@vpn34-243.rz.hs-offenburg.de JOIN :#esoteric < 1388142703 343141 :oerjan!oerjan@sprocket.nvg.ntnu.no PRIVMSG #esoteric :it all makes sense now. < 1388142870 745530 :oerjan!oerjan@sprocket.nvg.ntnu.no PRIVMSG #esoteric :i think i've managed my first negative karma reddit comment. or alternatively, somehow managed to avoid any before now. < 1388142969 666288 :FreeFull!~freefull@defocus/sausage-lover PRIVMSG #esoteric :Can you link to it? < 1388142994 679490 :oerjan!oerjan@sprocket.nvg.ntnu.no PRIVMSG #esoteric :i somehow feel that would be vote cheating :P < 1388143001 44624 :oerjan!oerjan@sprocket.nvg.ntnu.no PRIVMSG #esoteric :(it's only at -1 though) < 1388143116 146170 :FreeFull!~freefull@defocus/sausage-lover PRIVMSG #esoteric :I just want to see what it is < 1388143165 395197 :oklopol!~oklopol@dyn60-339.yok.fi PRIVMSG #esoteric :what is it oerjan?? < 1388143184 762283 :oerjan!oerjan@sprocket.nvg.ntnu.no PRIVMSG #esoteric :http://www.reddit.com/r/math/comments/1tpxxk/my_math_teacher_posted_this_i_need_your_help_guys/ceaenhx?context=3 < 1388143252 563151 :oklopol!~oklopol@dyn60-339.yok.fi PRIVMSG #esoteric :" Hmm, standard is 8*8" you don't know chess? < 1388143272 431878 :oerjan!oerjan@sprocket.nvg.ntnu.no PRIVMSG #esoteric :`? freefull < 1388143276 636787 :HackEgo!dlopen@libdl.so PRIVMSG #esoteric :FreeFull is either full of freedom or free of fulldom, we are not sure. < 1388143287 332804 :oerjan!oerjan@sprocket.nvg.ntnu.no PRIVMSG #esoteric :no room for chess < 1388143312 142443 :oklopol!~oklopol@dyn60-339.yok.fi PRIVMSG #esoteric :okay < 1388143314 184459 :oklopol!~oklopol@dyn60-339.yok.fi PRIVMSG #esoteric :i understand < 1388143380 106684 :FreeFull!~freefull@defocus/sausage-lover PRIVMSG #esoteric :oerjan: I can think of cases where the correct answer wouldn't be 0%, but the case on the board isn't one of those < 1388143417 961695 :oklopol!~oklopol@dyn60-339.yok.fi PRIVMSG #esoteric :i don't actually know where the karma thingie is shown < 1388143421 196239 :oklopol!~oklopol@dyn60-339.yok.fi PRIVMSG #esoteric :(nor what it is) < 1388143577 477323 :oerjan!oerjan@sprocket.nvg.ntnu.no PRIVMSG #esoteric :oklopol: just after the nickname < 1388143588 163378 :oerjan!oerjan@sprocket.nvg.ntnu.no PRIVMSG #esoteric :(also you bastards upvoted it :P) < 1388143651 217169 :FreeFull!~freefull@defocus/sausage-lover PRIVMSG #esoteric :=P < 1388143898 538518 :oerjan!oerjan@sprocket.nvg.ntnu.no PRIVMSG #esoteric :i suppose the ui doesn't use the term karma anywhere. < 1388143938 449624 :oerjan!oerjan@sprocket.nvg.ntnu.no PRIVMSG #esoteric :actually it's (mostly) translated to norwegian so i wouldn't really know. < 1388143972 894545 :Taneb!~Taneb@runciman.hacksoc.org PRIVMSG #esoteric :What do you guys think of the Lamdu programmming language thing that was on reddit the other day < 1388144025 145018 :oerjan!oerjan@sprocket.nvg.ntnu.no PRIVMSG #esoteric :i got this "not real haskell" reaction < 1388144053 992671 :Taneb!~Taneb@runciman.hacksoc.org PRIVMSG #esoteric :oerjan, a lot of things aren't real haskell < 1388144125 156592 :Taneb!~Taneb@runciman.hacksoc.org PRIVMSG #esoteric :But I know what you mean < 1388144254 617668 :FreeFull!~freefull@defocus/sausage-lover PRIVMSG #esoteric :I am pondering making my caps lock into greek shift < 1388144276 441179 :Taneb!~Taneb@runciman.hacksoc.org PRIVMSG #esoteric :Oooh, that sounds like a good idea < 1388144288 987054 :FreeFull!~freefull@defocus/sausage-lover PRIVMSG #esoteric :And then shift+capslock can be capslock < 1388144300 168660 :Taneb!~Taneb@runciman.hacksoc.org PRIVMSG #esoteric :Or cyrillic < 1388144307 596894 :FreeFull!~freefull@defocus/sausage-lover PRIVMSG #esoteric :Or maybe make capslock be shiftlock, and then shift+capslock be greek shift < 1388144326 878530 :FreeFull!~freefull@defocus/sausage-lover PRIVMSG #esoteric :If I really want to write cyrillic I'll switch keyboard layouts < 1388144631 342982 :Taneb!~Taneb@runciman.hacksoc.org PRIVMSG #esoteric :I think I just heard thunder < 1388144677 978518 :impomatic!~digital_w@150.20.208.46.dyn.plus.net PRIVMSG #esoteric :I want that Mandelbrot Blanket :-) < 1388145470 168245 :Phantom_Hoover!~Phantom@unaffiliated/phantom-hoover PRIVMSG #esoteric :you want shift+capslock to be capital greek letters surely < 1388145867 975869 :hogeyui_!~hogeyuiVP@vps.usamimi.biz QUIT :Ping timeout: 260 seconds < 1388146897 982951 :hogeyui_!~hogeyuiVP@vps.usamimi.biz JOIN :#esoteric < 1388148267 275822 :oerjan!oerjan@sprocket.nvg.ntnu.no QUIT :Quit: leaving < 1388148429 903781 :hogeyui_!~hogeyuiVP@vps.usamimi.biz QUIT :Ping timeout: 272 seconds < 1388148930 740104 :Sgeo!~quassel@ool-44c2df0c.dyn.optonline.net QUIT :Read error: Connection reset by peer < 1388149204 864762 :zzo38!~zzo38@24-207-57-25.eastlink.ca JOIN :#esoteric < 1388149479 74374 :hogeyui_!~hogeyuiVP@vps.usamimi.biz JOIN :#esoteric < 1388149578 278288 :FreeFull!~freefull@defocus/sausage-lover PRIVMSG #esoteric :Phantom_Hoover: If I want capitals I'll use shift when pressing the key < 1388149588 736782 :FreeFull!~freefull@defocus/sausage-lover PRIVMSG #esoteric :greek shift is a toggle I think < 1388149601 533552 :FreeFull!~freefull@defocus/sausage-lover PRIVMSG #esoteric :Maybe it's greek lock < 1388149604 550516 :FreeFull!~freefull@defocus/sausage-lover PRIVMSG #esoteric :I'd have to look it up < 1388149931 937872 :FreeFull!~freefull@defocus/sausage-lover PRIVMSG #esoteric :Hey, there is a new Mill Achitecture lecture video < 1388150333 468556 :tromp_!~tromp@ool-4570a22a.dyn.optonline.net JOIN :#esoteric < 1388150369 999608 :hogeyui_!~hogeyuiVP@vps.usamimi.biz QUIT :Ping timeout: 246 seconds < 1388151026 476316 :tromp_!~tromp@ool-4570a22a.dyn.optonline.net QUIT :Remote host closed the connection < 1388151176 977590 :tromp_!~tromp@ool-4570a22a.dyn.optonline.net JOIN :#esoteric < 1388151212 241699 :tromp_!~tromp@ool-4570a22a.dyn.optonline.net QUIT :Remote host closed the connection < 1388151573 947266 :olsner!~salparot@78-72-235-77-no50.business.telia.com JOIN :#esoteric < 1388151583 895416 :Phantom_Hoover!~Phantom@unaffiliated/phantom-hoover QUIT :Ping timeout: 260 seconds < 1388151649 771783 :hogeyui_!~hogeyuiVP@vps.usamimi.biz JOIN :#esoteric < 1388152184 742474 :hogeyui_!~hogeyuiVP@vps.usamimi.biz QUIT :Ping timeout: 252 seconds < 1388152221 770593 :boily!~boily@207.112.39.31 JOIN :#esoteric < 1388152296 58490 :zzo38!~zzo38@24-207-57-25.eastlink.ca PRIVMSG #esoteric :Do you like this kind of shogi variant? http://www.chessvariants.org/index/msdisplay.php?itemid=MSunknownoffpiec < 1388152393 157203 :boily!~boily@207.112.39.31 PRIVMSG #esoteric :good zzorning38. I never variated my shōgi yet. < 1388152423 912309 :boily!~boily@207.112.39.31 QUIT :Client Quit < 1388152523 101724 :boily!~boily@207.112.39.31 JOIN :#esoteric < 1388152529 374494 :metasepia!~metasepia@207.112.39.31 JOIN :#esoteric < 1388152541 84708 :Phantom_Hoover!~Phantom@unaffiliated/phantom-hoover JOIN :#esoteric < 1388152638 488144 :zzo38!~zzo38@24-207-57-25.eastlink.ca PRIVMSG #esoteric :Hello < 1388152669 128643 :boily!~boily@207.112.39.31 PRIVMSG #esoteric :now, let's see if I barged in an ongoing conversation by correctly checking the logs... < 1388153139 330614 :tromp_!~tromp@ool-4570a22a.dyn.optonline.net JOIN :#esoteric < 1388153246 932525 :carado!~user4539@2a01:e35:8b61:e430:6ef0:49ff:fe73:1fd0 JOIN :#esoteric < 1388153271 378571 :quintopia!~quintopia@unaffiliated/quintopia PRIVMSG #esoteric :hily < 1388153401 51644 :boily!~boily@207.112.39.31 PRIVMSG #esoteric :hintopia! < 1388153414 17929 :yorick!~yorick@oftn/member/yorick JOIN :#esoteric < 1388153423 637116 :fizzie!fis@unaffiliated/fizzie PRIVMSG #esoteric :Hoity-boily. < 1388153431 224603 :boily!~boily@207.112.39.31 PRIVMSG #esoteric :... hoity-boily??? < 1388153473 594205 :boily!~boily@207.112.39.31 PRIVMSG #esoteric :bon matizzie. < 1388153497 286289 :fizzie!fis@unaffiliated/fizzie PRIVMSG #esoteric :It's like hoity-toity, but boilier. < 1388153498 958039 :quintopia!~quintopia@unaffiliated/quintopia PRIVMSG #esoteric :i tried Bon Martin on a south african guy named...yeah < 1388153503 229717 :quintopia!~quintopia@unaffiliated/quintopia PRIVMSG #esoteric :he didn't get it < 1388153640 816794 :boily!~boily@207.112.39.31 PRIVMSG #esoteric :fizzie: tmyk... < 1388153656 345844 :boily!~boily@207.112.39.31 PRIVMSG #esoteric :quintopia: 'tis a sad world where Martinses can't be bon martined... < 1388153852 307980 :quintopia!~quintopia@unaffiliated/quintopia PRIVMSG #esoteric :he said that bon means sight in bantu languages, but can also be used as a greeting < 1388153860 851118 :hogeyui_!~hogeyuiVP@vps.usamimi.biz JOIN :#esoteric < 1388154183 874048 :hogeyui_!~hogeyuiVP@vps.usamimi.biz QUIT :Ping timeout: 272 seconds < 1388154314 677508 :yours_truly!~yours@74.114.76.110 JOIN :#esoteric < 1388154331 6282 :ter2!~tertu@65-128-138-136.mpls.qwest.net JOIN :#esoteric < 1388154357 984633 :nisstyre!~yours@oftn/member/Nisstyre QUIT :Ping timeout: 272 seconds < 1388154391 598509 :boily!~boily@207.112.39.31 PRIVMSG #esoteric :`relcome yours_truly < 1388154394 324950 :HackEgo!dlopen@libdl.so PRIVMSG #esoteric :​06yours_truly: 13Welcome 04to 07the 08international 09hub 02for 06esoteric 13programming 04language 07design 08and 09deployment! 02For 06more 13information, 04check 07out 08our 09wiki: 02. 06(For 13the 04other 07kind 08of 09esoterica, 02try 06#esoteric 13on 04irc.dal.net.) < 1388155075 380074 :tromp_!~tromp@ool-4570a22a.dyn.optonline.net QUIT :Ping timeout: 245 seconds < 1388155391 910320 :olsner!~salparot@78-72-235-77-no50.business.telia.com QUIT :Ping timeout: 260 seconds < 1388155541 778445 :hogeyui_!~hogeyuiVP@vps.usamimi.biz JOIN :#esoteric < 1388155858 486530 :w00tles!~w00tles@87-104-164-168-dynamic-customer.profibernet.dk QUIT :Ping timeout: 245 seconds < 1388155895 953990 :Phantom_Hoover!~Phantom@unaffiliated/phantom-hoover QUIT :Ping timeout: 260 seconds < 1388157038 712957 :hogeyui_!~hogeyuiVP@vps.usamimi.biz QUIT :Ping timeout: 240 seconds < 1388157625 338552 :Vorpal!~Vorpal@unaffiliated/vorpal PRIVMSG #esoteric : Vorpal: http://www.chron.com/news/houston-texas/article/Guinness-certifies-world-s-largest-gingerbread-5028028.php is what I saw. <-- impressive, but not pure gingerbread... < 1388157635 423006 :Vorpal!~Vorpal@unaffiliated/vorpal PRIVMSG #esoteric :I feel using wood is cheating < 1388157978 269322 :fizzie!fis@unaffiliated/fizzie PRIVMSG #esoteric :Yes, I think so too. < 1388158471 40878 :hogeyui_!~hogeyuiVP@vps.usamimi.biz JOIN :#esoteric < 1388158535 151964 :Vorpal!~Vorpal@unaffiliated/vorpal PRIVMSG #esoteric :fizzie, I wonder what the largest "real" gingerbread house actually is < 1388158579 929138 :tromp_!~tromp@ool-4570a22a.dyn.optonline.net JOIN :#esoteric < 1388158663 775666 :Vorpal!~Vorpal@unaffiliated/vorpal PRIVMSG #esoteric :Well this is interesting, turning on compositing in the window manager setting improved window moving performance a lot < 1388158676 477148 :Vorpal!~Vorpal@unaffiliated/vorpal PRIVMSG #esoteric :However, now resizing windows lags terribly < 1388158678 132927 :Vorpal!~Vorpal@unaffiliated/vorpal PRIVMSG #esoteric :-_- < 1388158700 348125 :boily!~boily@207.112.39.31 PRIVMSG #esoteric :compositing still exists? < 1388158707 467655 :Vorpal!~Vorpal@unaffiliated/vorpal PRIVMSG #esoteric :boily, guess so? < 1388158713 229251 :Vorpal!~Vorpal@unaffiliated/vorpal PRIVMSG #esoteric :As opoosed to what? < 1388158728 541212 :Vorpal!~Vorpal@unaffiliated/vorpal PRIVMSG #esoteric :I'm using MATE btw, so this is a metacity fork < 1388158734 686000 :boily!~boily@207.112.39.31 PRIVMSG #esoteric :as opposed to I thought it was a fad, and people got tired of all the wobbly windowing stuff. < 1388158768 937749 :Vorpal!~Vorpal@unaffiliated/vorpal PRIVMSG #esoteric :boily, yeah, I wish I could turn off the drop shadows... < 1388158786 781415 :Vorpal!~Vorpal@unaffiliated/vorpal PRIVMSG #esoteric :Can't find a setting for it < 1388158806 787301 :fizzie!fis@unaffiliated/fizzie PRIVMSG #esoteric :SteamOS has a xcompmgr-based compositor, or so I've heard. < 1388158812 565287 :Vorpal!~Vorpal@unaffiliated/vorpal PRIVMSG #esoteric :Heh < 1388158943 653449 :Taneb!~Taneb@runciman.hacksoc.org PRIVMSG #esoteric :Gunnerkrigg Court is getting creepy < 1388158951 745129 :Vorpal!~Vorpal@unaffiliated/vorpal PRIVMSG #esoteric :That is a web comic right? < 1388158962 853232 :Taneb!~Taneb@runciman.hacksoc.org PRIVMSG #esoteric :Yes < 1388159002 345471 :Vorpal!~Vorpal@unaffiliated/vorpal PRIVMSG #esoteric :Hm, which custom android firmware to use... I would like to update from my old version of PAC (4.1.2) to something 4.3-based or such. Or at least 4.2. < 1388159055 154370 :Vorpal!~Vorpal@unaffiliated/vorpal PRIVMSG #esoteric :omnirom? < 1388159170 583794 :Vorpal!~Vorpal@unaffiliated/vorpal PRIVMSG #esoteric :Maybe a new PAC? < 1388159199 511656 :fizzie!fis@unaffiliated/fizzie PRIVMSG #esoteric :I see you're a PAC man. < 1388159215 791910 :Vorpal!~Vorpal@unaffiliated/vorpal PRIVMSG #esoteric :fizzie, quite, the full name of the rom is actually PACman ROM < 1388159227 775234 :Vorpal!~Vorpal@unaffiliated/vorpal PRIVMSG #esoteric :so that was not as funny as you thought :P < 1388159231 379945 :fizzie!fis@unaffiliated/fizzie PRIVMSG #esoteric :Aw. < 1388159251 400273 :Vorpal!~Vorpal@unaffiliated/vorpal PRIVMSG #esoteric :fizzie, it is so called because it is a mix of Paranoid Android, AKOP and CyanogenMod < 1388159254 463969 :Vorpal!~Vorpal@unaffiliated/vorpal PRIVMSG #esoteric :thus PAC < 1388159261 394599 :fizzie!fis@unaffiliated/fizzie PRIVMSG #esoteric :(Does Pac-Man have a driver's license that says "Man, Pac" on it?) < 1388159347 893722 :boily!~boily@207.112.39.31 PRIVMSG #esoteric :I wish I could cyanogenise my phone. it isn't supported :( < 1388159393 305657 :Vorpal!~Vorpal@unaffiliated/vorpal PRIVMSG #esoteric :Oh god, using a third party custom kernel with the latest PAC doesn't work apparently. Screw that then < 1388159410 678066 :Vorpal!~Vorpal@unaffiliated/vorpal PRIVMSG #esoteric :I might just stay on 4.1.2 instead... Since everything pretty much works as it is. < 1388159442 530956 :zzo38!~zzo38@24-207-57-25.eastlink.ca PRIVMSG #esoteric :Do custom Android systems include a command-shell and the ability to modify the permissions of installed programs (rather than only to view them)? < 1388159476 897607 :Vorpal!~Vorpal@unaffiliated/vorpal PRIVMSG #esoteric :zzo38, you can do that with xprivacy (an xposed framework module) on pretty much any non-MIUI system < 1388159510 483655 :zzo38!~zzo38@24-207-57-25.eastlink.ca PRIVMSG #esoteric :What does MIUI mean? < 1388159530 827524 :Vorpal!~Vorpal@unaffiliated/vorpal PRIVMSG #esoteric :IIRC that is the stock motorola GUI framework thingy < 1388159544 930854 :Vorpal!~Vorpal@unaffiliated/vorpal PRIVMSG #esoteric :Or wait hm, no < 1388159578 927676 :Vorpal!~Vorpal@unaffiliated/vorpal PRIVMSG #esoteric :Well it is the stock GUI that some phone manufacturer added anyway, forgot which one < 1388159592 682010 :Vorpal!~Vorpal@unaffiliated/vorpal PRIVMSG #esoteric :Samsung has touchwiz, HTC has Sense. It is along those lines < 1388159686 459904 :Vorpal!~Vorpal@unaffiliated/vorpal PRIVMSG #esoteric :zzo38, anyway, xposed framework is awesome, it basically allows runtime patching the entire system, by hooking into early startup code and basically loading a module into every dalvik (the android java vm) process. < 1388159821 936798 :Bike_!~Glossina@216-161-90-94.ptld.qwest.net NICK :Bike < 1388160024 412989 :Vorpal!~Vorpal@unaffiliated/vorpal PRIVMSG #esoteric :boily, what phone is that? < 1388160043 743286 :fizzie!fis@unaffiliated/fizzie PRIVMSG #esoteric :Recurring annoyance: when booted to Windows, the two (spinning-disk) Linux drives keep getting woken up, even when set "offline" in disk management. Both when anything "special" is happening (Windows Update is checking for updates, Steam wants to install DirectX for the billionth time) but also more or less randomly a few times every day. < 1388160071 852404 :Vorpal!~Vorpal@unaffiliated/vorpal PRIVMSG #esoteric :Hm < 1388160088 661284 :Vorpal!~Vorpal@unaffiliated/vorpal PRIVMSG #esoteric :that is a bit weird < 1388160105 240392 :fizzie!fis@unaffiliated/fizzie PRIVMSG #esoteric :Oh, and is also spins up the disks when told to shut down or go to sleep. < 1388160110 402142 :Vorpal!~Vorpal@unaffiliated/vorpal PRIVMSG #esoteric :Ouch < 1388160115 910070 :fizzie!fis@unaffiliated/fizzie PRIVMSG #esoteric :(Then it immediately spins them down again, naturally.) < 1388160128 254799 :Vorpal!~Vorpal@unaffiliated/vorpal PRIVMSG #esoteric :fizzie, maybe it is checking SMART status wrt the random stuff? < 1388160141 956509 :boily!~boily@207.112.39.31 PRIVMSG #esoteric :Vorpal: HTC One V. < 1388160147 524600 :Vorpal!~Vorpal@unaffiliated/vorpal PRIVMSG #esoteric :I had smartmontools on linux spin up the windows disk < 1388160151 483675 :Vorpal!~Vorpal@unaffiliated/vorpal PRIVMSG #esoteric :boily, hm okay, no idea < 1388160159 134440 :boily!~boily@207.112.39.31 PRIVMSG #esoteric :(meanwhile, I'm compiling QT, and contributing to Climate Change...) < 1388160167 579077 :Vorpal!~Vorpal@unaffiliated/vorpal PRIVMSG #esoteric :Hah < 1388160174 221258 :Vorpal!~Vorpal@unaffiliated/vorpal PRIVMSG #esoteric :boily, gentoo? < 1388160208 970706 :Vorpal!~Vorpal@unaffiliated/vorpal PRIVMSG #esoteric :Also you should totally buy some solar panels to offset your QT compiling < 1388160210 253776 :boily!~boily@207.112.39.31 PRIVMSG #esoteric :Vorpal: nah. stuck with wkhtmltopdf, and it won't output headers and footers if you don't use a custom version of QT. < 1388160230 631528 :Vorpal!~Vorpal@unaffiliated/vorpal PRIVMSG #esoteric :what is wkhtmltopdf? < 1388160258 912610 :boily!~boily@207.112.39.31 PRIVMSG #esoteric :a very obscure utility that converts html files over to PDF. it's used by the new reporting engine in OpenERP. < 1388160279 15383 :boily!~boily@207.112.39.31 PRIVMSG #esoteric :(imho, a very, very stupid move, marginally better than what they had before.) < 1388160282 337742 :Vorpal!~Vorpal@unaffiliated/vorpal PRIVMSG #esoteric :Never heard of OpenERP < 1388160287 732108 :Vorpal!~Vorpal@unaffiliated/vorpal PRIVMSG #esoteric :Why not use CUPS to print to PDF... < 1388160293 292480 :Vorpal!~Vorpal@unaffiliated/vorpal PRIVMSG #esoteric :From a browser < 1388160315 313614 :boily!~boily@207.112.39.31 PRIVMSG #esoteric :woah, woah! stop being logical! we're talking about Enterprise stuff here! < 1388160320 496187 :Vorpal!~Vorpal@unaffiliated/vorpal PRIVMSG #esoteric :Oh okay < 1388160323 848431 :fizzie!fis@unaffiliated/fizzie PRIVMSG #esoteric :"wk" is presumably short for webkit? < 1388160328 616460 :boily!~boily@207.112.39.31 PRIVMSG #esoteric :fizzie: it is. < 1388160330 129078 :fizzie!fis@unaffiliated/fizzie PRIVMSG #esoteric :Vorpal: Oh, I also had the GTK save/open dialog annoyingly spin up the Windows disk in Linux, but now that it's a SSD I don't mind so much. < 1388160347 523897 :Vorpal!~Vorpal@unaffiliated/vorpal PRIVMSG #esoteric :fizzie, Ah, use SSDs for EVERYTHING < 1388160361 925771 :fizzie!fis@unaffiliated/fizzie PRIVMSG #esoteric :I don't want to pay for 2*3 terabytes of SSD, really. < 1388160395 703234 :Vorpal!~Vorpal@unaffiliated/vorpal PRIVMSG #esoteric :Hm I wonder what an 1 TB SSD costs < 1388160413 338210 :Vorpal!~Vorpal@unaffiliated/vorpal PRIVMSG #esoteric :Holy shit < 1388160425 74430 :Vorpal!~Vorpal@unaffiliated/vorpal PRIVMSG #esoteric :53758 for a PCI Express SSD < 1388160439 199182 :Vorpal!~Vorpal@unaffiliated/vorpal PRIVMSG #esoteric :8527 for the cheapest 1 TB SATA SSD < 1388160448 214751 :boily!~boily@207.112.39.31 PRIVMSG #esoteric :are those in CAD? < 1388160456 340353 :fizzie!fis@unaffiliated/fizzie PRIVMSG #esoteric :SEK, I hope. < 1388160460 968473 :tromp_!~tromp@ool-4570a22a.dyn.optonline.net QUIT :Ping timeout: 246 seconds < 1388160489 916217 :Vorpal!~Vorpal@unaffiliated/vorpal PRIVMSG #esoteric :SEK yes < 1388160511 371136 :boily!~boily@207.112.39.31 PRIVMSG #esoteric :~eval 8527 / 6.0819 < 1388160513 965183 :metasepia!~metasepia@207.112.39.31 PRIVMSG #esoteric :Error (1): < 1388160515 410379 :boily!~boily@207.112.39.31 PRIVMSG #esoteric :~eval 8527 / 6.0819 < 1388160516 8093 :fizzie!fis@unaffiliated/fizzie PRIVMSG #esoteric :576.90 EUR (about 5200 SEK) for the cheapest 1TB SATA SSD (Samsung 840 EVO 1 TB 2.5" SATA3 Basic Retail) at the Finnish verkkokauppa.com shop. < 1388160517 398146 :metasepia!~metasepia@207.112.39.31 PRIVMSG #esoteric :1402.0289712096549 < 1388160541 882003 :Vorpal!~Vorpal@unaffiliated/vorpal PRIVMSG #esoteric :Hm the SSD in my work computer (Intel 520, 240 GB) costs 2075 < 1388160569 585385 :Vorpal!~Vorpal@unaffiliated/vorpal PRIVMSG #esoteric :But we are upgrading to Intel 520 with 480 GB storage soon, which cost 3683 < 1388160586 930569 :carado!~user4539@2a01:e35:8b61:e430:6ef0:49ff:fe73:1fd0 QUIT :Ping timeout: 246 seconds < 1388160590 881841 :fizzie!fis@unaffiliated/fizzie PRIVMSG #esoteric :I've seen some random guides on how to really disable a disk in Windows, but they all involved all kinds of nasty "uninstall drivers" kind of nonsense, and the one that seemed marginally less invasive didn't do anything. < 1388160654 192005 :Vorpal!~Vorpal@unaffiliated/vorpal PRIVMSG #esoteric :I can only find PCI Express SSDs above 2 TB < 1388160657 914006 :Vorpal!~Vorpal@unaffiliated/vorpal PRIVMSG #esoteric :no SATA onezsx < 1388160660 480038 :Vorpal!~Vorpal@unaffiliated/vorpal PRIVMSG #esoteric :ones* < 1388160698 633279 :fizzie!fis@unaffiliated/fizzie PRIVMSG #esoteric :And a lot of the stuff are for people who actually want to keep their drive usable from Windows; I just want those completely turned off. < 1388160720 790751 :Vorpal!~Vorpal@unaffiliated/vorpal PRIVMSG #esoteric :fizzie, you could unplug them? < 1388160751 429431 :fizzie!fis@unaffiliated/fizzie PRIVMSG #esoteric :That would involve opening the computer for every single OS switch. < 1388160769 595698 :fizzie!fis@unaffiliated/fizzie PRIVMSG #esoteric :Some kind of a front-panel power switch could work, if someone makes that kind of thing. < 1388160771 160847 :zzo38!~zzo38@24-207-57-25.eastlink.ca PRIVMSG #esoteric :Install a hardware switch then. < 1388160771 366492 :Vorpal!~Vorpal@unaffiliated/vorpal PRIVMSG #esoteric :Heh, Toshiba has a 1.6 TB SSD for around 50 000. SATA < 1388160790 662398 :Vorpal!~Vorpal@unaffiliated/vorpal PRIVMSG #esoteric :fizzie, doubt it for SATA < 1388160795 572993 :Vorpal!~Vorpal@unaffiliated/vorpal PRIVMSG #esoteric :custom drivers? < 1388160805 84650 :Vorpal!~Vorpal@unaffiliated/vorpal PRIVMSG #esoteric :You could write custom chipset drivers for windows < 1388160814 743611 :Vorpal!~Vorpal@unaffiliated/vorpal PRIVMSG #esoteric :That hid those disks < 1388160829 626727 :fizzie!fis@unaffiliated/fizzie PRIVMSG #esoteric :There was something you could do somewhat easily in device management to hide the disks, but then it doesn't ever spin them down either. < 1388160842 85884 :Vorpal!~Vorpal@unaffiliated/vorpal PRIVMSG #esoteric :Well okay < 1388160917 558009 :Vorpal!~Vorpal@unaffiliated/vorpal PRIVMSG #esoteric :I'm trying to figure out the point of Google Cloud Print... Can't find any < 1388160920 580577 :fizzie!fis@unaffiliated/fizzie PRIVMSG #esoteric :I think I saw some rather kludgly-looking batch file for a "programmatically spin down, then hide the disk" thing somewhere, though. < 1388161086 656999 :impomatic!~digital_w@150.20.208.46.dyn.plus.net PRIVMSG #esoteric :Would anyone here be interested in entering a Core War tournament? Also, if the tournament is held in Cambridge either in or near the computer museum, would anyone attend? < 1388161124 225211 :Vorpal!~Vorpal@unaffiliated/vorpal PRIVMSG #esoteric :Huh, turning on compositing made full screen flash video work again??? < 1388161204 246900 :boily!~boily@207.112.39.31 PRIVMSG #esoteric :I like Flash. it has the loveliest, weirdestest bugs I ever seen. < 1388161355 891116 :Vorpal!~Vorpal@unaffiliated/vorpal PRIVMSG #esoteric :boily, yes previously it was sluggish when playing full screen < 1388161787 976513 :carado!~user4539@2a01:e35:8b61:e430:6ef0:49ff:fe73:1fd0 JOIN :#esoteric < 1388161894 995842 :boily!~boily@207.112.39.31 PRIVMSG #esoteric :caradhello. < 1388162510 997309 :w00tles!~w00tles@87-104-164-168-dynamic-customer.profibernet.dk JOIN :#esoteric < 1388162520 834436 :w00tles!~w00tles@87-104-164-168-dynamic-customer.profibernet.dk QUIT :Max SendQ exceeded < 1388162562 878179 :w00tles!~w00tles@87-104-164-168-dynamic-customer.profibernet.dk JOIN :#esoteric < 1388163500 370898 :Bike!~Glossina@216-161-90-94.ptld.qwest.net QUIT :Ping timeout: 245 seconds < 1388163620 954782 :Bike!~Glossina@174-25-43-147.ptld.qwest.net JOIN :#esoteric < 1388163887 762312 :tromp_!~tromp@ool-4570a22a.dyn.optonline.net JOIN :#esoteric < 1388164141 750260 :tromp_!~tromp@ool-4570a22a.dyn.optonline.net QUIT :Ping timeout: 252 seconds < 1388164177 906345 :Bike!~Glossina@174-25-43-147.ptld.qwest.net QUIT :Ping timeout: 246 seconds < 1388164301 999523 :Bike!~Glossina@174-25-60-165.ptld.qwest.net JOIN :#esoteric < 1388164557 918527 :olsner!~salparot@78-72-235-77-no50.business.telia.com JOIN :#esoteric < 1388164589 40986 :ter2!~tertu@65-128-138-136.mpls.qwest.net NICK :tertu < 1388164648 45845 :quintopia!~quintopia@unaffiliated/quintopia PRIVMSG #esoteric :hi Taneb < 1388164651 675779 :quintopia!~quintopia@unaffiliated/quintopia PRIVMSG #esoteric :hi tertu < 1388164665 287892 :tertu!~tertu@65-128-138-136.mpls.qwest.net PRIVMSG #esoteric :hey < 1388164681 272335 :quintopia!~quintopia@unaffiliated/quintopia PRIVMSG #esoteric :what you been working on < 1388164731 785028 :Taneb!~Taneb@runciman.hacksoc.org PRIVMSG #esoteric :Hi quintopia < 1388164762 788657 :quintopia!~quintopia@unaffiliated/quintopia PRIVMSG #esoteric :hows life Taneb < 1388164771 138760 :Taneb!~Taneb@runciman.hacksoc.org PRIVMSG #esoteric :Boring < 1388164792 780333 :Taneb!~Taneb@runciman.hacksoc.org PRIVMSG #esoteric :I'm not too fond of the 5 days between Christmas and New Year's Eve < 1388164802 901439 :Taneb!~Taneb@runciman.hacksoc.org PRIVMSG #esoteric :And I miss being at university < 1388164814 227251 :Taneb!~Taneb@runciman.hacksoc.org PRIVMSG #esoteric :I've been playing Minecraft more than usual lately < 1388164848 406818 :quintopia!~quintopia@unaffiliated/quintopia PRIVMSG #esoteric :programmed anything lately < 1388164856 608485 :Taneb!~Taneb@runciman.hacksoc.org PRIVMSG #esoteric :Not anything interesting < 1388164863 872382 :Taneb!~Taneb@runciman.hacksoc.org PRIVMSG #esoteric :I've been trying to learn Agda again < 1388164867 170372 :Taneb!~Taneb@runciman.hacksoc.org PRIVMSG #esoteric :But it hasn't gone well < 1388164899 22169 :quintopia!~quintopia@unaffiliated/quintopia PRIVMSG #esoteric :how do you go about learning a new lang < 1388164921 216485 :Taneb!~Taneb@runciman.hacksoc.org PRIVMSG #esoteric :I don't know < 1388164931 788520 :Taneb!~Taneb@runciman.hacksoc.org PRIVMSG #esoteric :I'm not very good at learning new things < 1388164970 953783 :Taneb!~Taneb@runciman.hacksoc.org PRIVMSG #esoteric :I've been meaning to learn Rust, too < 1388164971 159665 :quintopia!~quintopia@unaffiliated/quintopia PRIVMSG #esoteric :but you've learned things in the past. how? < 1388164998 897797 :Taneb!~Taneb@runciman.hacksoc.org PRIVMSG #esoteric :Well, with Haskell, I started by following LYAH while messing with it in GHCi < 1388165035 365446 :Taneb!~Taneb@runciman.hacksoc.org PRIVMSG #esoteric :Once I thought I was getting better, I started posting some code I had written in this channel and letting elliott, oerjan, and shachaf shout at me < 1388165043 741964 :Taneb!~Taneb@runciman.hacksoc.org PRIVMSG #esoteric :And now I feel pretty good at Haskell < 1388165052 488571 :Taneb!~Taneb@runciman.hacksoc.org PRIVMSG #esoteric :Having learnt from their criticisms < 1388165087 545553 :quintopia!~quintopia@unaffiliated/quintopia PRIVMSG #esoteric :guess you can't do that with agda, there being no one here versed enough in it to shout at you < 1388165103 135471 :Taneb!~Taneb@runciman.hacksoc.org PRIVMSG #esoteric :I think letting yourself mess around, but letting others help you make your mess neater really helps you to learn < 1388165120 766613 :quintopia!~quintopia@unaffiliated/quintopia PRIVMSG #esoteric :why do you want to know agda? < 1388165130 638887 :Taneb!~Taneb@runciman.hacksoc.org PRIVMSG #esoteric :I don't know < 1388165151 921413 :Taneb!~Taneb@runciman.hacksoc.org PRIVMSG #esoteric :I don't even know what to do with Agda < 1388165170 875546 :boily!~boily@207.112.39.31 PRIVMSG #esoteric :that's a good enough reason. < 1388165172 591687 :quintopia!~quintopia@unaffiliated/quintopia PRIVMSG #esoteric :well that might be your problem. if you don't know why you want to do it, you probably won't be very motivated to do it < 1388165183 88652 :Taneb!~Taneb@runciman.hacksoc.org PRIVMSG #esoteric :Today I used to maybe prove that disjunction and conjunction formed a semiring < 1388165188 840968 :Taneb!~Taneb@runciman.hacksoc.org PRIVMSG #esoteric :But then I don't know how it proved that < 1388165192 888505 :Taneb!~Taneb@runciman.hacksoc.org PRIVMSG #esoteric :Or how I can use that proof < 1388165377 926680 :Bike!~Glossina@174-25-60-165.ptld.qwest.net QUIT :Ping timeout: 272 seconds < 1388165469 930972 :Bike!~Glossina@67-5-215-244.ptld.qwest.net JOIN :#esoteric < 1388165609 903198 :olsner!~salparot@78-72-235-77-no50.business.telia.com QUIT :Quit: Leaving < 1388165763 54114 :MindlessDrone!~MindlessD@vpn34-243.rz.hs-offenburg.de QUIT :Ping timeout: 246 seconds < 1388165975 894305 :Bike!~Glossina@67-5-215-244.ptld.qwest.net QUIT :Ping timeout: 260 seconds < 1388166091 96443 :Bike!~Glossina@67-5-224-68.ptld.qwest.net JOIN :#esoteric < 1388166165 22849 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric :good morning #esoteric < 1388166189 196020 :boily!~boily@207.112.39.31 PRIVMSG #esoteric :@localtime kmc < 1388166189 710286 :lambdabot!~lambdabot@silicon.int-e.eu PRIVMSG #esoteric :Local time for kmc is Fri Dec 27 09:43:09 2013 < 1388166201 112402 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric :i'm actually 1 hour ahead of there right now < 1388166202 487346 :boily!~boily@207.112.39.31 PRIVMSG #esoteric :good fternoon, kmc. < 1388166208 450909 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric :but i don't update the clock on my vps when i travel < 1388166217 249199 :boily!~boily@207.112.39.31 PRIVMSG #esoteric :Mountain Time? < 1388166223 917216 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric :ja < 1388166246 340396 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric :yesterday went for a drive here: http://en.wikipedia.org/wiki/File:CONM_Independence_monument_2.jpg < 1388166248 951785 :^v!~NotPing@c-71-238-153-166.hsd1.mi.comcast.net JOIN :#esoteric < 1388166284 288159 :Taneb!~Taneb@runciman.hacksoc.org PRIVMSG #esoteric :Hello, all < 1388166286 380316 :skrillex64!~skrillex6@119-46-191-21.static.asianet.co.th JOIN :#esoteric < 1388166371 926352 :boily!~boily@207.112.39.31 PRIVMSG #esoteric :kmc: that looks like a nice place. < 1388166469 138700 :skrillex64!~skrillex6@119-46-191-21.static.asianet.co.th PRIVMSG #esoteric :364:::14,15 hey :::3664 < 1388166469 344782 :boily!~boily@207.112.39.31 PRIVMSG #esoteric :Taneb: suffering from universital cravings? < 1388166479 106137 :boily!~boily@207.112.39.31 PRIVMSG #esoteric :`relcome skrillex64 < 1388166481 237958 :HackEgo!dlopen@libdl.so PRIVMSG #esoteric :​09skrillex64: 02Welcome 06to 13the 04international 07hub 08for 09esoteric 02programming 06language 13design 04and 07deployment! 08For 09more 02information, 06check 13out 04our 07wiki: 08. 09(For 02the 06other 13kind 04of 07esoterica, 08try 09#esoteric 02on 06irc.dal.net.) < 1388166509 485154 :Taneb!~Taneb@runciman.hacksoc.org PRIVMSG #esoteric :boily, I'm just suffering right now < 1388166584 368994 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric :boily: yep < 1388166586 308473 :skrillex64!~skrillex6@119-46-191-21.static.asianet.co.th PRIVMSG #esoteric :ACTION 04(9,04 04,0:04,1 15m04[T]15x 11:1311:04 15Closing Script ( º..ǹ... )04 11:1311: 15s04C15ript 04,0:0,04 04,0) < 1388166620 974311 :Taneb!~Taneb@runciman.hacksoc.org PRIVMSG #esoteric :I am installing Rust 90 miles away < 1388166621 216851 :skrillex64!~skrillex6@119-46-191-21.static.asianet.co.th QUIT : < 1388166654 841323 :Taneb!~Taneb@runciman.hacksoc.org PRIVMSG #esoteric :This would be easier if I knew how to use Arch < 1388166660 711194 :boily!~boily@207.112.39.31 PRIVMSG #esoteric :what the technicolor fungot was that... < 1388166661 358259 :fungot!fis@eos.zem.fi PRIVMSG #esoteric :boily: same url as before for new jar up yet?) publically acessible) later i tried clisp ( interpreted) chicken scripts, is there any haskell builtin to test whether one number is within the scope of python, i do < 1388166670 491878 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric :`run echo 'ºêÒºÒÂ..ä»áÅéǹêÒÒ...' | iconv -t iso8859-1 | iconv -f tis-620 < 1388166672 340374 :HackEgo!dlopen@libdl.so PRIVMSG #esoteric :​บ๊ายบาย..ไปแล้วน๊าา... < 1388166690 571850 :boily!~boily@207.112.39.31 PRIVMSG #esoteric :kmc: and how in fungot did you manage to guess it was tis-620... < 1388166690 936734 :fungot!fis@eos.zem.fi PRIVMSG #esoteric :boily: not at all, since there are 3 syntax for integer literals. the semantics are like scheme, but that's an unfair generalization < 1388166698 748350 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric :boily: chardet < 1388166705 233862 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric :"Goodbye to N๊aa ... .." < 1388166707 289249 :boily!~boily@207.112.39.31 PRIVMSG #esoteric :Taneb: Arch, as in the VCS, or as in the distro? < 1388166712 142521 :Taneb!~Taneb@runciman.hacksoc.org PRIVMSG #esoteric :The distro < 1388166723 296783 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric :i was like "that can't be right" and then saw the .th hostname in the quit msg < 1388166728 987204 :MindlessDrone!~MindlessD@HSI-KBW-37-49-6-33.hsi14.kabel-badenwuerttemberg.de JOIN :#esoteric < 1388166736 53802 :Taneb!~Taneb@runciman.hacksoc.org PRIVMSG #esoteric :It would probably be much easier if I knew pacman (the package manager, not the game or the character) < 1388166745 622912 :boily!~boily@207.112.39.31 PRIVMSG #esoteric :kmc: oh hm. I obviously failed my spot check there... < 1388166759 209269 :Taneb!~Taneb@runciman.hacksoc.org PRIVMSG #esoteric :Where is .th? < 1388166766 86521 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric :thai land < 1388166771 391806 :Taneb!~Taneb@runciman.hacksoc.org PRIVMSG #esoteric :Aaaaah < 1388166772 976263 :boily!~boily@207.112.39.31 PRIVMSG #esoteric :Taneb: well. pacman -Syu to make your system up-to-date, pacman -S for installing stuff. < 1388166773 687278 :Taneb!~Taneb@runciman.hacksoc.org PRIVMSG #esoteric :.hth < 1388166780 896173 :Taneb!~Taneb@runciman.hacksoc.org PRIVMSG #esoteric :boily, I'm not a sudo-er < 1388166803 288703 :boily!~boily@207.112.39.31 PRIVMSG #esoteric :I don't have sudo installed on my machine. I just “su”, then do the Stuff that has to be Done. < 1388166805 294260 :Taneb!~Taneb@runciman.hacksoc.org PRIVMSG #esoteric :Is there a way I could do it locally or something like that < 1388166843 464776 :Taneb!~Taneb@runciman.hacksoc.org PRIVMSG #esoteric :Frankly I'm glad I'm not a sudo-er, I could probably set the machine on fire < 1388166850 95951 :Taneb!~Taneb@runciman.hacksoc.org PRIVMSG #esoteric :By accident < 1388166866 455715 :boily!~boily@207.112.39.31 PRIVMSG #esoteric :eeeeeh... yes. the answer is most definitely yes, but I don't know how. I suspect a mixture of ABS and pacman is going to be involved. < 1388166877 415370 :boily!~boily@207.112.39.31 PRIVMSG #esoteric :you should ask in #archlinux, or check the wiki. < 1388166921 490897 :Taneb!~Taneb@runciman.hacksoc.org PRIVMSG #esoteric :I... can't be bothered < 1388166924 712666 :boily!~boily@207.112.39.31 PRIVMSG #esoteric :settings machines on fire is an unusual and memorable experience. I... uhm... welll... I'm now scared of PSUs. < 1388166926 465507 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric :`from-8bit ºêÒºÒÂ..ä»áÅéǹêÒÒ... < 1388166928 880326 :HackEgo!dlopen@libdl.so PRIVMSG #esoteric :​บ๊ายบาย..ไปแล้วน๊าา... < 1388166956 633723 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric :`from-8bit ðòå÷åä íåä÷åä < 1388166959 179530 :HackEgo!dlopen@libdl.so PRIVMSG #esoteric :​נעוקוה םוהקוה < 1388166967 891631 :boily!~boily@207.112.39.31 PRIVMSG #esoteric :`from-8bit ? < 1388166970 344752 :HackEgo!dlopen@libdl.so PRIVMSG #esoteric :​? < 1388166974 968078 :boily!~boily@207.112.39.31 PRIVMSG #esoteric :dammit. doesn't work. < 1388166989 886695 :Taneb!~Taneb@runciman.hacksoc.org PRIVMSG #esoteric :kmc, you know Rust, right? If I show you potential future rust programs in the future would you critique them? < 1388166992 136584 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric :hmm that was supposed to be ПРЕВЕД МЕДВЕД < 1388166996 865474 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric :Taneb: sure! < 1388167026 24908 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric :Taneb: which version of the language & compiler are you using? I recommend sticking with master rather than the point releases, until 1.0 < 1388167046 547197 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric :I guess it is pretty hard to heuristically distinguish national 8-bit codes < 1388167049 393018 :boily!~boily@207.112.39.31 PRIVMSG #esoteric :Taneb: if you go fetch a package's PKGBUILD, you can redirect the compilation to a local repo. < 1388167062 384196 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric :wonder if chardet uses any language-specific letter frequency data on long enough texts < 1388167066 799985 :Taneb!~Taneb@runciman.hacksoc.org PRIVMSG #esoteric :kmc, 0.8 I think < 1388167082 264203 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric :`from-8bit should pass through ascii characters < 1388167084 517705 :HackEgo!dlopen@libdl.so PRIVMSG #esoteric :should pass through ascii characters < 1388167085 765817 :boily!~boily@207.112.39.31 PRIVMSG #esoteric :Taneb: also, you could forget everything about packages, and just do “make && make install” to local from source, as in the Olden Days of Unix. < 1388167097 733399 :Taneb!~Taneb@runciman.hacksoc.org PRIVMSG #esoteric :boily, that is what I am doing now < 1388167110 841250 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric :`from-8bit büt whát døe§ it dó with űtf-8 < 1388167111 147364 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :kmc: help what < 1388167113 331141 :HackEgo!dlopen@libdl.so PRIVMSG #esoteric :iconv: illegal input sequence at position 30 \ iconv: illegal input sequence at position 30 \ büt whát dře§ it dó with < 1388167118 906967 :Taneb!~Taneb@runciman.hacksoc.org PRIVMSG #esoteric :But the source seems to be 16MB < 1388167129 530789 :Taneb!~Taneb@runciman.hacksoc.org PRIVMSG #esoteric :And it is downloading sloooowlyyyyy < 1388167138 765161 :conehead!~conehead@unaffiliated/conehead JOIN :#esoteric < 1388167139 22142 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :oh < 1388167169 323418 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric :/home/keegan/proj/servo/servo/build.debug/x86_64-unknown-linux-gnu/src/compiler/rust/x86_64-unknown-linux-gnu/stage2/bin/rustc 0.9-pre (67d7be0 2013-10-29 12:02:59 -0700) < 1388167190 643689 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric :^ i don't install the toolchains, just run them out of dirs < 1388167380 782816 :tromp_!~tromp@ool-4570a22a.dyn.optonline.net JOIN :#esoteric < 1388167622 861690 :tromp_!~tromp@ool-4570a22a.dyn.optonline.net QUIT :Ping timeout: 240 seconds < 1388167758 972998 :Taneb!~Taneb@runciman.hacksoc.org PRIVMSG #esoteric :Reading Wikipedia about Rust, "Other features from Haskell, such as higher-kinded polymorphism, are not yet supported." < 1388167767 776535 :Taneb!~Taneb@runciman.hacksoc.org PRIVMSG #esoteric :Is that planned, or is it not going to happen < 1388167772 127072 :yours_truly!~yours@74.114.76.110 QUIT :Quit: Leaving < 1388167796 426180 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric :I don't know that it's "planned" exactly, but if somebody did the work we would be happy to merge it < 1388167818 3481 :nisstyre!~yours@oftn/member/Nisstyre JOIN :#esoteric < 1388167864 481033 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :that's a feature from haskell? < 1388167882 933063 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :first list-comprehensions and now higher-kinded polymorphism! v. innovative. < 1388167897 26734 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric :I think right now the core team is focusing on getting lots of smaller stuff fixed for the imminent 1.0 release < 1388167923 898209 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric :HKP would be a pretty big change and is also backwards-compatible, so it's more likely to happen after 1.0 < 1388168140 265026 :w00tles!~w00tles@87-104-164-168-dynamic-customer.profibernet.dk QUIT :Quit: quit < 1388168587 67012 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric :Taneb: note that polymorphism in Rust is implemented by compiling a separate version for each instantiation, which limits some of what can be done < 1388168618 728635 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric :for example I think one couldn't really support higher-rank types, i.e. foralls in function parameter types < 1388168634 206050 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :imo jit < 1388168642 774447 :Bike!~Glossina@67-5-224-68.ptld.qwest.net PRIVMSG #esoteric :how's haskell do it < 1388168645 496229 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric :although you might be able to support types like runST :: (forall s. ST s a) -> a, because s is a phantom parameter to ST < 1388168675 836770 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric :Bike: values in GHC Haskell have a uniform representation; they are always a pointer to a heap object whose first word is a pointer to an "info table" < 1388168693 305465 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :Bike: http://spl.smugmug.com/Humor/Lambdacats/i-XwKHSBM/2/O/boxed%20cat%20has%20a%20uniform%20representation.jpg < 1388168696 301134 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :hth < 1388168696 820337 :Bike!~Glossina@67-5-224-68.ptld.qwest.net PRIVMSG #esoteric :so it dispatches at runtime/ < 1388168703 733201 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric :it's not dspatch even < 1388168707 129290 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :It doesn't dispatch at all. < 1388168711 944765 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric :map :: (a -> b) -> [a] -> [b] has the same machine code regardless of what a and b are < 1388168713 735697 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :It's just like a void * (except type-safe) < 1388168728 17618 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric :because they are known to be 1 word in size < 1388168743 638187 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric :and you can even force polymorphic values, with "seq" say, because that's done through that info table < 1388168768 339071 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric :whereas Rust supports passing structures of various sizes by value, and has several types of heap allocation and other stuff < 1388168771 219311 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :This means that unboxed types like Int# aren't really first-class. < 1388168772 495169 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :You can < 1388168773 191510 :Bike!~Glossina@67-5-224-68.ptld.qwest.net PRIVMSG #esoteric :oh i was thinking of typeclasses since i don't know anything < 1388168777 501302 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :'t write "id 5#" < 1388168782 478693 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric :and also the low level focus means you *want* to specialize your polymorphic functions to specific types < 1388168791 389099 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric :Bike: typeclasses are implemented by passing around a "dictionary" < 1388168819 197870 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :@let data c *> a = c => Ctx a < 1388168819 403142 :lambdabot!~lambdabot@silicon.int-e.eu PRIVMSG #esoteric : Parse failed: Illegal class assertion < 1388168820 52418 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric :data EqDict a = EqDict { eq :: a -> a -> Bool } < 1388168820 845009 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric ::'( < 1388168851 696127 :boily!~boily@207.112.39.31 PRIVMSG #esoteric ::t (*>) < 1388168852 455538 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric :then a type like (Eq t) => Int -> t -> Int turns into EqDict t -> Int -> t -> Int < 1388168852 660849 :lambdabot!~lambdabot@silicon.int-e.eu PRIVMSG #esoteric :Applicative f => f a -> f b -> f b < 1388168892 700023 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :(==) :: a -> a -> Bool turns into eq :: EqDict a -> a -> a -> Bool. < 1388168909 344696 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric :Bike: Scala has a mechanism for implicit parameters to functions, and one can use this to do typeclass-like things < 1388168936 149403 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric :the main extra thing you get with typeclasses is that there's only one value of type EqDict t in scope at a time, so to speak < 1388168943 669851 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :Does that let you do things like instance Eq a => Eq [a]? < 1388168977 725036 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric :Bike: so if you build two binary search trees over element type T, you know they were built with the same Ord instance < 1388168985 491379 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric :which means the binary search tree library can support efficient merges < 1388169007 778700 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric :which you can't do when the ordering is an implicit parameter to every tree operation, with a value which could be different from time to time < 1388169022 409691 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :Or the comparison function is part of the tree itself. < 1388169158 928782 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric :yeah < 1388169167 126647 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric :but then you need to compare comparison functions to merge trees < 1388169183 47039 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric :and extensional equality of functions is uncomputable of course -- but you might get away with intensional equality < 1388169184 767426 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :Right. < 1388169275 943454 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric :Bike: in Rust it's even the case that the shape of Option depends on what T is < 1388169314 323029 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric :if T is a non-nullable pointer (e.g. ~S or @S or &S), Option is represented by a single pointer which might be null < 1388169330 716835 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric :if it's a nullable pointer or an int or a struct or something, it's represented the way variants usually are < 1388169345 709508 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric :with a tag word and a C-style union < 1388169384 651866 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :does rust do fancy pointer tagging things < 1388169390 55606 :tswett!6b0598fd@gateway/web/freenode/ip.107.5.152.253 JOIN :#esoteric < 1388169390 261423 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric :don't believe so < 1388169395 681903 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric :although it gives you enough rope to do them yourself < 1388169398 193155 :tswett!6b0598fd@gateway/web/freenode/ip.107.5.152.253 PRIVMSG #esoteric :Hey guys. < 1388169408 477592 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric :hi tswett < 1388169413 54575 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric :(we're not all guys btw) < 1388169423 175162 :tswett!6b0598fd@gateway/web/freenode/ip.107.5.152.253 PRIVMSG #esoteric :I'm using "guy" in the looser sense. < 1388169436 912735 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric :well you don't singlehandedly decide what a word means < 1388169454 313732 :Taneb!~Taneb@runciman.hacksoc.org PRIVMSG #esoteric :kmc, I'd say "guy" is becoming increasingly gender neutral, especially in the plural < 1388169470 285844 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric :there is still much discussion about this (e.g. http://storify.com/jvns/guys-guys-guys) so I think it's better to avoid assuming it's gender-neutral for now < 1388169476 617421 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric :but it's not a big deal or anything < 1388169531 426315 :nooodl!~nooodl@91.177.112.9 PRIVMSG #esoteric :"@b0rk In a personal context I also use "dude" regardless of gender but have been replacing it with gender-neutral "gurl" for balance lately." < 1388169538 701809 :nooodl!~nooodl@91.177.112.9 PRIVMSG #esoteric :gurl... < 1388169543 698153 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric :yeah wtf < 1388169550 985658 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric :GNU Url < 1388169747 100953 :tswett!6b0598fd@gateway/web/freenode/ip.107.5.152.253 PRIVMSG #esoteric :I use "guys" with a gender-neutral meaning. < 1388169755 736430 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric :that's good < 1388169773 523234 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric :however not everyone will understand it that way, and I like to err on the side of not alienating people < 1388169777 255013 :tswett!6b0598fd@gateway/web/freenode/ip.107.5.152.253 PRIVMSG #esoteric :Anyway, I smell an esolang. < 1388169785 727644 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric :again, it's not a big deal < 1388169794 826577 :tswett!6b0598fd@gateway/web/freenode/ip.107.5.152.253 PRIVMSG #esoteric :Yeah, I guess it didn't occur to me that people might be alienated. < 1388169864 755999 :Bike!~Glossina@67-5-224-68.ptld.qwest.net PRIVMSG #esoteric :http://www.scribd.com/doc/193957988/Virgil-Bucks-The-Revolutionary-Cybercurrency-On-The-Net meanwhile, in r bitcoin < 1388169894 680048 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric :Bike: did you see https://medium.com/quinn-norton/f3db7e13e6e3 < 1388169904 922239 :Bike!~Glossina@67-5-224-68.ptld.qwest.net PRIVMSG #esoteric :i apologize for not understanding anything about polymorphs < 1388169907 720589 :Bike!~Glossina@67-5-224-68.ptld.qwest.net PRIVMSG #esoteric :no < 1388169912 838784 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric :Bike: what about animorphs < 1388169967 438869 :Bike!~Glossina@67-5-224-68.ptld.qwest.net PRIVMSG #esoteric :never read animorphs < 1388169973 353382 :Bike!~Glossina@67-5-224-68.ptld.qwest.net PRIVMSG #esoteric :"Like everything the internet does, internet money is over-technical, over-engineered, probably not very well thought out, hilarious, profoundly male dominated, and eventually compared to Hitler" some good writing here < 1388170126 407967 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric :Bike: don't apologize for not knowing stuff :/ < 1388170136 251087 :boily!~boily@207.112.39.31 PRIVMSG #esoteric :Bike: it's... strangely spot-on. < 1388170167 840267 :Bike!~Glossina@67-5-224-68.ptld.qwest.net PRIVMSG #esoteric :this is a good article < 1388170168 747161 :nooodl!~nooodl@91.177.112.9 PRIVMSG #esoteric :(stares at http://esolangs.org/wiki/Gs2#Commands) this is a lotta work < 1388170177 536949 :nooodl!~nooodl@91.177.112.9 PRIVMSG #esoteric :oh no i messed something up < 1388170186 421368 :Bike!~Glossina@67-5-224-68.ptld.qwest.net PRIVMSG #esoteric :don't do that < 1388170218 96235 :Bike!~Glossina@67-5-224-68.ptld.qwest.net PRIVMSG #esoteric :i guess i am profoundly middle class < 1388170251 593417 :conehead!~conehead@unaffiliated/conehead QUIT :Quit: Computer has gone to sleep. < 1388170384 425167 :boily!~boily@207.112.39.31 PRIVMSG #esoteric :ACTION is thwarted by Qt's Reluctantness and Anti-Compilable Features < 1388170397 742169 :Bike!~Glossina@67-5-224-68.ptld.qwest.net PRIVMSG #esoteric :suburbs creep me out though < 1388170411 253502 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric :yup < 1388170512 763707 :Bike!~Glossina@67-5-224-68.ptld.qwest.net PRIVMSG #esoteric :i think they kind of remind me of the planet from a wrinkle in time < 1388170552 737619 :boily!~boily@207.112.39.31 PRIVMSG #esoteric :suffurbs. creepy, gloomy suburbs where every house is the same, every inflatable neighbour is the same, everything is drab and all you want is to get the fungout out. < 1388170566 13629 :boily!~boily@207.112.39.31 PRIVMSG #esoteric :s/fungout/fungot/ < 1388170566 219606 :fungot!fis@eos.zem.fi PRIVMSG #esoteric :boily: i logged on. :) i think mine predates yours < 1388170579 669743 :boily!~boily@207.112.39.31 PRIVMSG #esoteric :fungot: probably so. America is young. < 1388170619 715385 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :fungot's is a predator < 1388170620 100436 :fungot!fis@eos.zem.fi PRIVMSG #esoteric :shachaf: process 1 killed. it's a nice city in june or something else? an office suite, perhaps, it's weird that if you never use " foo fnord" < 1388170659 850286 :Gregor!dlopen@libdl.so PRIVMSG #esoteric :Is there a file format that's as feature-rich as tar or cpio but random-access and well-supported? Help me out here... I am literally considering .zip.xz. < 1388170669 210154 :Bike!~Glossina@67-5-224-68.ptld.qwest.net PRIVMSG #esoteric :shachaf: http://25.media.tumblr.com/d72bee13510fed7fc967a18d5fbd97ba/tumblr_mye61rDDnV1r7mymoo1_1280.png < 1388170685 146673 :Bike!~Glossina@67-5-224-68.ptld.qwest.net PRIVMSG #esoteric :Gregor: recoils in disgust < 1388170696 7397 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :Bike: help < 1388170702 631588 :boily!~boily@207.112.39.31 PRIVMSG #esoteric :Bike: AAAAAAAAAAAAAAAAAAAAAAAAH! < 1388170724 697569 :tswett!6b0598fd@gateway/web/freenode/ip.107.5.152.253 PRIVMSG #esoteric :What nice features do tar and cpio have? < 1388170737 778374 :boily!~boily@207.112.39.31 PRIVMSG #esoteric :Gregor: ÆÆÆÆÆÆÆÆÆÆÆÆÆÆÆÆÆÆÆÆÆÆÆÆĦ! < 1388170742 94205 :Gregor!dlopen@libdl.so PRIVMSG #esoteric :tswett: Full support for all Unix garbage (modes, owner, etc) < 1388170769 654586 :Gregor!dlopen@libdl.so PRIVMSG #esoteric :I need something that can archive a Unix directory tree, but has a f***ing index. < 1388170773 623770 :boily!~boily@207.112.39.31 PRIVMSG #esoteric :Gregor: fuse with compression? < 1388170791 40921 :tswett!6b0598fd@gateway/web/freenode/ip.107.5.152.253 PRIVMSG #esoteric :Just put each individual file into a tar file and then put all the tar files into whatever your archive file format is. < 1388170820 528521 :tswett!6b0598fd@gateway/web/freenode/ip.107.5.152.253 PRIVMSG #esoteric :Whelp, I'm looking at a Bitcoin price graph, and now the long-term trend actually looks pretty clear. < 1388170825 44338 :boily!~boily@207.112.39.31 PRIVMSG #esoteric :Gregor: something like a .vmdk, btrfs-formatted, with lzo? < 1388170868 502214 :Gregor!dlopen@libdl.so PRIVMSG #esoteric :boily: That's... not terrible... enormously wasteful for a write-only filesystem, and requires root to create or extract which is a pain... < 1388170921 261018 :boily!~boily@207.112.39.31 PRIVMSG #esoteric :Gregor: you sure you need root? even with fuse and qemu and plenty of four-letter emulatory words? < 1388170960 998141 :boily!~boily@207.112.39.31 PRIVMSG #esoteric :(also, you could set-up a vagrant system, and create a zipping utility that scp stuff over to the VM) < 1388170980 128698 :Gregor!dlopen@libdl.so PRIVMSG #esoteric :boily: FUSE I can tolerate, if it needed qemu then that would defeat the purpose. I could just extract the whole archive in the time it'd take to launch a friggin' VM. < 1388171016 105418 :tswett!6b0598fd@gateway/web/freenode/ip.107.5.152.253 PRIVMSG #esoteric :Looks like on average, the price has multiplied tenfold every ten months. And the longest it's ever gone without posting a gain is... a mere 21 months. < 1388171020 509572 :tswett!6b0598fd@gateway/web/freenode/ip.107.5.152.253 PRIVMSG #esoteric :BUT. I SMELL AN ESOLANG. < 1388171030 109976 :oerjan!oerjan@sprocket.nvg.ntnu.no JOIN :#esoteric < 1388171033 351177 :tswett!6b0598fd@gateway/web/freenode/ip.107.5.152.253 PRIVMSG #esoteric :There are a bunch of objects. Objects can create objects and send messages to objects. < 1388171073 499979 :w00tles!~w00tles@87-104-164-168-dynamic-customer.profibernet.dk JOIN :#esoteric < 1388171091 20754 :boily!~boily@207.112.39.31 PRIVMSG #esoteric :ACTION gives an arrow, a bat and a pit to tswett < 1388171116 773653 :tswett!6b0598fd@gateway/web/freenode/ip.107.5.152.253 PRIVMSG #esoteric :Is it a crooked arrow? < 1388171204 35794 :tromp_!~tromp@ool-4570a22a.dyn.optonline.net JOIN :#esoteric < 1388171321 921448 :boily!~boily@207.112.39.31 PRIVMSG #esoteric :tswett: it is one that can travel one edge on a dodecahedron. < 1388171334 73367 :tswett!6b0598fd@gateway/web/freenode/ip.107.5.152.253 PRIVMSG #esoteric :Sounds pretty crooked to me. < 1388171353 124714 :Taneb!~Taneb@runciman.hacksoc.org PRIVMSG #esoteric :tswett, that language feels like my misunderstanding of Smalltalk < 1388171373 563548 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric :haha < 1388171384 573558 :boily!~boily@207.112.39.31 PRIVMSG #esoteric :tswett: http://wimrijnders.nl/other/befunge/wumpus.bf hth. < 1388171390 655783 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric :that reminds me of my idea to make an esolang which has all the properties beginners think Haskell has < 1388171393 567066 :tswett!6b0598fd@gateway/web/freenode/ip.107.5.152.253 PRIVMSG #esoteric :Taneb: like Smalltalk, but with other stuff and without other stuff. Like, you know how Smalltalk message sends are really just procedure calls? These ones aren't. < 1388171409 100589 :tswett!6b0598fd@gateway/web/freenode/ip.107.5.152.253 PRIVMSG #esoteric :kmc: sounds neat. What properties are those, again? < 1388171430 389531 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric :automatic memoization of functions < 1388171440 428807 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric :type system which separates pure and impure functions < 1388171463 630286 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric :also you have to solve a category theory exercise to do IO < 1388171527 348971 :boily!~boily@207.112.39.31 PRIVMSG #esoteric :CT is easy. understanding it is hard. < 1388171607 883171 :Gregor!dlopen@libdl.so PRIVMSG #esoteric :I'm still liking .zip.xz ... < 1388171612 271335 :Gregor!dlopen@libdl.so PRIVMSG #esoteric :(With zip -0 of course) < 1388171662 532717 :oerjan!oerjan@sprocket.nvg.ntnu.no PRIVMSG #esoteric :kmc: can you make monads actually be burritos twh < 1388171679 721312 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric :yes < 1388171815 553794 :tswett!6b0598fd@gateway/web/freenode/ip.107.5.152.253 PRIVMSG #esoteric :So, lessee. Each object shall have one method and some local variables. There are a couple of things you can do. You can create another object. You can send a message to an object. And maybe you can use E's fancy "when" thing. < 1388171873 237230 :tswett!6b0598fd@gateway/web/freenode/ip.107.5.152.253 PRIVMSG #esoteric :In E, when you send a message to an object using an "eventual send" statement, the statement returns immediately, returning a reference to the object's response. < 1388171912 122982 :tswett!6b0598fd@gateway/web/freenode/ip.107.5.152.253 PRIVMSG #esoteric :Of course, by the time that happens, the object hasn't responded yet, so the reference isn't very usable. < 1388171924 120658 :tswett!6b0598fd@gateway/web/freenode/ip.107.5.152.253 PRIVMSG #esoteric :But once the object actually responds, *then* the reference becomes usable. < 1388171937 65147 :tromp_!~tromp@ool-4570a22a.dyn.optonline.net QUIT :Ping timeout: 246 seconds < 1388172003 502888 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric :`? twh < 1388172005 288895 :HackEgo!dlopen@libdl.so PRIVMSG #esoteric :twh would help, but is an hth derivative. hth. twh. hand. < 1388172020 120709 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric :ACTION wasn't expecting that to work < 1388172022 936772 :tswett!6b0598fd@gateway/web/freenode/ip.107.5.152.253 PRIVMSG #esoteric :What's twh? < 1388172053 840382 :Bike!~Glossina@67-5-224-68.ptld.qwest.net PRIVMSG #esoteric :that would help < 1388172089 561378 :Gregor!dlopen@libdl.so PRIVMSG #esoteric :SQUASHFS! < 1388172090 49313 :tswett!6b0598fd@gateway/web/freenode/ip.107.5.152.253 PRIVMSG #esoteric :What should I call this language... < 1388172091 901077 :Gregor!dlopen@libdl.so PRIVMSG #esoteric :That's the answer! < 1388172132 616586 :boily!~boily@207.112.39.31 PRIVMSG #esoteric :tswett: you should call your language “Gregor's Answer”. < 1388172145 176429 :tswett!6b0598fd@gateway/web/freenode/ip.107.5.152.253 PRIVMSG #esoteric :Works for me. < 1388172418 881859 :^v!~NotPing@c-71-238-153-166.hsd1.mi.comcast.net QUIT :Remote host closed the connection < 1388172558 916343 :Taneb!~Taneb@runciman.hacksoc.org PRIVMSG #esoteric :That's... actually a good name for this language < 1388172677 473681 :Gregor!dlopen@libdl.so PRIVMSG #esoteric :>_< < 1388172756 407169 :oerjan!oerjan@sprocket.nvg.ntnu.no PRIVMSG #esoteric :Taneb: 'The name of the language is called "Haddocks' Eyes"' hth < 1388172780 958972 :tswett!6b0598fd@gateway/web/freenode/ip.107.5.152.253 PRIVMSG #esoteric :So "Haddocks' Eyes" is the name of the name of the language? < 1388172800 55194 :oerjan!oerjan@sprocket.nvg.ntnu.no PRIVMSG #esoteric :most certainly not < 1388173080 705893 :tswett!6b0598fd@gateway/web/freenode/ip.107.5.152.253 PRIVMSG #esoteric :So, wait. It is the case that "The song is called Ways and Means" and that "The song is A-sitting on a Gate", right? So, uh... < 1388173088 998217 :tswett!6b0598fd@gateway/web/freenode/ip.107.5.152.253 PRIVMSG #esoteric :Lemme think, here... < 1388173109 755562 :zzo38!~zzo38@24-207-57-25.eastlink.ca PRIVMSG #esoteric :What is your opinion of this kind of Famicom mapper? http://wiki.nesdev.com/w/index.php/User:Zzo38/Mapper_F < 1388173111 443539 :oerjan!oerjan@sprocket.nvg.ntnu.no PRIVMSG #esoteric :ACTION hides behind a rock to avoid exploding brain matter < 1388173137 55755 :tswett!6b0598fd@gateway/web/freenode/ip.107.5.152.253 PRIVMSG #esoteric :So, "Ways and Means" and "A-sitting on a Gate" are both names. Using a name consists of referring to the name's referent; mentioning a name consists of referring to the name. < 1388173160 33057 :boily!~boily@207.112.39.31 PRIVMSG #esoteric :ACTION shuts himself in a maple lodge < 1388173204 233677 :tswett!6b0598fd@gateway/web/freenode/ip.107.5.152.253 PRIVMSG #esoteric :All right. So, the phrasing gives the strong impression that the name "Ways and Means" is mentioned, whereas the name "A-sitting on a Gate" is used. < 1388173247 770487 :oerjan!oerjan@sprocket.nvg.ntnu.no PRIVMSG #esoteric :i am pretty sure the white knight would disagree with you. somehow. < 1388173295 281184 :tswett!6b0598fd@gateway/web/freenode/ip.107.5.152.253 PRIVMSG #esoteric :It's possible that when he says "The song is called Ways and Means", he's actually using the name "Ways and Means", and thus asserting that what the song is called is the reference of the name "Ways and Means". < 1388173312 55290 :tswett!6b0598fd@gateway/web/freenode/ip.107.5.152.253 PRIVMSG #esoteric :But, assuming my initial impression is correct... < 1388173337 790392 :tswett!6b0598fd@gateway/web/freenode/ip.107.5.152.253 PRIVMSG #esoteric :The White Knight refers to the song using the phrase "A-sitting on a Gate", but asserts that it is called "Ways and Means", and that its name is "The Aged Aged Man". < 1388173361 958372 :oerjan!oerjan@sprocket.nvg.ntnu.no PRIVMSG #esoteric :ACTION digs a tunnel to get further away from the inevitable explosion. < 1388173391 988570 :^v!~NotPing@c-71-238-153-166.hsd1.mi.comcast.net JOIN :#esoteric < 1388173478 741426 :tswett!6b0598fd@gateway/web/freenode/ip.107.5.152.253 PRIVMSG #esoteric :So when referring to the song, there are three things we could reasonably call it: "A-sitting on the Gate" (what the Knight calls it), "Ways and Means" (what the Knight asserts that it is generally called), and "The Aged Aged Man" (what the Knight asserts its proper name is). < 1388173511 349154 :tswett!6b0598fd@gateway/web/freenode/ip.107.5.152.253 PRIVMSG #esoteric :I think it makes the most sense to refer to the song as "Ways and Means", since if that's what the song is generally called, then that's presumably the most recognizable thing by which to call it. < 1388173536 547869 :tswett!6b0598fd@gateway/web/freenode/ip.107.5.152.253 PRIVMSG #esoteric :Then, finally, the name "Haddocks' Eyes" refers to the name "The Aged Aged Man". < 1388173656 633618 :quintopia!~quintopia@unaffiliated/quintopia PRIVMSG #esoteric :ACTION explodes in oerjan's tunnel < 1388173686 970435 :boily!~boily@207.112.39.31 PRIVMSG #esoteric :the chännel has become #eroteric. < 1388173980 439260 :oerjan!oerjan@sprocket.nvg.ntnu.no PRIVMSG #esoteric :wat. < 1388174532 38174 :oerjan!oerjan@sprocket.nvg.ntnu.no PRIVMSG #esoteric :`? taneb < 1388174533 949054 :HackEgo!dlopen@libdl.so PRIVMSG #esoteric :Taneb is not elliott, no matter who you ask. He also isn't a rabbi although he has pretended in the past. He has at least two backup keyboards, and five genders. (See also: d-modules) < 1388174593 348056 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :who invented Tanebventions < 1388174596 9111 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :boily? < 1388174620 153591 :Taneb!~Taneb@runciman.hacksoc.org PRIVMSG #esoteric :He coined the term < 1388174660 481275 :oerjan!oerjan@sprocket.nvg.ntnu.no PRIVMSG #esoteric :the master of chimærventions < 1388175174 885081 :tswett!6b0598fd@gateway/web/freenode/ip.107.5.152.253 PRIVMSG #esoteric :Taneb has five genders, eh? < 1388175176 533618 :tswett!6b0598fd@gateway/web/freenode/ip.107.5.152.253 PRIVMSG #esoteric :What are they? < 1388175180 842689 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :«Isn't category theory defined as "objects and arrows"? And a monad is just the category of types (or so I read somewhere).» < 1388175245 410088 :tswett!6b0598fd@gateway/web/freenode/ip.107.5.152.253 PRIVMSG #esoteric :You know, I can really only think of one name that has a name itself, and that's the tetragrammaton. < 1388175279 673489 :Bike!~Glossina@67-5-224-68.ptld.qwest.net PRIVMSG #esoteric :i hear objects are just morphisms on the category of noumenon < 1388175313 738834 :Bike!~Glossina@67-5-224-68.ptld.qwest.net PRIVMSG #esoteric :i also hear that the name of the rose is actually just "Rose". lovely woma < 1388175314 594029 :tswett!6b0598fd@gateway/web/freenode/ip.107.5.152.253 PRIVMSG #esoteric :Concepts are just Kan extensions. < 1388175314 799800 :Bike!~Glossina@67-5-224-68.ptld.qwest.net PRIVMSG #esoteric :n < 1388175334 227048 :tswett!6b0598fd@gateway/web/freenode/ip.107.5.152.253 PRIVMSG #esoteric :More like Tyler or like Lalonde? < 1388175343 338181 :Bike!~Glossina@67-5-224-68.ptld.qwest.net PRIVMSG #esoteric :lalonde < 1388175366 961680 :tromp_!~tromp@ool-4570a22a.dyn.optonline.net JOIN :#esoteric < 1388175475 845284 :Bike!~Glossina@67-5-224-68.ptld.qwest.net PRIVMSG #esoteric :i can't think of any either, other than the tetragrammaton and the one due to shakespeare < 1388175532 680183 :tswett!6b0598fd@gateway/web/freenode/ip.107.5.152.253 PRIVMSG #esoteric :What's the one due to Shakespeare? < 1388175535 208030 :tswett!6b0598fd@gateway/web/freenode/ip.107.5.152.253 PRIVMSG #esoteric :Macbeth? < 1388175553 191309 :Bike!~Glossina@67-5-224-68.ptld.qwest.net PRIVMSG #esoteric :a rose by any other name < 1388175556 756637 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric :shachaf: whatchaf < 1388175583 383989 :Taneb!~Taneb@runciman.hacksoc.org PRIVMSG #esoteric :tswett, one of them is "male" < 1388175585 905975 :conehead!~conehead@unaffiliated/conehead JOIN :#esoteric < 1388175589 54169 :Taneb!~Taneb@runciman.hacksoc.org PRIVMSG #esoteric :The other four are secret < 1388175590 572741 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :http://www.reddit.com/r/haskell/comments/1tr6ur/wolf_goat_cabbage_solving_simple_logic_problems/ gan < 1388175602 286795 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :the article it links to is not much better < 1388175622 914140 :tromp_!~tromp@ool-4570a22a.dyn.optonline.net QUIT :Ping timeout: 246 seconds < 1388175660 463992 :Bike!~Glossina@67-5-224-68.ptld.qwest.net PRIVMSG #esoteric :oh, apparently 'the name of the rose' isn't related to shakespeare, silly me < 1388175718 884894 :polytone!~monotone@room208.org NICK :monotone < 1388175792 15554 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :and also i like how everyone seems to link to http://adit.io/posts/2013-04-17-functors,_applicatives,_and_monads_in_pictures.html < 1388175840 726280 :Bike!~Glossina@67-5-224-68.ptld.qwest.net PRIVMSG #esoteric :i guess people don't usually talk about names independently of their referents enough for the use of a name rather than "[referent]'s name" to be necessary < 1388175889 669390 :quintopia!~quintopia@unaffiliated/quintopia PRIVMSG #esoteric :does anyone know the name of the wind kthx < 1388175895 638150 :tswett!6b0598fd@gateway/web/freenode/ip.107.5.152.253 PRIVMSG #esoteric :"the wind" hth < 1388175899 29900 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric :ACTION takes a big hit from a bong shaped like douglass hofstadter's head < 1388175917 957563 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :douglass_ hofstadter < 1388175922 694816 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric :c.c < 1388175980 975435 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :Bike: imo come up with a name which names itself < 1388175987 33190 :Bike!~Glossina@67-5-224-68.ptld.qwest.net PRIVMSG #esoteric :tom < 1388175989 587315 :Bike!~Glossina@67-5-224-68.ptld.qwest.net PRIVMSG #esoteric :done < 1388176016 417283 :quintopia!~quintopia@unaffiliated/quintopia PRIVMSG #esoteric :THE AUTONOMEN < 1388176165 721867 :oerjan!oerjan@sprocket.nvg.ntnu.no PRIVMSG #esoteric :s/OMEN/YM you greek-latin mixing fiend < 1388176201 311699 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :is greek-latin like pig-latin < 1388176216 607443 :tswett!6b0598fd@gateway/web/freenode/ip.107.5.152.253 PRIVMSG #esoteric :oerjan meant to say "you greek–latin mixing fiend". < 1388176225 554862 :tswett!6b0598fd@gateway/web/freenode/ip.107.5.152.253 PRIVMSG #esoteric :It's a really easy typo to make. < 1388176227 510979 :oerjan!oerjan@sprocket.nvg.ntnu.no PRIVMSG #esoteric :shachaf: onay < 1388176252 18584 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :tswett meant to say «oerjan meant to say "you greek—latin mixing friend".» < 1388176259 945191 :oerjan!oerjan@sprocket.nvg.ntnu.no PRIVMSG #esoteric :`unidecode – < 1388176261 921308 :HackEgo!dlopen@libdl.so PRIVMSG #esoteric :​[U+2013 EN DASH] < 1388176268 993901 :tswett!6b0598fd@gateway/web/freenode/ip.107.5.152.253 PRIVMSG #esoteric :`unidecode — < 1388176270 435423 :HackEgo!dlopen@libdl.so PRIVMSG #esoteric :​[U+2014 EM DASH] < 1388176275 629918 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :`unidecode r < 1388176277 249095 :HackEgo!dlopen@libdl.so PRIVMSG #esoteric :​[U+0072 LATIN SMALL LETTER R] < 1388176306 969730 :tswett!6b0598fd@gateway/web/freenode/ip.107.5.152.253 PRIVMSG #esoteric :shachaf: you filthy offspring of unspecified gender of a dog of unspecified gender < 1388176321 832417 :tswett!6b0598fd@gateway/web/freenode/ip.107.5.152.253 PRIVMSG #esoteric :`unidecode éé < 1388176323 389106 :HackEgo!dlopen@libdl.so PRIVMSG #esoteric :​[U+00E9 LATIN SMALL LETTER E WITH ACUTE] [U+0065 LATIN SMALL LETTER E] [U+0301 COMBINING ACUTE ACCENT] < 1388176327 136842 :oerjan!oerjan@sprocket.nvg.ntnu.no PRIVMSG #esoteric :are these genders included in taneb's secret list < 1388176338 65346 :tswett!6b0598fd@gateway/web/freenode/ip.107.5.152.253 PRIVMSG #esoteric :oerjan: how should I know? < 1388176343 395519 :Taneb!~Taneb@runciman.hacksoc.org PRIVMSG #esoteric :I will neither confirm or deny that < 1388176348 905494 :oerjan!oerjan@sprocket.nvg.ntnu.no PRIVMSG #esoteric :darn < 1388176367 835823 :tswett!6b0598fd@gateway/web/freenode/ip.107.5.152.253 PRIVMSG #esoteric :I'm trying to think of a word or short phrase meaning "reference upon whose resolution a piece of code will be queued to execute". < 1388176407 880412 :Bike!~Glossina@67-5-224-68.ptld.qwest.net PRIVMSG #esoteric :thunk? < 1388176424 489839 :tswett!6b0598fd@gateway/web/freenode/ip.107.5.152.253 PRIVMSG #esoteric :Hmm. < 1388176436 227743 :oerjan!oerjan@sprocket.nvg.ntnu.no PRIVMSG #esoteric :promise? < 1388176467 692154 :tswett!6b0598fd@gateway/web/freenode/ip.107.5.152.253 PRIVMSG #esoteric :"Promise" here just means "unresolved reference". < 1388176470 308574 :oerjan!oerjan@sprocket.nvg.ntnu.no PRIVMSG #esoteric :both of those seem backwards somehow < 1388176803 718438 :tswett!6b0598fd@gateway/web/freenode/ip.107.5.152.253 PRIVMSG #esoteric :Oh yeah, "nomen" is Latin, isn't it. < 1388176813 470926 :Taneb!~Taneb@runciman.hacksoc.org PRIVMSG #esoteric :Ye < 1388176822 753136 :Bike!~Glossina@67-5-224-68.ptld.qwest.net PRIVMSG #esoteric :noumenanome < 1388176983 925116 :tswett!6b0598fd@gateway/web/freenode/ip.107.5.152.253 PRIVMSG #esoteric :Whelp, I just finished writing the semantics for my unfinished version of Gregor's Answer. < 1388177004 129626 :conehead!~conehead@unaffiliated/conehead QUIT :Quit: Computer has gone to sleep. < 1388177044 112914 :tswett!6b0598fd@gateway/web/freenode/ip.107.5.152.253 PRIVMSG #esoteric :`unidecode  < 1388177045 764441 :HackEgo!dlopen@libdl.so PRIVMSG #esoteric :​[U+E000 DUNNO] < 1388177055 5866 :tswett!6b0598fd@gateway/web/freenode/ip.107.5.152.253 PRIVMSG #esoteric :Maybe I should make a language called . < 1388177071 660966 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric :haha < 1388177076 763892 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric :`paste bin/unidecode < 1388177078 630437 :HackEgo!dlopen@libdl.so PRIVMSG #esoteric :http://codu.org/projects/hackbot/fshg/index.cgi/raw-file/tip/bin/unidecode < 1388177084 476584 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric :awesome < 1388177086 838287 :tswett!6b0598fd@gateway/web/freenode/ip.107.5.152.253 PRIVMSG #esoteric :The name of the language's name would, of course, be "Unicode private use character U+E000". < 1388177092 417527 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric :also for me that shows up as a penguin <3 < 1388177095 460476 :Bike!~Glossina@67-5-224-68.ptld.qwest.net PRIVMSG #esoteric :a language whose name is f8ff in whatever encoding < 1388177130 115428 :tswett!6b0598fd@gateway/web/freenode/ip.107.5.152.253 PRIVMSG #esoteric :How about , what does that show up as for you guys. < 1388177142 216016 :Bike!~Glossina@67-5-224-68.ptld.qwest.net PRIVMSG #esoteric :a rectangle < 1388177150 445835 :tswett!6b0598fd@gateway/web/freenode/ip.107.5.152.253 PRIVMSG #esoteric :I wonder if there's a way I could copy an invalid code point to the clipboard... < 1388177170 945827 :tswett!6b0598fd@gateway/web/freenode/ip.107.5.152.253 PRIVMSG #esoteric :Hmmmm. < 1388177180 511826 :Bike!~Glossina@67-5-224-68.ptld.qwest.net PRIVMSG #esoteric :øÿ < 1388177201 957084 :tswett!6b0598fd@gateway/web/freenode/ip.107.5.152.253 PRIVMSG #esoteric :You know, I could probably set this text box's character encoding to Latin1. < 1388177232 366499 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric :for me  is a big squiggly thing that's like 5 times wider than a usual character < 1388177236 503502 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric :(proportional font natch) < 1388177288 747138 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric : is a benzene ring < 1388177299 704914 :tswett!6b0598fd@gateway/web/freenode/ip.107.5.152.253 PRIVMSG #esoteric :`unidecode ÿø < 1388177301 22962 :HackEgo!dlopen@libdl.so PRIVMSG #esoteric :​[U+00FF LATIN SMALL LETTER Y WITH DIAERESIS] [U+00F8 LATIN SMALL LETTER O WITH STROKE] < 1388177304 830459 :tswett!6b0598fd@gateway/web/freenode/ip.107.5.152.253 PRIVMSG #esoteric :Aww. < 1388177306 26097 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric : is a keyboard key icon with a GNU on it < 1388177399 782938 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric :penguins, flowers, italicized greek, ligatures, cantillated hebrew, strikethrough latin, gnus, hangul jamo, georgian script (??), box drawin' characters < 1388177422 556561 :Bike!~Glossina@67-5-224-68.ptld.qwest.net PRIVMSG #esoteric :why ?? < 1388177428 954960 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric :cause I can't identify it for sure < 1388177431 266425 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric :without Effort < 1388177432 727762 :Bike!~Glossina@67-5-224-68.ptld.qwest.net PRIVMSG #esoteric :oh < 1388177457 638996 :w00tles!~w00tles@87-104-164-168-dynamic-customer.profibernet.dk QUIT :Quit: quit < 1388177552 945903 :tswett_!~blah@c-107-5-152-253.hsd1.mi.comcast.net JOIN :#esoteric < 1388177563 716571 :tswett_!~blah@c-107-5-152-253.hsd1.mi.comcast.net PRIVMSG #esoteric :Ahoy. < 1388177571 290384 :Bike!~Glossina@67-5-224-68.ptld.qwest.net PRIVMSG #esoteric :are you a dried chicken wing < 1388177579 759717 :tswett_!~blah@c-107-5-152-253.hsd1.mi.comcast.net PRIVMSG #esoteric :Who, < 1388177584 884719 :tswett_!~blah@c-107-5-152-253.hsd1.mi.comcast.net PRIVMSG #esoteric :Er. < 1388177588 482680 :tswett_!~blah@c-107-5-152-253.hsd1.mi.comcast.net PRIVMSG #esoteric :Who, me? < 1388177594 424877 :tswett_!~blah@c-107-5-152-253.hsd1.mi.comcast.net PRIVMSG #esoteric :`unidecode < 1388177595 993405 :HackEgo!dlopen@libdl.so PRIVMSG #esoteric :Traceback (most recent call last): \ File "/hackenv/bin/unidecode", line 4, in \ print u" ".join("[U+{0:04X} {1}]".format(ord(c), unicodedata.name(c, "DUNNO")) for c in " ".join(sys.argv[1:]).decode("utf-8")).encode("utf-8") \ File "/opt/python27/lib/python2.7/encodings/utf_8.py", line 16, in decode \ return codecs.utf_8_decode < 1388177607 480163 :tswett_!~blah@c-107-5-152-253.hsd1.mi.comcast.net PRIVMSG #esoteric :Uh-huh. < 1388177622 641133 :tswett_!~blah@c-107-5-152-253.hsd1.mi.comcast.net PRIVMSG #esoteric :`unidecode < 1388177624 510489 :HackEgo!dlopen@libdl.so PRIVMSG #esoteric :Traceback (most recent call last): \ File "/hackenv/bin/unidecode", line 4, in \ print u" ".join("[U+{0:04X} {1}]".format(ord(c), unicodedata.name(c, "DUNNO")) for c in " ".join(sys.argv[1:]).decode("utf-8")).encode("utf-8") \ File "/opt/python27/lib/python2.7/encodings/utf_8.py", line 16, in decode \ return codecs.utf_8_decode < 1388177631 126602 :tswett!6b0598fd@gateway/web/freenode/ip.107.5.152.253 PRIVMSG #esoteric :`unidecode øÿ < 1388177632 717158 :HackEgo!dlopen@libdl.so PRIVMSG #esoteric :​[U+00F8 LATIN SMALL LETTER O WITH STROKE] [U+00FF LATIN SMALL LETTER Y WITH DIAERESIS] < 1388177640 560403 :Bike!~Glossina@67-5-224-68.ptld.qwest.net PRIVMSG #esoteric :what is hapen < 1388177643 665746 :tswett!6b0598fd@gateway/web/freenode/ip.107.5.152.253 PRIVMSG #esoteric :Sump'm wunky. < 1388177747 367907 :tswett!6b0598fd@gateway/web/freenode/ip.107.5.152.253 PRIVMSG #esoteric :Lemme see here. < 1388177751 17542 :tswett_!~blah@c-107-5-152-253.hsd1.mi.comcast.net QUIT :Client Quit < 1388177783 863508 :tswett_!~blah@c-107-5-152-253.hsd1.mi.comcast.net JOIN :#esoteric < 1388177794 787216 :tswett!6b0598fd@gateway/web/freenode/ip.107.5.152.253 PRIVMSG #esoteric :tswett: ¡olé! < 1388177819 216362 :tswett_!~blah@c-107-5-152-253.hsd1.mi.comcast.net PRIVMSG #esoteric :tswett: ¡olé! < 1388177827 400884 :tswett_!~blah@c-107-5-152-253.hsd1.mi.comcast.net PRIVMSG #esoteric :Yeah baby. We're in business. < 1388177842 941925 :b_jonas!~x@russell2.math.bme.hu PRIVMSG #esoteric :Bike: Somebody set us up the bomb. < 1388177844 643800 :tswett_!~blah@c-107-5-152-253.hsd1.mi.comcast.net PRIVMSG #esoteric :`unidecode ¡é < 1388177846 164600 :HackEgo!dlopen@libdl.so PRIVMSG #esoteric :​[U+00A1 INVERTED EXCLAMATION MARK] [U+00E9 LATIN SMALL LETTER E WITH ACUTE] < 1388177922 936421 :tswett!6b0598fd@gateway/web/freenode/ip.107.5.152.253 PRIVMSG #esoteric :Now I kinda wonder, like, what if I, like... < 1388177938 58428 :Bike!~Glossina@67-5-224-68.ptld.qwest.net PRIVMSG #esoteric :smoked a bong /made out of/ hofstater's head? < 1388177968 961506 :tswett!6b0598fd@gateway/web/freenode/ip.107.5.152.253 PRIVMSG #esoteric :That just gave me an error message. < 1388178039 386567 :tswett!6b0598fd@gateway/web/freenode/ip.107.5.152.253 PRIVMSG #esoteric :I typed 猫 into the thing that's supposed to convert UTF-8 to Latin1. < 1388178048 545433 :tswett!6b0598fd@gateway/web/freenode/ip.107.5.152.253 PRIVMSG #esoteric :Thing is, I guess that's not really possible. < 1388178067 907205 :Bike!~Glossina@67-5-224-68.ptld.qwest.net PRIVMSG #esoteric :it's not in latin1 is it < 1388178073 683806 :tswett!6b0598fd@gateway/web/freenode/ip.107.5.152.253 PRIVMSG #esoteric :Nope. < 1388178073 921790 :Bike!~Glossina@67-5-224-68.ptld.qwest.net PRIVMSG #esoteric :or, in fact, latin < 1388178084 973681 :tswett!6b0598fd@gateway/web/freenode/ip.107.5.152.253 PRIVMSG #esoteric :I don't think ¡ is Latin either, but it's in Latin1. < 1388178110 990888 :Bike!~Glossina@67-5-224-68.ptld.qwest.net PRIVMSG #esoteric :it's in a romance language at least. < 1388178129 456875 :tswett!6b0598fd@gateway/web/freenode/ip.107.5.152.253 PRIVMSG #esoteric :How romantic. < 1388178151 432122 :tswett!6b0598fd@gateway/web/freenode/ip.107.5.152.253 PRIVMSG #esoteric :`unidecode à < 1388178153 236231 :HackEgo!dlopen@libdl.so PRIVMSG #esoteric :​[U+00C3 LATIN CAPITAL LETTER A WITH TILDE] [U+0083 DUNNO] < 1388178179 494994 :tswett!6b0598fd@gateway/web/freenode/ip.107.5.152.253 PRIVMSG #esoteric :`unidecode à < 1388178180 914018 :HackEgo!dlopen@libdl.so PRIVMSG #esoteric :​[U+00C3 LATIN CAPITAL LETTER A WITH TILDE] [U+0083 DUNNO] [U+00C2 LATIN CAPITAL LETTER A WITH CIRCUMFLEX] [U+0083 DUNNO] < 1388178211 874720 :tswett_!~blah@c-107-5-152-253.hsd1.mi.comcast.net QUIT :Ping timeout: 260 seconds < 1388178258 797382 :zzo38!~zzo38@24-207-57-25.eastlink.ca PRIVMSG #esoteric :I did write a program, which can do some things including convert UTF-8 to Latin1. < 1388178282 483641 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric :`from-8bit 猫 < 1388178284 310273 :HackEgo!dlopen@libdl.so PRIVMSG #esoteric :iconv: illegal input sequence at position 0 \ iconv: conversion from `None' is not supported \ Try `iconv --help' or `iconv --usage' for more information. \ iconv: illegal input sequence at position 0 < 1388178294 998527 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric :none encoding with left beef < 1388178341 693586 :tswett!6b0598fd@gateway/web/freenode/ip.107.5.152.253 PRIVMSG #esoteric :Lessee, in raw binary, that's 11000011 01000011 11000010 01000011, but in UTF-8 that's 11000011 10000011 01000011 11000011 10000010 01000011. < 1388178359 81859 :tswett!6b0598fd@gateway/web/freenode/ip.107.5.152.253 PRIVMSG #esoteric :Ah, nope, 8 is 1000, not 0100. < 1388178408 403815 :Bike!~Glossina@67-5-224-68.ptld.qwest.net PRIVMSG #esoteric :"raw" nothin, i need to see the outgoing square wave < 1388178425 82542 :boily!~boily@207.112.39.31 PRIVMSG #esoteric :back from an intense session of XML with . may I ask why are you converting cats? < 1388178447 929240 :tswett!6b0598fd@gateway/web/freenode/ip.107.5.152.253 PRIVMSG #esoteric :So 11000011 is encoded as 11000011 10000011, and 10000011 is encoded as 11000010 10000011, and 11000010 is encoded as 11000011 10000010, and 10000010 is encoded as 11000010 10000010. Right? < 1388178463 419704 :tswett!6b0598fd@gateway/web/freenode/ip.107.5.152.253 PRIVMSG #esoteric :Bike: on which medium? < 1388178486 203034 :Bike!~Glossina@67-5-224-68.ptld.qwest.net PRIVMSG #esoteric :twisted pair < 1388178490 97107 :Bike!~Glossina@67-5-224-68.ptld.qwest.net PRIVMSG #esoteric :also my band < 1388178526 375217 :tswett!6b0598fd@gateway/web/freenode/ip.107.5.152.253 PRIVMSG #esoteric :Yeah, but which twisted pair? < 1388178564 447851 :Bike!~Glossina@67-5-224-68.ptld.qwest.net PRIVMSG #esoteric :the one from your computer to whatever < 1388178579 769624 :tswett!6b0598fd@gateway/web/freenode/ip.107.5.152.253 PRIVMSG #esoteric :To my external hard drive? < 1388178606 403521 :tswett!6b0598fd@gateway/web/freenode/ip.107.5.152.253 PRIVMSG #esoteric :All right, send me an oscilloscope and a spare USB Mini cable. < 1388178611 257645 :boily!~boily@207.112.39.31 PRIVMSG #esoteric :ok. asking why cats are twisted may not be the right enquiry. this conversation has drifted far away from my Earthly needs. I shall drink a glass of OJ, resume my album, and coast along. < 1388178714 397151 :fizzie!fis@unaffiliated/fizzie PRIVMSG #esoteric :µ isn't very Latin, but is also in Latin-1. < 1388178773 919684 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :fizzie: Sure, but μ isn't. < 1388178823 774639 :fizzie!fis@unaffiliated/fizzie PRIVMSG #esoteric :I suppose the MICRO SIGN belongs to everyone. < 1388178828 812689 :fizzie!fis@unaffiliated/fizzie PRIVMSG #esoteric :Like space. < 1388178848 579912 :Bike!~Glossina@67-5-224-68.ptld.qwest.net PRIVMSG #esoteric :you know what sucks? µµg < 1388178849 988624 :Bike!~Glossina@67-5-224-68.ptld.qwest.net PRIVMSG #esoteric :fuck those < 1388178867 799986 :tswett!6b0598fd@gateway/web/freenode/ip.107.5.152.253 PRIVMSG #esoteric :Micromicrograms? < 1388178875 435196 :Bike!~Glossina@67-5-224-68.ptld.qwest.net PRIVMSG #esoteric :yep < 1388178876 543549 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric : < 1388178922 821183 :Bike!~Glossina@67-5-224-68.ptld.qwest.net PRIVMSG #esoteric :used by certain horrible people instead of nano- < 1388178937 969613 :Bike!~Glossina@67-5-224-68.ptld.qwest.net PRIVMSG #esoteric :or femtogram? w/e < 1388178990 466875 :fizzie!fis@unaffiliated/fizzie PRIVMSG #esoteric :Picogram, presumably. < 1388179068 369886 :tromp_!~tromp@ool-4570a22a.dyn.optonline.net JOIN :#esoteric < 1388179084 690100 :boily!~boily@207.112.39.31 PRIVMSG #esoteric :fungot: do you use scruples and minims? < 1388179084 895771 :fungot!fis@eos.zem.fi PRIVMSG #esoteric :boily: it is. :p))) name)) < 1388179096 744147 :boily!~boily@207.112.39.31 PRIVMSG #esoteric :fizzie: your bot. it is mocking me. < 1388179109 842800 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :fungot has no scruples < 1388179110 156458 :fungot!fis@eos.zem.fi PRIVMSG #esoteric :shachaf: i'm sure that all the cps in the first hl, it seems well suited to objects, not classes, lectures < 1388179197 386182 :boily!~boily@207.112.39.31 PRIVMSG #esoteric :fungot: what are hles? < 1388179197 631943 :fungot!fis@eos.zem.fi PRIVMSG #esoteric :boily: that kinda sucks < 1388179214 560653 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :fungot: be nice to boily, fungot < 1388179214 805530 :fungot!fis@eos.zem.fi PRIVMSG #esoteric :shachaf: but if you're at ip=2, the interp will be in the " strong set", you have 1 message. < 1388179225 647638 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :whoa < 1388179240 246347 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :fungot: you've convinced me. niceness to boily is entirely gratuitous < 1388179240 482643 :fungot!fis@eos.zem.fi PRIVMSG #esoteric :shachaf: well anyway! this is classic :) anyone know a fast algorithm in c ( because i'll already have implementations of it < 1388179264 220476 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :fizzie: your bot is rather full of itself < 1388179284 145651 :fizzie!fis@unaffiliated/fizzie PRIVMSG #esoteric :What else would it be full of? < 1388179284 993868 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :wait, maybe this is the setup for a joke < 1388179295 934880 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :fungot: yes, i know a fast algorithm in c < 1388179296 137279 :fungot!fis@eos.zem.fi PRIVMSG #esoteric :shachaf: bye? :p. < 1388179302 680012 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric ::p. < 1388179305 463055 :boily!~boily@207.112.39.31 PRIVMSG #esoteric :shachaf: bleh :P < 1388179310 211876 :zzo38!~zzo38@24-207-57-25.eastlink.ca PRIVMSG #esoteric :Let's see if my plan what I have to do next in a Dungeons&Dragons game is good enough! < 1388179339 471920 :zzo38!~zzo38@24-207-57-25.eastlink.ca PRIVMSG #esoteric :boily: Do YOU know what it is? < 1388179355 538250 :boily!~boily@207.112.39.31 PRIVMSG #esoteric :zzo38: the plan? < 1388179377 790395 :tswett!6b0598fd@gateway/web/freenode/ip.107.5.152.253 PRIVMSG #esoteric :fungot: hey, you know, I really like hanging out with you. < 1388179377 993750 :fungot!fis@eos.zem.fi PRIVMSG #esoteric :tswett: the func kylew just refered to is the first argument < 1388179382 309903 :boily!~boily@207.112.39.31 PRIVMSG #esoteric :(btw, I DMed a bout of Paranoia last Sunday. it was deadly :D) < 1388179505 727634 :zzo38!~zzo38@24-207-57-25.eastlink.ca PRIVMSG #esoteric :boily: Yes I mean the plan. (If you don't know, I can tell you, but maybe I forgot something important too) < 1388179537 649696 :zzo38!~zzo38@24-207-57-25.eastlink.ca PRIVMSG #esoteric :(Such as, what happens in case of something other than what I expected, or am unable to do for some reason) < 1388179573 268453 :boily!~boily@207.112.39.31 PRIVMSG #esoteric :zzo38: could you tell me the plan that is meant, and the Somethings that are Othered, the Forgotten Expectations and Everything Else? < 1388179588 5881 :zzo38!~zzo38@24-207-57-25.eastlink.ca PRIVMSG #esoteric :OK, I can try < 1388179673 707174 :zzo38!~zzo38@24-207-57-25.eastlink.ca PRIVMSG #esoteric :What I need to do, is find an area of plains in the middle of nowhere with nobody else around, make some cage or walls or something so that it is possible to see and hear through but not to walk through, bury the anti-magic amulet upside-down, attached to a trapdoor, hidden with grass, slightly open so that when it is stepped on it will close, ... < 1388179706 218172 :boily!~boily@207.112.39.31 PRIVMSG #esoteric :upside-down? < 1388179732 279899 :zzo38!~zzo38@24-207-57-25.eastlink.ca PRIVMSG #esoteric :... Put another object underneath which will support it, and enchant it with a spell allowing anyone in range who speaks the command word to retrieve it, and then force the prisoner and captain into the cage, lock it, and run away, ... < 1388179822 771890 :boily!~boily@207.112.39.31 PRIVMSG #esoteric :is that a weird analog to the Schrödingcat? < 1388179861 20656 :zzo38!~zzo38@24-207-57-25.eastlink.ca PRIVMSG #esoteric :... Make some barrier or something to assure that they will not step on the patch of the grass where it is hidden until we run away, and then they will step into the circle to un-mind-switch, and the captain will then say something which happens to contain the command word (but he doesn't know that is what it is). < 1388179864 611917 :zzo38!~zzo38@24-207-57-25.eastlink.ca PRIVMSG #esoteric :boily: No. < 1388179905 418064 :boily!~boily@207.112.39.31 PRIVMSG #esoteric :oh. I was fearing it wasn't as devious as it seemed. proceed with your Terrifying Plan, then... < 1388179981 265835 :zzo38!~zzo38@24-207-57-25.eastlink.ca PRIVMSG #esoteric :This may require some psychology to know what we expect the captain to say and to manipulate the situation into such a phrase. < 1388179988 992787 :Taneb!~Taneb@runciman.hacksoc.org PRIVMSG #esoteric :kmc, can you tell me why this won't compile? http://lpaste.net/3941835973981110272 < 1388180006 778978 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric :can you tell me what the error message is? < 1388180042 101638 :zzo38!~zzo38@24-207-57-25.eastlink.ca PRIVMSG #esoteric :But before all of that, we may need to handcuff them together. I have already tied up both of them, but that isn't good enough. < 1388180053 304829 :boily!~boily@207.112.39.31 PRIVMSG #esoteric :zzo38: a traditional Batman Gambit. < 1388180054 296670 :Taneb!~Taneb@runciman.hacksoc.org PRIVMSG #esoteric :kmc, unexpected failure < 1388180064 965217 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric :internal compiler error?? < 1388180065 989414 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric :sucks < 1388180067 429237 :Taneb!~Taneb@runciman.hacksoc.org PRIVMSG #esoteric :Aye < 1388180079 13083 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric :anyway I think you want: use std::io::{stdin, ReaderUtil}; ...; stdin.read_char() < 1388180088 609583 :Taneb!~Taneb@runciman.hacksoc.org PRIVMSG #esoteric :I think it may be because I completely misread a lot of the tutorial < 1388180097 83650 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric :when a function is documented as taking self or &self etc, you call it using OOP method call syntax < 1388180101 599088 :zzo38!~zzo38@24-207-57-25.eastlink.ca PRIVMSG #esoteric :boily: Yes I suppose it is a bit like a Batman Gambit, but far more confusing. < 1388180118 121779 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric :and to call such a method from a trait, you need to bring the trait into scope, even though the name isn't explicitly used < 1388180120 557734 :glogbackup!~glogbacku@192.3.160.190 JOIN :#esoteric < 1388180125 61016 :Taneb!~Taneb@runciman.hacksoc.org PRIVMSG #esoteric :Right < 1388180133 12081 :boily!~boily@207.112.39.31 PRIVMSG #esoteric :glelllolllolllelllogbackup. < 1388180147 467800 :boily!~boily@207.112.39.31 PRIVMSG #esoteric :zzo38: and why the requirement to the handcuffs? < 1388180168 603703 :zzo38!~zzo38@24-207-57-25.eastlink.ca PRIVMSG #esoteric :boily: So that they are forced to remain next to each other. < 1388180188 334626 :Taneb!~Taneb@runciman.hacksoc.org PRIVMSG #esoteric :Well, now it gives me an actual error < 1388180191 615138 :boily!~boily@207.112.39.31 PRIVMSG #esoteric :zzo38: indeed. only one trap, and you wouldn't want one of them staying untrapped, eh? < 1388180202 712959 :Taneb!~Taneb@runciman.hacksoc.org PRIVMSG #esoteric :failed to find an implementation of trait std::io::Reader for extern "Rust" fn() -> @std::io::Reader:'static < 1388180257 126037 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric :oh you need to call stdin() < 1388180261 261803 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric :to get the object which represents stdin < 1388180263 580449 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric :i don't remember why :/ < 1388180277 877149 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric :you're using the old @-ful IO stuff < 1388180278 865860 :zzo38!~zzo38@24-207-57-25.eastlink.ca PRIVMSG #esoteric :boily: Well, I intend to set the captain free afterward if the plan works correctly. But I won't free the other guy. < 1388180283 44371 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric :so all this code will be scrapped when you upgrade Rust < 1388180303 738263 :Taneb!~Taneb@runciman.hacksoc.org PRIVMSG #esoteric :Serves me right for trying to learn an indev language :) < 1388180310 864294 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric :ayup < 1388180319 404018 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric :although the /concepts/ are pretty much fixed at this point < 1388180338 825709 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric :and the concepts are unique enough that they require some learning < 1388180350 364049 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric :it's not like learning Python when you know Ruby or whatever < 1388180360 492814 :boily!~boily@207.112.39.31 PRIVMSG #esoteric :zzo38: so you need an unhandcuffer somewhere. < 1388180381 727034 :zzo38!~zzo38@24-207-57-25.eastlink.ca PRIVMSG #esoteric :boily: That will be easily enough to do afterward, I expect. < 1388180400 458082 :Taneb!~Taneb@runciman.hacksoc.org PRIVMSG #esoteric :Well, my code works now < 1388180403 557405 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric :coool! < 1388180405 768083 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric :congratsneb < 1388180446 408130 :Taneb!~Taneb@runciman.hacksoc.org PRIVMSG #esoteric :(trying to solve http://rosalind.info/problems/dna/ ) < 1388180507 517312 :zzo38!~zzo38@24-207-57-25.eastlink.ca PRIVMSG #esoteric :But there are things to consider, such as the range of the anti-magic, which is 60ft. < 1388180533 983103 :Bike!~Glossina@67-5-224-68.ptld.qwest.net PRIVMSG #esoteric :hehh, it has "Translating RNA into Protein" but the actual problem is way easier than the title makes you think < 1388180538 925289 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric :lol < 1388180542 408557 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric :yeah write a protein folding simulator < 1388180560 86258 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric :Taneb: would you like style criticism on your code < 1388180579 589105 :Taneb!~Taneb@runciman.hacksoc.org PRIVMSG #esoteric :Please < 1388180581 416474 :zzo38!~zzo38@24-207-57-25.eastlink.ca PRIVMSG #esoteric :And it may be necessary to see what is happening from remotely, somehow. This is to see who is dead and who is switched and stuff like that. < 1388180584 492559 :Bike!~Glossina@67-5-224-68.ptld.qwest.net PRIVMSG #esoteric :cool little site though < 1388180610 867974 :Taneb!~Taneb@runciman.hacksoc.org PRIVMSG #esoteric :Bike, for practising programming I'd rate it much higher than Euler < 1388180617 480316 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric :loop { match my_stdin.read_char() { '\n' => break, ... } } < 1388180621 322026 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric :that avoids the need for buf < 1388180632 808788 :Bike!~Glossina@67-5-224-68.ptld.qwest.net PRIVMSG #esoteric :Taneb: it's true, euler involves a lot more math < 1388180633 877318 :boily!~boily@207.112.39.31 PRIVMSG #esoteric :~eval intercalate " " . map (show . length) . group . sort $ "AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC" < 1388180635 820029 :metasepia!~metasepia@207.112.39.31 PRIVMSG #esoteric :"20 12 17 21" < 1388180638 363050 :zzo38!~zzo38@24-207-57-25.eastlink.ca PRIVMSG #esoteric :Since there is also the possibility that the prisoner is lying and he may be able to kill the captain. But, I do have a backup plan in that case too! < 1388180648 341152 :Taneb!~Taneb@runciman.hacksoc.org PRIVMSG #esoteric :kmc, ooh, cunning < 1388180653 413525 :Bike!~Glossina@67-5-224-68.ptld.qwest.net PRIVMSG #esoteric ::t intercalate < 1388180654 244428 :lambdabot!~lambdabot@silicon.int-e.eu PRIVMSG #esoteric :[a] -> [[a]] -> [a] < 1388180664 363825 :boily!~boily@207.112.39.31 PRIVMSG #esoteric :zzo38: 60ft radius of AM? that's more than enough. < 1388180664 894999 :zzo38!~zzo38@24-207-57-25.eastlink.ca PRIVMSG #esoteric :Did I miss anything else important, perhaps? < 1388180667 185338 :Bike!~Glossina@67-5-224-68.ptld.qwest.net PRIVMSG #esoteric :i think that may be cheating. < 1388180677 898592 :boily!~boily@207.112.39.31 PRIVMSG #esoteric :zzo38: and what is your contingency plan? < 1388180679 528606 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric :i might also use a hashmap rather than 4 variables, but that's something a matter of taste < 1388180698 850709 :boily!~boily@207.112.39.31 PRIVMSG #esoteric :zzo38: eeeeh... you really need a roof over your cage. < 1388180701 710763 :Taneb!~Taneb@runciman.hacksoc.org PRIVMSG #esoteric :kmc, with only 4 variables, it doesn't feel worth it < 1388180703 603260 :Bike!~Glossina@67-5-224-68.ptld.qwest.net PRIVMSG #esoteric :also, totally impractical for sequences of realistic length :p < 1388180704 560596 :zzo38!~zzo38@24-207-57-25.eastlink.ca PRIVMSG #esoteric :boily: Yes I know it is more than enough, but if it is too large, that can be a problem too; the exact range will be important. < 1388180705 361022 :Taneb!~Taneb@runciman.hacksoc.org PRIVMSG #esoteric :Any more, and I'd switch < 1388180707 312720 :boily!~boily@207.112.39.31 PRIVMSG #esoteric :zzo38: also, dig-proof your trap. < 1388180736 504109 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric :in master rust there is println!(..) which does the fmt! for you < 1388180740 811912 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :kmc: does rust refer to things by their implementations < 1388180741 96142 :zzo38!~zzo38@24-207-57-25.eastlink.ca PRIVMSG #esoteric :O, yes I need the roof, I suppose. < 1388180741 897478 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric :also the formatting language has completely changed < 1388180744 375750 :Bike!~Glossina@67-5-224-68.ptld.qwest.net PRIVMSG #esoteric :http://rosalind.info/problems/mprt/ now that's more like it < 1388180747 318639 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric :shachaf: there are traits too < 1388180751 782613 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric :but i don't remember if hashmap uses the trait < 1388180751 988580 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :i mean "hashmap" < 1388180764 362353 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric :i mean that there is a trait for unordered containers or w/e < 1388180764 882047 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :oh maybe that's what you mean < 1388180769 737647 :zzo38!~zzo38@24-207-57-25.eastlink.ca PRIVMSG #esoteric :And, how do you mean, dig-proof? It isn't really a trap; it is supposed to be a kind of defense mechanism. < 1388180772 994041 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :yes < 1388180793 180385 :Bike!~Glossina@67-5-224-68.ptld.qwest.net PRIVMSG #esoteric :hey look! de bruijn! < 1388180805 860351 :Bike!~Glossina@67-5-224-68.ptld.qwest.net PRIVMSG #esoteric :edit distance is way down there tho < 1388180809 622823 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric :it's now more like Python's str.format method < 1388180824 89478 :Bike!~Glossina@67-5-224-68.ptld.qwest.net PRIVMSG #esoteric :i might have to do these < 1388180828 631546 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric :which is p. cool < 1388180872 654661 :Bike!~Glossina@67-5-224-68.ptld.qwest.net PRIVMSG #esoteric :it's cool how close bioinformatics is to information theory stuffs < 1388180883 230641 :zzo38!~zzo38@24-207-57-25.eastlink.ca PRIVMSG #esoteric :My backup plan is that if the prisoner kills the captain, have someone go near the cage and speak another phrase which happens to contain the command word, and then call me and the royal wizard over, to deal with it. < 1388180883 956282 :boily!~boily@207.112.39.31 PRIVMSG #esoteric :zzo38: hmm... when we D&D, we always find a way to severely compromise the physical integrity of surrounding things, whatever material they may be made of. < 1388180895 518703 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric :I tend to rant about how format strings should be replaced with some richer data type < 1388180903 585482 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric :but I realized that you'd have to re-build all the internationalization tools < 1388180916 101457 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric :format strings are the bread and butter of i18n, which is largely performed by non-programmers < 1388180930 128581 :zzo38!~zzo38@24-207-57-25.eastlink.ca PRIVMSG #esoteric :boily: Can you explain more about that please? < 1388180932 762866 :boily!~boily@207.112.39.31 PRIVMSG #esoteric :zzo38: so the intent is to have the prisonner die in a discreet manner, surrounded by Green Pastures. < 1388180937 545961 :Bike!~Glossina@67-5-224-68.ptld.qwest.net PRIVMSG #esoteric :you use format strings for internationalization? < 1388180951 491224 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric :the syntax used by Python .format() and new Rust fmt! allows the format string to permute its arguments, which is important for i18n < 1388180958 739548 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :in that case why aren't they called forinternationalization strings < 1388180961 754143 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric :c.c < 1388180965 383641 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :i blame Gracenotes < 1388180967 161142 :zzo38!~zzo38@24-207-57-25.eastlink.ca PRIVMSG #esoteric :boily: NO. The intent is to force him to un-mind-switch with the captain; the captain wants his body back. < 1388180971 246715 :boily!~boily@207.112.39.31 PRIVMSG #esoteric :zzo38: explosions, magical mishaps, stupid self-sacrifices with energy buildups, mutations... < 1388180974 991747 :boily!~boily@207.112.39.31 PRIVMSG #esoteric :zzo38: oh. < 1388180979 920783 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric :hungarian fori18ns < 1388180983 429451 :tromp_!~tromp@ool-4570a22a.dyn.optonline.net QUIT :Ping timeout: 245 seconds < 1388180995 461485 :Bike!~Glossina@67-5-224-68.ptld.qwest.net PRIVMSG #esoteric :that was a serious question i don't know about i18n < 1388181007 629494 :zzo38!~zzo38@24-207-57-25.eastlink.ca PRIVMSG #esoteric :And in my plan I have just the only small window of magic in order to prevent other magical stuff. < 1388181009 858315 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric :Bike: yeah, someone has to translate all the strings used in the UI < 1388181025 969936 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric :and they'll often be format strings because stuff gets interpolated < 1388181033 12383 :zzo38!~zzo38@24-207-57-25.eastlink.ca PRIVMSG #esoteric :The secondary objective is the prisoner to be dead. < 1388181044 137291 :Bike!~Glossina@67-5-224-68.ptld.qwest.net PRIVMSG #esoteric :the only thing i know about is that one C library that defines a _ macro or suchlike < 1388181050 78229 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric :and different languages put things in different orders sometimes < 1388181066 562937 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :_(Bicycle) < 1388181071 230795 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric :bicyclidine < 1388181071 530059 :boily!~boily@207.112.39.31 PRIVMSG #esoteric :zzo38: AAAAAAAAAAH! sudden illumination. “mind switch.” I now understand. < 1388181087 928228 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric :`addquote zzo38: AAAAAAAAAAH! sudden illumination. “mind switch.” I now understand. < 1388181092 557672 :HackEgo!dlopen@libdl.so PRIVMSG #esoteric :1149) zzo38: AAAAAAAAAAH! sudden illumination. “mind switch.” I now understand. < 1388181115 618995 :Bike!~Glossina@67-5-224-68.ptld.qwest.net PRIVMSG #esoteric :so you have println(_("fuck your shit")) and the _ takes care of making a list of what needs to be translated, and replacing it, or... whatever < 1388181122 563470 :Gregor!dlopen@libdl.so PRIVMSG #esoteric :squashfs is my new favorite archival format. < 1388181125 322673 :Bike!~Glossina@67-5-224-68.ptld.qwest.net PRIVMSG #esoteric :println isn't real c but, fuck it < 1388181140 738933 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric :#define println puts < 1388181145 290579 :Bike!~Glossina@67-5-224-68.ptld.qwest.net PRIVMSG #esoteric :yeah that one < 1388181153 655085 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric :#define create creat < 1388181162 684702 :Taneb!~Taneb@runciman.hacksoc.org PRIVMSG #esoteric :kmc, final code: http://runciman.hacksoc.org/~taneb/dna.rs.txt any more tips/ < 1388181177 673692 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric :"apparently future rust does this nicer." i'm not sure about that :3 < 1388181197 374363 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric :it looks good Taneb < 1388181211 93339 :Taneb!~Taneb@runciman.hacksoc.org PRIVMSG #esoteric ::) < 1388181215 973869 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric :do we have a += operator? i forgot < 1388181223 299715 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric ::t (+=) < 1388181224 271391 :lambdabot!~lambdabot@silicon.int-e.eu PRIVMSG #esoteric :(Num a, MonadState s m) => ASetter' s a -> a -> m () < 1388181230 315330 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric :i think you don't need the semicolon after match { ... }; < 1388181236 573246 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric :cause it ends the enclosing block < 1388181261 976330 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :what if during the month after february but before april, you could use march { ... } blocks < 1388181269 660253 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :but it would be a syntax error otherwise < 1388181272 830252 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric :el oh el < 1388181303 739570 :Taneb!~Taneb@runciman.hacksoc.org PRIVMSG #esoteric :kmc, there is a += < 1388181324 444402 :Taneb!~Taneb@runciman.hacksoc.org PRIVMSG #esoteric :There is not a ++ < 1388181327 343411 :Taneb!~Taneb@runciman.hacksoc.org PRIVMSG #esoteric :SCIENCE < 1388181334 154106 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric :i think for reasons < 1388181339 18262 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :well, i mean, who likes ++ < 1388181339 222251 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric :hm i can't remember < 1388181343 55298 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :++-- < 1388181350 316161 :Taneb!~Taneb@runciman.hacksoc.org PRIVMSG #esoteric :`karma ++ < 1388181354 703016 :HackEgo!dlopen@libdl.so PRIVMSG #esoteric :​++ has 0 karma. < 1388181360 356213 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :(who's *crementing whom here??) < 1388181367 796065 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric :I do know that there was concern over letting people overload += because you might make x += y behave semantically differently from x = x + y, but you probably *do* want them to be different for efficiency < 1388181369 513456 :zzo38!~zzo38@24-207-57-25.eastlink.ca PRIVMSG #esoteric :boily: Ah, but there is more! I will need to blindfold them at first, while arranging the area for the box in the grass. Since, we need to make them remain in the range of the anti-magic field. < 1388181385 112971 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric :say x and y are huge matrices, it is better to add the elements in-place if you can < 1388181403 298982 :Taneb!~Taneb@runciman.hacksoc.org PRIVMSG #esoteric :kmc, that is still semantically equivalent, just not operationally, right? < 1388181427 155367 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric :but there's no way for the lang to verify that your += and + overloads are consistent < 1388181437 209645 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric :the C++ answer is "sucks to be you then" < 1388181448 184846 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric :but Rust people are less happy with that answer? < 1388181449 503976 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric :shrug < 1388181454 800949 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric :gotta go ttyl < 1388181491 506160 :boily!~boily@207.112.39.31 PRIVMSG #esoteric :zzo38: will you have to use timed, self-disintegrating blindfolds? < 1388181508 263637 :boily!~boily@207.112.39.31 PRIVMSG #esoteric :(meanwhile, disappearing toward some random movie.) < 1388181510 8758 :zzo38!~zzo38@24-207-57-25.eastlink.ca PRIVMSG #esoteric :boily: No, removing them by hand should be OK. < 1388181523 272729 :boily!~boily@207.112.39.31 PRIVMSG #esoteric :zzo38: more reliable. < 1388181529 126786 :boily!~boily@207.112.39.31 QUIT :Quit: HORROR CHICKEN < 1388181532 286438 :metasepia!~metasepia@207.112.39.31 QUIT :Remote host closed the connection < 1388181551 917084 :zzo38!~zzo38@24-207-57-25.eastlink.ca PRIVMSG #esoteric :Hopefully, do all of you others understand this plan now? < 1388181558 517770 :zzo38!~zzo38@24-207-57-25.eastlink.ca PRIVMSG #esoteric :Or is it too confusing? < 1388181572 245205 :quintopia!~quintopia@unaffiliated/quintopia PRIVMSG #esoteric :it makes sense to me < 1388181594 552657 :zzo38!~zzo38@24-207-57-25.eastlink.ca PRIVMSG #esoteric :OK, good. < 1388181618 600851 :zzo38!~zzo38@24-207-57-25.eastlink.ca PRIVMSG #esoteric :Did I miss anything, or is there another question to consider, or something else? There may be something I haven't anticipated yet. < 1388181649 920212 :carado!~user4539@2a01:e35:8b61:e430:6ef0:49ff:fe73:1fd0 QUIT :Ping timeout: 246 seconds < 1388181788 943118 :Taneb!~Taneb@runciman.hacksoc.org PRIVMSG #esoteric :Another program! < 1388181789 251110 :Taneb!~Taneb@runciman.hacksoc.org PRIVMSG #esoteric :http://runciman.hacksoc.org/~taneb/rna.rs.txt < 1388181798 934888 :carado!~user4539@2a01:e35:8b61:e430:6ef0:49ff:fe73:1fd0 JOIN :#esoteric < 1388181820 672597 :Taneb!~Taneb@runciman.hacksoc.org PRIVMSG #esoteric :Please anyone make ANY criticism you can think of < 1388181838 564033 :Bike!~Glossina@67-5-224-68.ptld.qwest.net PRIVMSG #esoteric :do you not care about recieving invalid dna? < 1388181845 627043 :Taneb!~Taneb@runciman.hacksoc.org PRIVMSG #esoteric :No < 1388182034 822700 :Bike_!~Glossina@71-214-86-192.ptld.qwest.net JOIN :#esoteric < 1388182101 15156 :Bike!~Glossina@67-5-224-68.ptld.qwest.net QUIT :Ping timeout: 246 seconds < 1388182159 1512 :Bike_!~Glossina@71-214-86-192.ptld.qwest.net PRIVMSG #esoteric :with something that simple is there much to criticize < 1388182177 577626 :Taneb!~Taneb@runciman.hacksoc.org PRIVMSG #esoteric :Bike_, I want to make sure I'm not doing anything awful < 1388182191 462876 :Taneb!~Taneb@runciman.hacksoc.org PRIVMSG #esoteric :I mean, in a Haskell program that long I could do like 100 awful things < 1388182345 287323 :Bike_!~Glossina@71-214-86-192.ptld.qwest.net PRIVMSG #esoteric :well everything i can think of is boring stuff like 'what about lowercase letters' and CRLF handling < 1388182350 106547 :Bike_!~Glossina@71-214-86-192.ptld.qwest.net NICK :Bike < 1388182357 680168 :Bike!~Glossina@71-214-86-192.ptld.qwest.net PRIVMSG #esoteric :you could skip to making more general transducers i guess < 1388182385 166379 :Taneb!~Taneb@runciman.hacksoc.org PRIVMSG #esoteric :Bike, the input is very restricted. Not sure about crlf handling, though < 1388182424 114221 :FreeFull!~freefull@defocus/sausage-lover PRIVMSG #esoteric :Taneb: That looks suspiciously like Rust < 1388182441 95089 :Taneb!~Taneb@runciman.hacksoc.org PRIVMSG #esoteric :FreeFull, there is a good reason for that < 1388182455 100232 :Bike!~Glossina@71-214-86-192.ptld.qwest.net PRIVMSG #esoteric :in my amazingly awesome experience with bio lab code, line endings are an everpresent nightmare, so be prepared?? < 1388182476 338685 :Taneb!~Taneb@runciman.hacksoc.org PRIVMSG #esoteric :Also I've had something in my eye for like two hours < 1388182487 836760 :FreeFull!~freefull@defocus/sausage-lover PRIVMSG #esoteric :Taneb: Also looks suspiciously like converting DNA to RNA in a Rosalind problem < 1388182505 890728 :FreeFull!~freefull@defocus/sausage-lover PRIVMSG #esoteric :I would have just used tr < 1388182517 929928 :Bike!~Glossina@71-214-86-192.ptld.qwest.net PRIVMSG #esoteric :right, general transducer. < 1388182549 272668 :Taneb!~Taneb@runciman.hacksoc.org PRIVMSG #esoteric :FreeFull, my goal is to learn rust, not to solve Rosalind problems :) < 1388182565 807719 :Bike!~Glossina@71-214-86-192.ptld.qwest.net PRIVMSG #esoteric :i feel like i shoudl complain about 'converting' there since you're totally ignoring primary transcription < 1388182567 534303 :FreeFull!~freefull@defocus/sausage-lover PRIVMSG #esoteric :=P < 1388182574 438481 :FreeFull!~freefull@defocus/sausage-lover PRIVMSG #esoteric :Taneb: Project Euler too mathy? < 1388182592 870036 :Taneb!~Taneb@runciman.hacksoc.org PRIVMSG #esoteric :FreeFull, Project Euler I find is awful for learning a language < 1388182612 742266 :FreeFull!~freefull@defocus/sausage-lover PRIVMSG #esoteric :Taneb: Right now, isn't it that what breaks out of the loop is an error? < 1388182618 507044 :FreeFull!~freefull@defocus/sausage-lover PRIVMSG #esoteric :That's not good < 1388182633 576847 :Taneb!~Taneb@runciman.hacksoc.org PRIVMSG #esoteric :What? < 1388182654 612833 :FreeFull!~freefull@defocus/sausage-lover PRIVMSG #esoteric :Well, you've got an infinite loop with a match in it < 1388182661 860065 :FreeFull!~freefull@defocus/sausage-lover PRIVMSG #esoteric :And then a statement after that < 1388182694 562278 :FreeFull!~freefull@defocus/sausage-lover PRIVMSG #esoteric :I assume you mean for that statement to be reached at some point < 1388182695 513760 :Bike!~Glossina@71-214-86-192.ptld.qwest.net PRIVMSG #esoteric :break breaks out of the loop, rather than signaling an error < 1388182710 948907 :FreeFull!~freefull@defocus/sausage-lover PRIVMSG #esoteric :Oh, wait < 1388182720 448173 :FreeFull!~freefull@defocus/sausage-lover PRIVMSG #esoteric :I didn't notice that the \n case broke out of the loop < 1388182725 159185 :FreeFull!~freefull@defocus/sausage-lover PRIVMSG #esoteric :Disregard me, I'm derpy >_< < 1388182738 205490 :FreeFull!~freefull@defocus/sausage-lover PRIVMSG #esoteric :Taneb: What happens when the loop gets EOF? < 1388182846 303135 :Phantom_Hoover!~Phantom@unaffiliated/phantom-hoover JOIN :#esoteric < 1388182990 366865 :conehead!~conehead@unaffiliated/conehead JOIN :#esoteric < 1388183193 7738 :Phantom_Hoover!~Phantom@unaffiliated/phantom-hoover QUIT :Ping timeout: 246 seconds < 1388183300 817717 :MindlessDrone!~MindlessD@HSI-KBW-37-49-6-33.hsi14.kabel-badenwuerttemberg.de QUIT :Quit: MindlessDrone < 1388184205 445142 :pjotter!~pjotter@a80-101-119-171.adsl.xs4all.nl JOIN :#esoteric < 1388184600 399722 :glogbackup!~glogbacku@192.3.160.190 QUIT :Remote host closed the connection < 1388184698 446361 :Taneb!~Taneb@runciman.hacksoc.org PRIVMSG #esoteric :FreeFull, I am not sure < 1388184715 674836 :FreeFull!~freefull@defocus/sausage-lover PRIVMSG #esoteric :Taneb: Try it out, pipe it a file without a newline < 1388184719 964601 :AnotherTest!~turingcom@94-224-30-45.access.telenet.be QUIT :Ping timeout: 272 seconds < 1388184748 408089 :FreeFull!~freefull@defocus/sausage-lover PRIVMSG #esoteric :Taneb: You could also handle lowercase input < 1388184785 724458 :Taneb!~Taneb@runciman.hacksoc.org PRIVMSG #esoteric :Yeah, it fails if there isn't a newline < 1388184829 800348 :FreeFull!~freefull@defocus/sausage-lover PRIVMSG #esoteric :Well, you could try to fix that < 1388184949 96016 :Taneb!~Taneb@runciman.hacksoc.org PRIVMSG #esoteric :I don't know where to begin :( < 1388184980 286916 :Taneb!~Taneb@runciman.hacksoc.org PRIVMSG #esoteric :Yes I do < 1388185048 326724 :Taneb!~Taneb@runciman.hacksoc.org PRIVMSG #esoteric :It... sort of works now < 1388185057 924525 :Taneb!~Taneb@runciman.hacksoc.org PRIVMSG #esoteric :$ ./rna < bad < 1388185058 128142 :Taneb!~Taneb@runciman.hacksoc.org PRIVMSG #esoteric :UUU���� < 1388185067 12380 :Bike!~Glossina@71-214-86-192.ptld.qwest.net PRIVMSG #esoteric :perfect < 1388185093 427352 :pjotter!~pjotter@a80-101-119-171.adsl.xs4all.nl PART :#esoteric < 1388185105 203375 :quintopia!~quintopia@unaffiliated/quintopia PRIVMSG #esoteric :what's it supposed to do < 1388185116 480845 :Bike!~Glossina@71-214-86-192.ptld.qwest.net PRIVMSG #esoteric :replace t's with u's < 1388185127 929888 :Taneb!~Taneb@runciman.hacksoc.org PRIVMSG #esoteric :http://rosalind.info/problems/rna/ < 1388185133 327630 :quintopia!~quintopia@unaffiliated/quintopia PRIVMSG #esoteric :apparently < 1388185157 217914 :quintopia!~quintopia@unaffiliated/quintopia PRIVMSG #esoteric :it would be more useful if it replaced rna sequences with correctly folded sequences of amino acids! :P < 1388185174 693301 :Bike!~Glossina@71-214-86-192.ptld.qwest.net PRIVMSG #esoteric :there's a later one about turing rna into primary structure yes < 1388185179 119805 :Bike!~Glossina@71-214-86-192.ptld.qwest.net PRIVMSG #esoteric :turning* < 1388185207 197796 :Bike!~Glossina@71-214-86-192.ptld.qwest.net PRIVMSG #esoteric :i wonder if there's anything about regulatory networks and/or ribozyme kinda crapola < 1388185207 781797 :Taneb!~Taneb@runciman.hacksoc.org PRIVMSG #esoteric :quintopia, baby steps < 1388185227 927332 :Taneb!~Taneb@runciman.hacksoc.org PRIVMSG #esoteric :Anyway, the issue is that it can't tell if it's at eof until it's tried to read < 1388185236 864122 :Taneb!~Taneb@runciman.hacksoc.org PRIVMSG #esoteric :And it's reading in UTF32 < 1388185258 424815 :Taneb!~Taneb@runciman.hacksoc.org PRIVMSG #esoteric :So, it tries to read a character, gets nonsense 4 times < 1388185268 365976 :Bike!~Glossina@71-214-86-192.ptld.qwest.net PRIVMSG #esoteric :https://en.wikipedia.org/wiki/File:Pseudoknot.svg so easy < 1388185327 398974 :tswett!6b0598fd@gateway/web/freenode/ip.107.5.152.253 PRIVMSG #esoteric :In BNF, [] denotes something optional and {} denotes something repeated zero or more times, right? < 1388185343 436800 :Taneb!~Taneb@runciman.hacksoc.org PRIVMSG #esoteric :kmc, library documentation is lacking in places < 1388185346 120586 :Taneb!~Taneb@runciman.hacksoc.org PRIVMSG #esoteric ::( < 1388185355 152128 :Bike!~Glossina@71-214-86-192.ptld.qwest.net PRIVMSG #esoteric :'The general problem of predicting lowest free energy structures with pseudoknots has been shown to be NP-complete.[5][6]' sonova < 1388185418 231643 :Bike!~Glossina@71-214-86-192.ptld.qwest.net PRIVMSG #esoteric :i only know the reverse process, which you can do by dumping shit in bleacch < 1388185420 634622 :Bike!~Glossina@71-214-86-192.ptld.qwest.net PRIVMSG #esoteric :fuck you physics < 1388185492 260382 :quintopia!~quintopia@unaffiliated/quintopia PRIVMSG #esoteric :i like that this website has the same name as my grandmother < 1388185524 538287 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :your grandfather's name is wikipedia? < 1388185552 907590 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :oh, rosalind.info < 1388185553 106515 :Taneb!~Taneb@runciman.hacksoc.org PRIVMSG #esoteric :FreeFull, it works now :) < 1388185559 335747 :FreeFull!~freefull@defocus/sausage-lover PRIVMSG #esoteric :Yay < 1388185561 324044 :FreeFull!~freefull@defocus/sausage-lover PRIVMSG #esoteric :Can we see? < 1388185562 352548 :quintopia!~quintopia@unaffiliated/quintopia PRIVMSG #esoteric :i said nothing about my grandfather, plus you can't talk about him cuz he's still alive < 1388185590 47329 :Taneb!~Taneb@runciman.hacksoc.org PRIVMSG #esoteric :http://runciman.hacksoc.org/~taneb/rna.rs.txt < 1388185616 862044 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :oops < 1388185646 131352 :Taneb!~Taneb@runciman.hacksoc.org PRIVMSG #esoteric :I guess I accidentally duplicated the eof test < 1388185647 881081 :Bike!~Glossina@71-214-86-192.ptld.qwest.net PRIVMSG #esoteric :do you need that second branch/ < 1388185651 132925 :Bike!~Glossina@71-214-86-192.ptld.qwest.net PRIVMSG #esoteric :yea < 1388185659 329432 :Taneb!~Taneb@runciman.hacksoc.org PRIVMSG #esoteric :The first one should be removed < 1388185682 825038 :Taneb!~Taneb@runciman.hacksoc.org PRIVMSG #esoteric :Try now < 1388185686 646237 :Bike!~Glossina@71-214-86-192.ptld.qwest.net PRIVMSG #esoteric :eh, really? i'd remove the second < 1388185693 524982 :Bike!~Glossina@71-214-86-192.ptld.qwest.net PRIVMSG #esoteric :what happens on an empty file, for one < 1388185699 739367 :Taneb!~Taneb@runciman.hacksoc.org PRIVMSG #esoteric :Nah, because it needs to have read a character to tell if it's eof < 1388185702 660791 :Taneb!~Taneb@runciman.hacksoc.org PRIVMSG #esoteric :Rust is weird, man < 1388185709 51934 :Bike!~Glossina@71-214-86-192.ptld.qwest.net PRIVMSG #esoteric :that... what? < 1388185718 271440 :Bike!~Glossina@71-214-86-192.ptld.qwest.net PRIVMSG #esoteric :what happens on an empty file, then? < 1388185737 283489 :Taneb!~Taneb@runciman.hacksoc.org PRIVMSG #esoteric :http://static.rust-lang.org/doc/0.8/std/io/trait.Reader.html#fn.eof < 1388185741 65174 :Taneb!~Taneb@runciman.hacksoc.org PRIVMSG #esoteric :Bike, empty output < 1388185760 806847 :tswett!6b0598fd@gateway/web/freenode/ip.107.5.152.253 PRIVMSG #esoteric :http://esolangs.org/wiki/Gregor%27s_Answer – there, doesn't this spec suck. < 1388185785 215122 :Bike!~Glossina@71-214-86-192.ptld.qwest.net PRIVMSG #esoteric :...ah, hm. < 1388185794 803902 :Bike!~Glossina@71-214-86-192.ptld.qwest.net PRIVMSG #esoteric :seems more like an error checkk. weird. < 1388185810 842778 :tswett!6b0598fd@gateway/web/freenode/ip.107.5.152.253 PRIVMSG #esoteric :So, you can create objects, and send them messages, and such. < 1388185819 283285 :Bike!~Glossina@71-214-86-192.ptld.qwest.net PRIVMSG #esoteric :....whiiiiich is exactly how feof works. < 1388185841 242006 :tswett!6b0598fd@gateway/web/freenode/ip.107.5.152.253 PRIVMSG #esoteric :It would be nice if you could create an object representing a pair of two other objects. < 1388185871 346463 :Bike!~Glossina@71-214-86-192.ptld.qwest.net PRIVMSG #esoteric :shouldn't it just be the usual "object that understands fst and snd messages" shit < 1388185891 609820 :tswett!6b0598fd@gateway/web/freenode/ip.107.5.152.253 PRIVMSG #esoteric :Bike: thing is, each object only has one method. < 1388185920 681011 :Bike!~Glossina@71-214-86-192.ptld.qwest.net PRIVMSG #esoteric :eh, so branch on message content? < 1388185932 738089 :tswett!6b0598fd@gateway/web/freenode/ip.107.5.152.253 PRIVMSG #esoteric :There's no obvious way to branch. < 1388186001 758512 :quintopia!~quintopia@unaffiliated/quintopia PRIVMSG #esoteric :tswett: needs example program < 1388186087 313975 :Sgeo!~quassel@ool-44c2df0c.dyn.optonline.net JOIN :#esoteric < 1388186111 182035 :tswett!6b0598fd@gateway/web/freenode/ip.107.5.152.253 PRIVMSG #esoteric :x{hel low orl d} – sets x to an object that, when called, returns nothing. < 1388186126 289155 :tswett!6b0598fd@gateway/web/freenode/ip.107.5.152.253 PRIVMSG #esoteric :Slightly, slightly more interesting: < 1388186146 997168 :tswett!6b0598fd@gateway/web/freenode/ip.107.5.152.253 PRIVMSG #esoteric :x{@} – sets x to an object that, when called, returns its argument. < 1388186230 39151 :tswett!6b0598fd@gateway/web/freenode/ip.107.5.152.253 PRIVMSG #esoteric :Hm, here's an idea. < 1388186356 68875 :tswett!6b0598fd@gateway/web/freenode/ip.107.5.152.253 PRIVMSG #esoteric :a{ i{@} yix xi@ y } < 1388186365 48713 :tswett!6b0598fd@gateway/web/freenode/ip.107.5.152.253 PRIVMSG #esoteric :When called, returns whatever it returned the last time it was called. < 1388186401 40704 :tswett!6b0598fd@gateway/web/freenode/ip.107.5.152.253 PRIVMSG #esoteric :Yeah, that'll do it, if you just expand it a little bit: a{ i{@} ziy yix xi@ y }. Returns whatever it returned the penultimate time it was called. < 1388186442 550966 :tswett!6b0598fd@gateway/web/freenode/ip.107.5.152.253 PRIVMSG #esoteric :A two-element queue can certainly be used as an ordered pair. < 1388186490 247937 :tswett!6b0598fd@gateway/web/freenode/ip.107.5.152.253 PRIVMSG #esoteric :"True" and "false" can be implemented as objects that take one of these queues and return either its first or its second element. < 1388186790 953176 :Taneb!~Taneb@runciman.hacksoc.org PRIVMSG #esoteric :Next one < 1388186791 326155 :Taneb!~Taneb@runciman.hacksoc.org PRIVMSG #esoteric :http://runciman.hacksoc.org/~taneb/revc.rs.txt < 1388187180 297885 :Taneb!~Taneb@runciman.hacksoc.org PRIVMSG #esoteric :kmc, thoughts? < 1388187325 644086 :Bike!~Glossina@71-214-86-192.ptld.qwest.net PRIVMSG #esoteric :still think you could/should write general transduction < 1388187386 395538 :Taneb!~Taneb@runciman.hacksoc.org PRIVMSG #esoteric :Bike, baby steps < 1388187415 215438 :Bike!~Glossina@71-214-86-192.ptld.qwest.net PRIVMSG #esoteric :you've practically done it anyway < 1388187574 564569 :Phantom_Hoover!~Phantom@unaffiliated/phantom-hoover JOIN :#esoteric < 1388187735 540850 :oerjan!oerjan@sprocket.nvg.ntnu.no QUIT :Quit: Nite < 1388187908 458724 :Bike!~Glossina@71-214-86-192.ptld.qwest.net PRIVMSG #esoteric :http://joelgrus.com/2013/12/24/why-programming-language-x-is-unambiguously-better-than-programming-language-y/ more like loglan than klingon < 1388188181 208062 :Bike!~Glossina@71-214-86-192.ptld.qwest.net PRIVMSG #esoteric :Fiora: http://www.opticsinfobase.org/ao/abstract.cfm?uri=ao-52-27-6735 this looks coolio < 1388188243 527084 :Bike!~Glossina@71-214-86-192.ptld.qwest.net PRIVMSG #esoteric :supposedly 'outperforms' jpeg < 1388188250 832148 :Bike!~Glossina@71-214-86-192.ptld.qwest.net PRIVMSG #esoteric :whatever that means < 1388188385 18340 :Gregor!dlopen@libdl.so PRIVMSG #esoteric :JPEG-2000 outperforms JPEG. Still nobody gives a shit. < 1388188451 980852 :kmc!~keegan@ec2-50-17-127-187.compute-1.amazonaws.com PRIVMSG #esoteric :did you know that JPEG supports arithmetic coding but nobody uses it because \rainbow{PATENTS} < 1388188510 622 :Gregor!dlopen@libdl.so PRIVMSG #esoteric :yaaaaay < 1388188512 528068 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :rainbow patents :'( < 1388188517 282293 :shachaf!~shachaf@unaffiliated/shachaf PRIVMSG #esoteric :next they'll patent hugs and kittens < 1388188547 396252 :quintopia!~quintopia@unaffiliated/quintopia PRIVMSG #esoteric :shachaf: i already did. super hard to enforce tho. < 1388188569 795135 :fizzie!fis@unaffiliated/fizzie PRIVMSG #esoteric :Rainbow patents, are they like a space-efficient way of patenting huge areas of patentable things? < 1388188660 550555 :fizzie!fis@unaffiliated/fizzie PRIVMSG #esoteric :Like a four-gig rainbow patent can cover all possible software patents up to 32 pages long and so on. < 1388188696 562793 :tswett!6b0598fd@gateway/web/freenode/ip.107.5.152.253 PRIVMSG #esoteric :We claim: 1. A method whereby a process is applied in a circumstance, the process having been chosen with regard to the circumstance so as to achieve a result possessing some quality. < 1388188698 751390 :quintopia!~quintopia@unaffiliated/quintopia PRIVMSG #esoteric :i feel like there's already a form for that at the patent office < 1388188710 969993 :tswett!6b0598fd@gateway/web/freenode/ip.107.5.152.253 PRIVMSG #esoteric :2. The method of claim 1, where the quality is a desirable quality. < 1388188738 481425 :tswett!6b0598fd@gateway/web/freenode/ip.107.5.152.253 PRIVMSG #esoteric :3. The method of claim 3, where the circumstance is the desirability of an object. < 1388188752 726458 :tswett!6b0598fd@gateway/web/freenode/ip.107.5.152.253 PRIVMSG #esoteric :4. The method of claim 3, where the process creates the desired object. < 1388188760 245811 :quintopia!~quintopia@unaffiliated/quintopia PRIVMSG #esoteric :did claim 3 just refer to itself < 1388188762 440912 :tswett!6b0598fd@gateway/web/freenode/ip.107.5.152.253 PRIVMSG #esoteric :Uh, claim 3 should refer to claim 1, not claim 3. < 1388188788 237261 :tswett!6b0598fd@gateway/web/freenode/ip.107.5.152.253 PRIVMSG #esoteric :5. The method of claim 1, where the process is chosen because of its similarity to another process.