00:23:54 -!- MindlessDrone has quit (Quit: MindlessDrone). 00:26:30 -!- yorick has quit (Remote host closed the connection). 00:39:10 -!- w00tles has quit (Quit: quit). 00:45:57 -!- tromp_ has quit (Read error: Connection reset by peer). 00:46:28 -!- tromp_ has joined. 00:47:02 -!- olsner has joined. 00:52:35 -!- olsner has quit (Ping timeout: 252 seconds). 01:00:55 meanwhile in r/bitcoin http://mibpaste.com/uXYrCS 01:02:02 http://superuser.com/questions/693440/why-does-an-exe-file-not-appear-as-ones-and-zeros-in-a-text-editor-such-as-notep 01:02:24 the top answer's going to be sensible, isn't it 01:02:59 yep 01:03:46 imo too sensible 01:04:02 These answers are very long. / The simple answer is: Notepad tries to see the 0s and 1s as text, which is its job. It doesn't realize they are not text and just displays what it can, which is a big jumble of letters that make no sense. 01:04:12 nice painting. 01:04:14 ^ that's probably enough 01:04:26 1s, 0s, and whitespace 01:04:34 most of all it did not need an arthur dove painting to bring the point across 01:04:50 yeah it did 01:04:56 I was hoping there'd be a plausible-looking answer that's completely wrong near the top 01:05:06 but it's superuser, not yahoo! answers 01:05:15 anyway there is some nonexciting esolanging happening http://esolangs.org/wiki/Gs2#Commands "wip" 01:05:22 I saw that in recent changes 01:05:34 the from/to columns are uh halfway between forth stack diagram things and type signatures 01:05:41 http://mushroomobserver.org/image/show_image/393975?_js=on&_new=true&obs=156302&q=1hq7D weird-ass mutant mushroom, via douglass_ 01:05:47 i should've maybe figured out which one i wanna use 01:06:09 kmc: nice fronds babe 01:06:13 :3 01:06:14 what the hell are those 01:09:44 one time i tried to download a .exe file from some strange server but instead of 0s and 1s it had 0s and 2s 01:10:02 almost broke my computer. F- would not download again 01:10:07 futurama joke 01:10:15 help 01:10:31 futumura joke?? 01:10:42 where 01:11:06 -!- tromp__ has joined. 01:11:31 my file had p's and q's 01:11:33 http://tech.karbassi.com/2008/01/15/futurama-benders-big-score-binary-joke/ ?? 01:11:42 "Now, if you take the whole thing by itself, it’s not a 16-bit code, but 32-bit. I believe IBM made a few super computers that handle 32-bit binary." 01:11:47 super 01:12:56 -!- tromp_ has quit (Ping timeout: 252 seconds). 01:17:02 shachaf: I like sentences like "I believe IBM made a few super computers that handle 32-bit binary." because they're true, and yet make the speaker sound horrifically uninformed 01:21:40 -!- oerjan has quit (Quit: Knyte). 01:40:04 ais523: Do you have a collection of them? 01:40:13 no 01:49:00 Do you know about iNES mapper 90? It has many strange things that don't make sense, such as: bit reversed mode for PRG bank numbers, the ability to change $6000-$7FFF between open bus and ROM (not RAM), two different ways to set nametable mirroring (which one is used is both software-controlled and controlled by a jumper), IRQ "funky mode", ability to set direction of IRQ counter. 01:49:19 tell me more about the funk. 01:49:59 -!- Sprocklem has joined. 01:50:15 is the jumper user-accessible on the cart? 01:50:20 also what is nametable mirroring? 01:52:15 Nametable mirroring in the Famicom is used to determine how the CIRAM is mirrored, which changes the arrangement of the four background screens; for example, if the right screen and left screen are the same, or if the top screen and bottom screen are the same instead. However there are more complicated kinds two, these are just the two simple kinds of nametable mirroring. 01:52:53 I don't know if the jumper is user-accessible. I also don't know how the "funky mode" works. 02:04:33 `unidecode Ɛ 02:04:35 ​[U+0190 LATIN CAPITAL LETTER OPEN E] 02:14:27 -!- Bike has quit (Ping timeout: 272 seconds). 02:16:05 -!- Sorella has quit (Remote host closed the connection). 02:16:18 -!- Bike has joined. 02:37:49 -!- Sprocklem has quit (Ping timeout: 252 seconds). 03:07:55 -!- ^v has quit (Quit: http://i.imgur.com/MHuW96t.gif). 03:15:39 -!- conehead has joined. 03:34:36 -!- nooodl has quit (Quit: Ik ga weg). 03:40:02 I am in progress typing of Dungeons&Dragons game. I did play the game yesterday, in fact. But now there is a problem, but I do have a plan. 04:11:34 that... 04:11:54 What about that? 04:12:06 I'm trying to parse the first sentence 04:24:54 zzo38 Teaches Typing 04:28:24 -!- pikhq_ has joined. 04:29:23 -!- pikhq has quit (Ping timeout: 240 seconds). 04:43:25 -!- carado has quit (Ping timeout: 246 seconds). 04:48:01 -!- mauke has quit (Disconnected by services). 04:48:11 -!- mauke has joined. 04:50:04 -!- preflex has quit (Ping timeout: 246 seconds). 04:50:40 -!- tromp__ has quit (Remote host closed the connection). 04:51:32 -!- preflex has joined. 05:08:35 :( at unmarked cabs 05:08:58 Unlike chess, planning ahead is much more difficult because of unknown information, but is just as important! 05:09:27 But, like in correspondence chess, there is enough time between sessions to think of it. 05:09:30 zzo38: how many non-attacking bishops can you place on a chessboard? 05:10:17 * Sgeo assumes the answer is greater than -1 05:10:29 quintopia: Do you mean like the queen puzzle, but only with diagonal moves? 05:10:40 yes 05:10:47 I don't know. 05:11:14 -!- conehead has quit (Quit: Computer has gone to sleep.). 05:11:42 You could make the split between the dark squares and light squares, so I would think the answer would be some even number. 05:12:07 it is an even number :D 05:12:29 Sgeo: what about unmarked cabs 05:12:30 OK, I got that much correct! 05:12:36 also, you can fill an entire rank or file safely, so it's more than 8! 05:12:44 quintopia: no it's not 05:12:48 there are only 64 squares on a chessborad 05:12:49 (in fact, that's a good path to a solution) 05:12:51 *chessboard 05:12:53 kmc: cab company I was unfamiliar with sent a cab that was not obviously a cab 05:12:55 and 64 <<<<<< 8! 05:13:04 Made me nervous so called company to check that it was in fact my cab 05:13:14 coppro: hmm good point. 05:13:27 also, you can fill an entire rank or file safely, so it's more than 8!/7! 05:13:55 Also, unrelated to it being unmarked, the driver had me input the address into the GPS. If I were tech-illiterate, that would have really sucked 05:14:26 Yes I realized that too, although I just instead to consider only the dark squares, and then the same solution can be mirrored for white-colored squares. 05:14:27 quintopia: is it 14? 05:14:28 Sgeo: what a shit taxi company 05:14:47 Not helpful: Driver not speaking English, so GPS was also in another language 05:14:48 coppro: good jerb 05:14:53 Sgeo: was it numbered 1729 05:15:13 Sgeo: that's a bad omen 05:15:31 coppro: don't ask me to prove it, but i can see why it's intuitively optimal 05:15:52 quithe proof is easy 05:16:00 *quintopia: the 05:16:35 each color has 7 diagonals parallel to its main diagonal, so max 7 of each color 05:16:37 coppro: is it? not every bishop attacks the same number of squares 05:16:41 Also, ended up waiting over an hour for a bus because the bus I wanted was 10 minutes early 05:16:48 Sgeo: I hate that 05:16:58 perhaps the bus was on time and the world was 10 minutes late 05:17:21 I like trains. Trains don't show up so early you miss them 05:17:39 Train stations also have nice billboards indicating when the train is late 05:18:08 trains might show up early in rare circumstances. But they don't leave early 05:18:22 unlike busses, have of whom don't know what a timepoint is 05:18:31 (their drivers don't know either) 05:18:32 *storms into cab with knife* drive this train to cuba! 05:18:40 coppro: ah, so it does. i didn't know off the top of my head the number of diagonals of one color in one direction 05:19:29 I looked 05:19:34 cheating, I know 05:19:44 Sgeo: http://instagram.com/p/gWkKveSLwH/ 05:20:13 Nowhen in particular too 05:25:22 -!- tromp_ has joined. 05:34:46 zzo38: http://jerkcity.com/_jerkcity5444.html 05:36:29 kmc: Why does the filename start with an underscore? 05:36:43 that is a fine question 05:36:47 compare & contrast with http://jerkcity.com/jerkcity5444.html 05:36:56 this is the web, it's a /resource/, not a file 05:37:25 O, that's what it means! 05:46:44 http://i.imgur.com/9skH9Qc.png 05:46:57 zzo38: pretty sure Bike was making a sarcastic comment about web development 05:47:29 kmc: ain't that the truth 05:48:26 Bike: can you figure out why i was searching for Oryza ruderalis? 05:54:43 -!- tromp_ has quit (Ping timeout: 252 seconds). 06:00:33 -!- glogbackup has quit (Remote host closed the connection). 06:00:33 -!- Frooxius has quit (Ping timeout: 272 seconds). 06:04:22 -!- nisstyre has quit (Ping timeout: 272 seconds). 06:09:29 -!- nisstyre has joined. 06:40:11 -!- copumpkin has quit (Ping timeout: 252 seconds). 06:42:22 `danddreclist 47 06:42:26 danddreclist 47: shachaf nooodl boily \ http://zzo38computer.org/dnd/recording/level20.tex 06:44:37 There it is! 06:46:38 I did think of the plan what to do next, although I think I will require someone to enchant an object with a spell to recall it to someone's hand if they speak the command word. 06:47:33 (It doesn't matter what the object is, as long as it can support things sitting on top.) 06:48:21 I did think of other ways not involving magical things, but they either involve combination locks, which they don't have, or otherwise will be too slow. 07:12:04 -!- augur has quit (Read error: Connection reset by peer). 07:12:31 -!- augur has joined. 07:18:21 -!- Frooxius has joined. 07:19:17 -!- w00tles has joined. 07:35:52 -!- Bike_ has joined. 07:38:00 -!- copumpkin has joined. 07:42:42 -!- Bike has quit (*.net *.split). 07:42:42 -!- realzies has quit (*.net *.split). 07:42:43 -!- iamcal has quit (*.net *.split). 07:46:00 -!- sebbu has quit (Ping timeout: 240 seconds). 07:49:33 -!- realzies has joined. 07:49:40 -!- w00tles has quit (Quit: quit). 07:56:55 -!- w00tles has joined. 08:05:38 -!- iamcal has joined. 08:23:31 -!- ais523 has quit. 08:27:08 -!- w00tles has quit (Quit: quit). 08:30:15 -!- w00tles has joined. 08:38:20 -!- zzo38 has quit (Remote host closed the connection). 08:42:59 -!- forzartus has joined. 08:44:06 -!- forzartus has left. 09:16:14 https://en.wikipedia.org/wiki/Diameter#Diameter_symbol literally has detailed instructions on which keys to press in order to enter the wrong codepoint 09:21:55 hah 09:26:32 -!- w00tles has quit (Quit: quit). 09:26:55 -!- w00tles has joined. 09:27:02 -!- w00tles has quit (Max SendQ exceeded). 09:27:45 -!- w00tles has joined. 09:31:29 -!- ter2 has joined. 09:35:05 -!- tertu has quit (Ping timeout: 252 seconds). 09:36:07 -!- oerjan has joined. 09:42:46 -!- sebbu has joined. 09:43:24 -!- sebbu has quit (Changing host). 09:43:24 -!- sebbu has joined. 09:45:32 -!- ter2 has quit (Ping timeout: 252 seconds). 09:48:54 shachaf: On linux, altgr + o will give you ø, which is the letter rather than the diameter symbol 09:51:46 -!- AnotherTest has joined. 09:52:24 Codepoints don't really exist, only glyphs. (Some of the emoji glyphs are almost in the flesh.) 10:20:54 zzo38: how many non-attacking bishops can you place on a chessboard? <-- obvious upper bound, check. simple way of achieving it, check. 10:20:58 (mate) 10:21:23 ok, once you've split white and black squares. 10:23:42 Sorry, but your reply is a bit stale. 10:25:06 well i had to reply before getting to the spoilers, OBVIOYSLY 10:25:30 (obvious to boily) 10:53:20 -!- nooodl has joined. 10:55:13 oerjan: huh? that doesn't have an obvious upper bound 10:55:21 oerjan: not a sharp one at least 10:55:28 the upper bound is really non-obvious 10:55:48 the lower bound is, mind you 10:55:48 no it's not, once you count the diagonals 10:56:15 (unlike the rook and queen versions, which do have obvious sharp upper bounds) 10:57:21 each color has 7 diagonals parallel to its main diagonal, so max 7 of each color 10:57:38 i thought of the same thing before reading it 10:58:47 It depends on the size of the chessboard 10:59:07 Let me look up a standard sized one 10:59:25 Hmm, standard is 8*8 11:00:04 You can place at least 14 non-attacking bishops 11:00:34 I don't know if you can place more 11:00:47 no you can't 11:02:04 You can fill up one side and then almost fill up the opposite side except for the corners 11:02:24 you can place 14 such that there is precisely one on each downwards white diagonal and one on each upwards black diagonal. 11:03:04 e.g. in the way you said (which is also the way i found) 11:04:24 Technically, you could just completely fill the chessboard with white bishops 11:04:38 Since they are the same colour, they won't attack each other 11:05:07 I don't think that's what was meant though 11:05:46 you don't say 11:06:35 Assuming all bishops can attach each other, 14 11:07:08 -!- impomatic has joined. 11:09:09 bishops are scheming bastards 11:09:23 attack 11:10:07 -!- Sorella has joined. 11:10:37 perhaps bishops of the same color _can_ attack each other, and that's why they're safely kept on different colors. 11:10:47 -!- Sorella has quit (Changing host). 11:10:47 -!- Sorella has joined. 11:11:35 -!- MindlessDrone has joined. 11:11:43 it all makes sense now. 11:14:30 i think i've managed my first negative karma reddit comment. or alternatively, somehow managed to avoid any before now. 11:16:09 Can you link to it? 11:16:34 i somehow feel that would be vote cheating :P 11:16:41 (it's only at -1 though) 11:18:36 I just want to see what it is 11:19:25 what is it oerjan?? 11:19:44 http://www.reddit.com/r/math/comments/1tpxxk/my_math_teacher_posted_this_i_need_your_help_guys/ceaenhx?context=3 11:20:52 " Hmm, standard is 8*8" you don't know chess? 11:21:12 `? freefull 11:21:16 FreeFull is either full of freedom or free of fulldom, we are not sure. 11:21:27 no room for chess 11:21:52 okay 11:21:54 i understand 11:23:00 oerjan: I can think of cases where the correct answer wouldn't be 0%, but the case on the board isn't one of those 11:23:37 i don't actually know where the karma thingie is shown 11:23:41 (nor what it is) 11:26:17 oklopol: just after the nickname 11:26:28 (also you bastards upvoted it :P) 11:27:31 =P 11:31:38 i suppose the ui doesn't use the term karma anywhere. 11:32:18 actually it's (mostly) translated to norwegian so i wouldn't really know. 11:32:52 What do you guys think of the Lamdu programmming language thing that was on reddit the other day 11:33:45 i got this "not real haskell" reaction 11:34:13 oerjan, a lot of things aren't real haskell 11:35:25 But I know what you mean 11:37:34 I am pondering making my caps lock into greek shift 11:37:56 Oooh, that sounds like a good idea 11:38:08 And then shift+capslock can be capslock 11:38:20 Or cyrillic 11:38:27 Or maybe make capslock be shiftlock, and then shift+capslock be greek shift 11:38:46 If I really want to write cyrillic I'll switch keyboard layouts 11:43:51 I think I just heard thunder 11:44:37 I want that Mandelbrot Blanket :-) 11:57:50 you want shift+capslock to be capital greek letters surely 12:04:27 -!- hogeyui_ has quit (Ping timeout: 260 seconds). 12:21:37 -!- hogeyui_ has joined. 12:44:27 -!- oerjan has quit (Quit: leaving). 12:47:09 -!- hogeyui_ has quit (Ping timeout: 272 seconds). 12:55:30 -!- Sgeo has quit (Read error: Connection reset by peer). 13:00:04 -!- zzo38 has joined. 13:04:39 -!- hogeyui_ has joined. 13:06:18 Phantom_Hoover: If I want capitals I'll use shift when pressing the key 13:06:28 greek shift is a toggle I think 13:06:41 Maybe it's greek lock 13:06:44 I'd have to look it up 13:12:11 Hey, there is a new Mill Achitecture lecture video 13:18:53 -!- tromp_ has joined. 13:19:29 -!- hogeyui_ has quit (Ping timeout: 246 seconds). 13:30:26 -!- tromp_ has quit (Remote host closed the connection). 13:32:56 -!- tromp_ has joined. 13:33:32 -!- tromp_ has quit (Remote host closed the connection). 13:39:33 -!- olsner has joined. 13:39:43 -!- Phantom_Hoover has quit (Ping timeout: 260 seconds). 13:40:49 -!- hogeyui_ has joined. 13:49:44 -!- hogeyui_ has quit (Ping timeout: 252 seconds). 13:50:21 -!- boily has joined. 13:51:36 Do you like this kind of shogi variant? http://www.chessvariants.org/index/msdisplay.php?itemid=MSunknownoffpiec 13:53:13 good zzorning38. I never variated my shōgi yet. 13:53:43 -!- boily has quit (Client Quit). 13:55:23 -!- boily has joined. 13:55:29 -!- metasepia has joined. 13:55:41 -!- Phantom_Hoover has joined. 13:57:18 Hello 13:57:49 now, let's see if I barged in an ongoing conversation by correctly checking the logs... 14:05:39 -!- tromp_ has joined. 14:07:26 -!- carado has joined. 14:07:51 hily 14:10:01 hintopia! 14:10:14 -!- yorick has joined. 14:10:23 Hoity-boily. 14:10:31 ... hoity-boily??? 14:11:13 bon matizzie. 14:11:37 It's like hoity-toity, but boilier. 14:11:38 i tried Bon Martin on a south african guy named...yeah 14:11:43 he didn't get it 14:14:00 fizzie: tmyk... 14:14:16 quintopia: 'tis a sad world where Martinses can't be bon martined... 14:17:32 he said that bon means sight in bantu languages, but can also be used as a greeting 14:17:40 -!- hogeyui_ has joined. 14:23:03 -!- hogeyui_ has quit (Ping timeout: 272 seconds). 14:25:14 -!- yours_truly has joined. 14:25:31 -!- ter2 has joined. 14:25:57 -!- nisstyre has quit (Ping timeout: 272 seconds). 14:26:31 `relcome yours_truly 14:26:34 ​yours_truly: Welcome to the international hub for esoteric programming language design and deployment! For more information, check out our wiki: . (For the other kind of esoterica, try #esoteric on irc.dal.net.) 14:37:55 -!- tromp_ has quit (Ping timeout: 245 seconds). 14:43:11 -!- olsner has quit (Ping timeout: 260 seconds). 14:45:41 -!- hogeyui_ has joined. 14:50:58 -!- w00tles has quit (Ping timeout: 245 seconds). 14:51:35 -!- Phantom_Hoover has quit (Ping timeout: 260 seconds). 15:10:38 -!- hogeyui_ has quit (Ping timeout: 240 seconds). 15:20:25 Vorpal: http://www.chron.com/news/houston-texas/article/Guinness-certifies-world-s-largest-gingerbread-5028028.php is what I saw. <-- impressive, but not pure gingerbread... 15:20:35 I feel using wood is cheating 15:26:18 Yes, I think so too. 15:34:31 -!- hogeyui_ has joined. 15:35:35 fizzie, I wonder what the largest "real" gingerbread house actually is 15:36:19 -!- tromp_ has joined. 15:37:43 Well this is interesting, turning on compositing in the window manager setting improved window moving performance a lot 15:37:56 However, now resizing windows lags terribly 15:37:58 -_- 15:38:20 compositing still exists? 15:38:27 boily, guess so? 15:38:33 As opoosed to what? 15:38:48 I'm using MATE btw, so this is a metacity fork 15:38:54 as opposed to I thought it was a fad, and people got tired of all the wobbly windowing stuff. 15:39:28 boily, yeah, I wish I could turn off the drop shadows... 15:39:46 Can't find a setting for it 15:40:06 SteamOS has a xcompmgr-based compositor, or so I've heard. 15:40:12 Heh 15:42:23 Gunnerkrigg Court is getting creepy 15:42:31 That is a web comic right? 15:42:42 Yes 15:43:22 Hm, which custom android firmware to use... I would like to update from my old version of PAC (4.1.2) to something 4.3-based or such. Or at least 4.2. 15:44:15 omnirom? 15:46:10 Maybe a new PAC? 15:46:39 I see you're a PAC man. 15:46:55 fizzie, quite, the full name of the rom is actually PACman ROM 15:47:07 so that was not as funny as you thought :P 15:47:11 Aw. 15:47:31 fizzie, it is so called because it is a mix of Paranoid Android, AKOP and CyanogenMod 15:47:34 thus PAC 15:47:41 (Does Pac-Man have a driver's license that says "Man, Pac" on it?) 15:49:07 I wish I could cyanogenise my phone. it isn't supported :( 15:49:53 Oh god, using a third party custom kernel with the latest PAC doesn't work apparently. Screw that then 15:50:10 I might just stay on 4.1.2 instead... Since everything pretty much works as it is. 15:50:42 Do custom Android systems include a command-shell and the ability to modify the permissions of installed programs (rather than only to view them)? 15:51:16 zzo38, you can do that with xprivacy (an xposed framework module) on pretty much any non-MIUI system 15:51:50 What does MIUI mean? 15:52:10 IIRC that is the stock motorola GUI framework thingy 15:52:24 Or wait hm, no 15:52:58 Well it is the stock GUI that some phone manufacturer added anyway, forgot which one 15:53:12 Samsung has touchwiz, HTC has Sense. It is along those lines 15:54:46 zzo38, anyway, xposed framework is awesome, it basically allows runtime patching the entire system, by hooking into early startup code and basically loading a module into every dalvik (the android java vm) process. 15:57:01 -!- Bike_ has changed nick to Bike. 16:00:24 boily, what phone is that? 16:00:43 Recurring annoyance: when booted to Windows, the two (spinning-disk) Linux drives keep getting woken up, even when set "offline" in disk management. Both when anything "special" is happening (Windows Update is checking for updates, Steam wants to install DirectX for the billionth time) but also more or less randomly a few times every day. 16:01:11 Hm 16:01:28 that is a bit weird 16:01:45 Oh, and is also spins up the disks when told to shut down or go to sleep. 16:01:50 Ouch 16:01:55 (Then it immediately spins them down again, naturally.) 16:02:08 fizzie, maybe it is checking SMART status wrt the random stuff? 16:02:21 Vorpal: HTC One V. 16:02:27 I had smartmontools on linux spin up the windows disk 16:02:31 boily, hm okay, no idea 16:02:39 (meanwhile, I'm compiling QT, and contributing to Climate Change...) 16:02:47 Hah 16:02:54 boily, gentoo? 16:03:28 Also you should totally buy some solar panels to offset your QT compiling 16:03:30 Vorpal: nah. stuck with wkhtmltopdf, and it won't output headers and footers if you don't use a custom version of QT. 16:03:50 what is wkhtmltopdf? 16:04:18 a very obscure utility that converts html files over to PDF. it's used by the new reporting engine in OpenERP. 16:04:39 (imho, a very, very stupid move, marginally better than what they had before.) 16:04:42 Never heard of OpenERP 16:04:47 Why not use CUPS to print to PDF... 16:04:53 From a browser 16:05:15 woah, woah! stop being logical! we're talking about Enterprise stuff here! 16:05:20 Oh okay 16:05:23 "wk" is presumably short for webkit? 16:05:28 fizzie: it is. 16:05:30 Vorpal: Oh, I also had the GTK save/open dialog annoyingly spin up the Windows disk in Linux, but now that it's a SSD I don't mind so much. 16:05:47 fizzie, Ah, use SSDs for EVERYTHING 16:06:01 I don't want to pay for 2*3 terabytes of SSD, really. 16:06:35 Hm I wonder what an 1 TB SSD costs 16:06:53 Holy shit 16:07:05 53758 for a PCI Express SSD 16:07:19 8527 for the cheapest 1 TB SATA SSD 16:07:28 are those in CAD? 16:07:36 SEK, I hope. 16:07:40 -!- tromp_ has quit (Ping timeout: 246 seconds). 16:08:09 SEK yes 16:08:31 ~eval 8527 / 6.0819 16:08:33 Error (1): 16:08:35 ~eval 8527 / 6.0819 16:08:36 576.90 EUR (about 5200 SEK) for the cheapest 1TB SATA SSD (Samsung 840 EVO 1 TB 2.5" SATA3 Basic Retail) at the Finnish verkkokauppa.com shop. 16:08:37 1402.0289712096549 16:09:01 Hm the SSD in my work computer (Intel 520, 240 GB) costs 2075 16:09:29 But we are upgrading to Intel 520 with 480 GB storage soon, which cost 3683 16:09:46 -!- carado has quit (Ping timeout: 246 seconds). 16:09:50 I've seen some random guides on how to really disable a disk in Windows, but they all involved all kinds of nasty "uninstall drivers" kind of nonsense, and the one that seemed marginally less invasive didn't do anything. 16:10:54 I can only find PCI Express SSDs above 2 TB 16:10:57 no SATA onezsx 16:11:00 ones* 16:11:38 And a lot of the stuff are for people who actually want to keep their drive usable from Windows; I just want those completely turned off. 16:12:00 fizzie, you could unplug them? 16:12:31 That would involve opening the computer for every single OS switch. 16:12:49 Some kind of a front-panel power switch could work, if someone makes that kind of thing. 16:12:51 Install a hardware switch then. 16:12:51 Heh, Toshiba has a 1.6 TB SSD for around 50 000. SATA 16:13:10 fizzie, doubt it for SATA 16:13:15 custom drivers? 16:13:25 You could write custom chipset drivers for windows 16:13:34 That hid those disks 16:13:49 There was something you could do somewhat easily in device management to hide the disks, but then it doesn't ever spin them down either. 16:14:02 Well okay 16:15:17 I'm trying to figure out the point of Google Cloud Print... Can't find any 16:15:20 I think I saw some rather kludgly-looking batch file for a "programmatically spin down, then hide the disk" thing somewhere, though. 16:18:06 Would anyone here be interested in entering a Core War tournament? Also, if the tournament is held in Cambridge either in or near the computer museum, would anyone attend? 16:18:44 Huh, turning on compositing made full screen flash video work again??? 16:20:04 I like Flash. it has the loveliest, weirdestest bugs I ever seen. 16:22:35 boily, yes previously it was sluggish when playing full screen 16:29:47 -!- carado has joined. 16:31:34 caradhello. 16:41:50 -!- w00tles has joined. 16:42:00 -!- w00tles has quit (Max SendQ exceeded). 16:42:42 -!- w00tles has joined. 16:58:20 -!- Bike has quit (Ping timeout: 245 seconds). 17:00:20 -!- Bike has joined. 17:04:47 -!- tromp_ has joined. 17:09:01 -!- tromp_ has quit (Ping timeout: 252 seconds). 17:09:37 -!- Bike has quit (Ping timeout: 246 seconds). 17:11:41 -!- Bike has joined. 17:15:57 -!- olsner has joined. 17:16:29 -!- ter2 has changed nick to tertu. 17:17:28 hi Taneb 17:17:31 hi tertu 17:17:45 hey 17:18:01 what you been working on 17:18:51 Hi quintopia 17:19:22 hows life Taneb 17:19:31 Boring 17:19:52 I'm not too fond of the 5 days between Christmas and New Year's Eve 17:20:02 And I miss being at university 17:20:14 I've been playing Minecraft more than usual lately 17:20:48 programmed anything lately 17:20:56 Not anything interesting 17:21:03 I've been trying to learn Agda again 17:21:07 But it hasn't gone well 17:21:39 how do you go about learning a new lang 17:22:01 I don't know 17:22:11 I'm not very good at learning new things 17:22:50 I've been meaning to learn Rust, too 17:22:51 but you've learned things in the past. how? 17:23:18 Well, with Haskell, I started by following LYAH while messing with it in GHCi 17:23:55 Once I thought I was getting better, I started posting some code I had written in this channel and letting elliott, oerjan, and shachaf shout at me 17:24:03 And now I feel pretty good at Haskell 17:24:12 Having learnt from their criticisms 17:24:47 guess you can't do that with agda, there being no one here versed enough in it to shout at you 17:25:03 I think letting yourself mess around, but letting others help you make your mess neater really helps you to learn 17:25:20 why do you want to know agda? 17:25:30 I don't know 17:25:51 I don't even know what to do with Agda 17:26:10 that's a good enough reason. 17:26:12 well that might be your problem. if you don't know why you want to do it, you probably won't be very motivated to do it 17:26:23 Today I used to maybe prove that disjunction and conjunction formed a semiring 17:26:28 But then I don't know how it proved that 17:26:32 Or how I can use that proof 17:29:37 -!- Bike has quit (Ping timeout: 272 seconds). 17:31:09 -!- Bike has joined. 17:33:29 -!- olsner has quit (Quit: Leaving). 17:36:03 -!- MindlessDrone has quit (Ping timeout: 246 seconds). 17:39:35 -!- Bike has quit (Ping timeout: 260 seconds). 17:41:31 -!- Bike has joined. 17:42:45 good morning #esoteric 17:43:09 @localtime kmc 17:43:09 Local time for kmc is Fri Dec 27 09:43:09 2013 17:43:21 i'm actually 1 hour ahead of there right now 17:43:22 good fternoon, kmc. 17:43:28 but i don't update the clock on my vps when i travel 17:43:37 Mountain Time? 17:43:43 ja 17:44:06 yesterday went for a drive here: http://en.wikipedia.org/wiki/File:CONM_Independence_monument_2.jpg 17:44:08 -!- ^v has joined. 17:44:44 Hello, all 17:44:46 -!- skrillex64 has joined. 17:46:11 kmc: that looks like a nice place. 17:47:49 64::: hey :::64 17:47:49 Taneb: suffering from universital cravings? 17:47:59 `relcome skrillex64 17:48:01 ​skrillex64: Welcome to the international hub for esoteric programming language design and deployment! For more information, check out our wiki: . (For the other kind of esoterica, try #esoteric on irc.dal.net.) 17:48:29 boily, I'm just suffering right now 17:49:44 boily: yep 17:49:46 * skrillex64 ( : m[T]x :ï: Closing Script ( ºêÒºÒÂ..ä»áÅéǹêÒÒ... ) :ï: sCript : ) 17:50:20 I am installing Rust 90 miles away 17:50:21 -!- skrillex64 has quit. 17:50:54 This would be easier if I knew how to use Arch 17:51:00 what the technicolor fungot was that... 17:51:01 boily: same url as before for new jar up yet?) publically acessible) later i tried clisp ( interpreted) chicken scripts, is there any haskell builtin to test whether one number is within the scope of python, i do 17:51:10 `run echo 'ºêÒºÒÂ..ä»áÅéǹêÒÒ...' | iconv -t iso8859-1 | iconv -f tis-620 17:51:12 ​บ๊ายบาย..ไปแล้วน๊าา... 17:51:30 kmc: and how in fungot did you manage to guess it was tis-620... 17:51:30 boily: not at all, since there are 3 syntax for integer literals. the semantics are like scheme, but that's an unfair generalization 17:51:38 boily: chardet 17:51:45 "Goodbye to N๊aa ... .." 17:51:47 Taneb: Arch, as in the VCS, or as in the distro? 17:51:52 The distro 17:52:03 i was like "that can't be right" and then saw the .th hostname in the quit msg 17:52:08 -!- MindlessDrone has joined. 17:52:16 It would probably be much easier if I knew pacman (the package manager, not the game or the character) 17:52:25 kmc: oh hm. I obviously failed my spot check there... 17:52:39 Where is .th? 17:52:46 thai land 17:52:51 Aaaaah 17:52:52 Taneb: well. pacman -Syu to make your system up-to-date, pacman -S for installing stuff. 17:52:53 .hth 17:53:00 boily, I'm not a sudo-er 17:53:23 I don't have sudo installed on my machine. I just “su”, then do the Stuff that has to be Done. 17:53:25 Is there a way I could do it locally or something like that 17:54:03 Frankly I'm glad I'm not a sudo-er, I could probably set the machine on fire 17:54:10 By accident 17:54:26 eeeeeh... yes. the answer is most definitely yes, but I don't know how. I suspect a mixture of ABS and pacman is going to be involved. 17:54:37 you should ask in #archlinux, or check the wiki. 17:55:21 I... can't be bothered 17:55:24 settings machines on fire is an unusual and memorable experience. I... uhm... welll... I'm now scared of PSUs. 17:55:26 `from-8bit ºêÒºÒÂ..ä»áÅéǹêÒÒ... 17:55:28 ​บ๊ายบาย..ไปแล้วน๊าา... 17:55:56 `from-8bit ðòå÷åä íåä÷åä 17:55:59 ​נעוקוה םוהקוה 17:56:07 `from-8bit ? 17:56:10 ​? 17:56:14 dammit. doesn't work. 17:56:29 kmc, you know Rust, right? If I show you potential future rust programs in the future would you critique them? 17:56:32 hmm that was supposed to be ПРЕВЕД МЕДВЕД 17:56:36 Taneb: sure! 17:57:06 Taneb: which version of the language & compiler are you using? I recommend sticking with master rather than the point releases, until 1.0 17:57:26 I guess it is pretty hard to heuristically distinguish national 8-bit codes 17:57:29 Taneb: if you go fetch a package's PKGBUILD, you can redirect the compilation to a local repo. 17:57:42 wonder if chardet uses any language-specific letter frequency data on long enough texts 17:57:46 kmc, 0.8 I think 17:58:02 `from-8bit should pass through ascii characters 17:58:04 should pass through ascii characters 17:58:05 Taneb: also, you could forget everything about packages, and just do “make && make install” to local from source, as in the Olden Days of Unix. 17:58:17 boily, that is what I am doing now 17:58:30 `from-8bit büt whát døe§ it dó with űtf-8 17:58:31 kmc: help what 17:58:33 iconv: illegal input sequence at position 30 \ iconv: illegal input sequence at position 30 \ büt whát dře§ it dó with 17:58:38 But the source seems to be 16MB 17:58:49 And it is downloading sloooowlyyyyy 17:58:58 -!- conehead has joined. 17:58:59 oh 17:59:29 /home/keegan/proj/servo/servo/build.debug/x86_64-unknown-linux-gnu/src/compiler/rust/x86_64-unknown-linux-gnu/stage2/bin/rustc 0.9-pre (67d7be0 2013-10-29 12:02:59 -0700) 17:59:50 ^ i don't install the toolchains, just run them out of dirs 18:03:00 -!- tromp_ has joined. 18:07:02 -!- tromp_ has quit (Ping timeout: 240 seconds). 18:09:18 Reading Wikipedia about Rust, "Other features from Haskell, such as higher-kinded polymorphism, are not yet supported." 18:09:27 Is that planned, or is it not going to happen 18:09:32 -!- yours_truly has quit (Quit: Leaving). 18:09:56 I don't know that it's "planned" exactly, but if somebody did the work we would be happy to merge it 18:10:18 -!- nisstyre has joined. 18:11:04 that's a feature from haskell? 18:11:22 first list-comprehensions and now higher-kinded polymorphism! v. innovative. 18:11:37 I think right now the core team is focusing on getting lots of smaller stuff fixed for the imminent 1.0 release 18:12:03 HKP would be a pretty big change and is also backwards-compatible, so it's more likely to happen after 1.0 18:15:40 -!- w00tles has quit (Quit: quit). 18:23:07 Taneb: note that polymorphism in Rust is implemented by compiling a separate version for each instantiation, which limits some of what can be done 18:23:38 for example I think one couldn't really support higher-rank types, i.e. foralls in function parameter types 18:23:54 imo jit 18:24:02 how's haskell do it 18:24:05 although you might be able to support types like runST :: (forall s. ST s a) -> a, because s is a phantom parameter to ST 18:24:35 Bike: values in GHC Haskell have a uniform representation; they are always a pointer to a heap object whose first word is a pointer to an "info table" 18:24:53 Bike: http://spl.smugmug.com/Humor/Lambdacats/i-XwKHSBM/2/O/boxed%20cat%20has%20a%20uniform%20representation.jpg 18:24:56 hth 18:24:56 so it dispatches at runtime/ 18:25:03 it's not dspatch even 18:25:07 It doesn't dispatch at all. 18:25:11 map :: (a -> b) -> [a] -> [b] has the same machine code regardless of what a and b are 18:25:13 It's just like a void * (except type-safe) 18:25:28 because they are known to be 1 word in size 18:25:43 and you can even force polymorphic values, with "seq" say, because that's done through that info table 18:26:08 whereas Rust supports passing structures of various sizes by value, and has several types of heap allocation and other stuff 18:26:11 This means that unboxed types like Int# aren't really first-class. 18:26:12 You can 18:26:13 oh i was thinking of typeclasses since i don't know anything 18:26:17 't write "id 5#" 18:26:22 and also the low level focus means you *want* to specialize your polymorphic functions to specific types 18:26:31 Bike: typeclasses are implemented by passing around a "dictionary" 18:26:59 @let data c *> a = c => Ctx a 18:26:59 Parse failed: Illegal class assertion 18:27:00 data EqDict a = EqDict { eq :: a -> a -> Bool } 18:27:00 :'( 18:27:31 :t (*>) 18:27:32 then a type like (Eq t) => Int -> t -> Int turns into EqDict t -> Int -> t -> Int 18:27:32 Applicative f => f a -> f b -> f b 18:28:12 (==) :: a -> a -> Bool turns into eq :: EqDict a -> a -> a -> Bool. 18:28:29 Bike: Scala has a mechanism for implicit parameters to functions, and one can use this to do typeclass-like things 18:28:56 the main extra thing you get with typeclasses is that there's only one value of type EqDict t in scope at a time, so to speak 18:29:03 Does that let you do things like instance Eq a => Eq [a]? 18:29:37 Bike: so if you build two binary search trees over element type T, you know they were built with the same Ord instance 18:29:45 which means the binary search tree library can support efficient merges 18:30:07 which you can't do when the ordering is an implicit parameter to every tree operation, with a value which could be different from time to time 18:30:22 Or the comparison function is part of the tree itself. 18:32:38 yeah 18:32:47 but then you need to compare comparison functions to merge trees 18:33:03 and extensional equality of functions is uncomputable of course -- but you might get away with intensional equality 18:33:04 Right. 18:34:35 Bike: in Rust it's even the case that the shape of Option depends on what T is 18:35:14 if T is a non-nullable pointer (e.g. ~S or @S or &S), Option is represented by a single pointer which might be null 18:35:30 if it's a nullable pointer or an int or a struct or something, it's represented the way variants usually are 18:35:45 with a tag word and a C-style union 18:36:24 does rust do fancy pointer tagging things 18:36:30 -!- tswett has joined. 18:36:30 don't believe so 18:36:35 although it gives you enough rope to do them yourself 18:36:38 Hey guys. 18:36:48 hi tswett 18:36:53 (we're not all guys btw) 18:37:03 I'm using "guy" in the looser sense. 18:37:16 well you don't singlehandedly decide what a word means 18:37:34 kmc, I'd say "guy" is becoming increasingly gender neutral, especially in the plural 18:37:50 there is still much discussion about this (e.g. http://storify.com/jvns/guys-guys-guys) so I think it's better to avoid assuming it's gender-neutral for now 18:37:56 but it's not a big deal or anything 18:38:51 "@b0rk In a personal context I also use "dude" regardless of gender but have been replacing it with gender-neutral "gurl" for balance lately." 18:38:58 gurl... 18:39:03 yeah wtf 18:39:10 GNU Url 18:42:27 I use "guys" with a gender-neutral meaning. 18:42:35 that's good 18:42:53 however not everyone will understand it that way, and I like to err on the side of not alienating people 18:42:57 Anyway, I smell an esolang. 18:43:05 again, it's not a big deal 18:43:14 Yeah, I guess it didn't occur to me that people might be alienated. 18:44:24 http://www.scribd.com/doc/193957988/Virgil-Bucks-The-Revolutionary-Cybercurrency-On-The-Net meanwhile, in r bitcoin 18:44:54 Bike: did you see https://medium.com/quinn-norton/f3db7e13e6e3 18:45:04 i apologize for not understanding anything about polymorphs 18:45:07 no 18:45:12 Bike: what about animorphs 18:46:07 never read animorphs 18:46:13 "Like everything the internet does, internet money is over-technical, over-engineered, probably not very well thought out, hilarious, profoundly male dominated, and eventually compared to Hitler" some good writing here 18:48:46 Bike: don't apologize for not knowing stuff :/ 18:48:56 Bike: it's... strangely spot-on. 18:49:27 this is a good article 18:49:28 (stares at http://esolangs.org/wiki/Gs2#Commands) this is a lotta work 18:49:37 oh no i messed something up 18:49:46 don't do that 18:50:18 i guess i am profoundly middle class 18:50:51 -!- conehead has quit (Quit: Computer has gone to sleep.). 18:53:04 * boily is thwarted by Qt's Reluctantness and Anti-Compilable Features 18:53:17 suburbs creep me out though 18:53:31 yup 18:55:12 i think they kind of remind me of the planet from a wrinkle in time 18:55:52 suffurbs. creepy, gloomy suburbs where every house is the same, every inflatable neighbour is the same, everything is drab and all you want is to get the fungout out. 18:56:06 s/fungout/fungot/ 18:56:06 boily: i logged on. :) i think mine predates yours 18:56:19 fungot: probably so. America is young. 18:56:59 fungot's is a predator 18:57:00 shachaf: process 1 killed. it's a nice city in june or something else? an office suite, perhaps, it's weird that if you never use " foo fnord" 18:57:39 Is there a file format that's as feature-rich as tar or cpio but random-access and well-supported? Help me out here... I am literally considering .zip.xz. 18:57:49 shachaf: http://25.media.tumblr.com/d72bee13510fed7fc967a18d5fbd97ba/tumblr_mye61rDDnV1r7mymoo1_1280.png 18:58:05 Gregor: recoils in disgust 18:58:16 Bike: help 18:58:22 Bike: AAAAAAAAAAAAAAAAAAAAAAAAH! 18:58:44 What nice features do tar and cpio have? 18:58:57 Gregor: ÆÆÆÆÆÆÆÆÆÆÆÆÆÆÆÆÆÆÆÆÆÆÆÆĦ! 18:59:02 tswett: Full support for all Unix garbage (modes, owner, etc) 18:59:29 I need something that can archive a Unix directory tree, but has a f***ing index. 18:59:33 Gregor: fuse with compression? 18:59:51 Just put each individual file into a tar file and then put all the tar files into whatever your archive file format is. 19:00:20 Whelp, I'm looking at a Bitcoin price graph, and now the long-term trend actually looks pretty clear. 19:00:25 Gregor: something like a .vmdk, btrfs-formatted, with lzo? 19:01:08 boily: That's... not terrible... enormously wasteful for a write-only filesystem, and requires root to create or extract which is a pain... 19:02:01 Gregor: you sure you need root? even with fuse and qemu and plenty of four-letter emulatory words? 19:02:40 (also, you could set-up a vagrant system, and create a zipping utility that scp stuff over to the VM) 19:03:00 boily: FUSE I can tolerate, if it needed qemu then that would defeat the purpose. I could just extract the whole archive in the time it'd take to launch a friggin' VM. 19:03:36 Looks like on average, the price has multiplied tenfold every ten months. And the longest it's ever gone without posting a gain is... a mere 21 months. 19:03:40 BUT. I SMELL AN ESOLANG. 19:03:50 -!- oerjan has joined. 19:03:53 There are a bunch of objects. Objects can create objects and send messages to objects. 19:04:33 -!- w00tles has joined. 19:04:51 * boily gives an arrow, a bat and a pit to tswett 19:05:16 Is it a crooked arrow? 19:06:44 -!- tromp_ has joined. 19:08:41 tswett: it is one that can travel one edge on a dodecahedron. 19:08:54 Sounds pretty crooked to me. 19:09:13 tswett, that language feels like my misunderstanding of Smalltalk 19:09:33 haha 19:09:44 tswett: http://wimrijnders.nl/other/befunge/wumpus.bf hth. 19:09:50 that reminds me of my idea to make an esolang which has all the properties beginners think Haskell has 19:09:53 Taneb: like Smalltalk, but with other stuff and without other stuff. Like, you know how Smalltalk message sends are really just procedure calls? These ones aren't. 19:10:09 kmc: sounds neat. What properties are those, again? 19:10:30 automatic memoization of functions 19:10:40 type system which separates pure and impure functions 19:11:03 also you have to solve a category theory exercise to do IO 19:12:07 CT is easy. understanding it is hard. 19:13:27 I'm still liking .zip.xz ... 19:13:32 (With zip -0 of course) 19:14:22 kmc: can you make monads actually be burritos twh 19:14:39 yes 19:16:55 So, lessee. Each object shall have one method and some local variables. There are a couple of things you can do. You can create another object. You can send a message to an object. And maybe you can use E's fancy "when" thing. 19:17:53 In E, when you send a message to an object using an "eventual send" statement, the statement returns immediately, returning a reference to the object's response. 19:18:32 Of course, by the time that happens, the object hasn't responded yet, so the reference isn't very usable. 19:18:44 But once the object actually responds, *then* the reference becomes usable. 19:18:57 -!- tromp_ has quit (Ping timeout: 246 seconds). 19:20:03 `? twh 19:20:05 twh would help, but is an hth derivative. hth. twh. hand. 19:20:20 * kmc wasn't expecting that to work 19:20:22 What's twh? 19:20:53 that would help 19:21:29 SQUASHFS! 19:21:30 What should I call this language... 19:21:31 That's the answer! 19:22:12 tswett: you should call your language “Gregor's Answer”. 19:22:25 Works for me. 19:26:58 -!- ^v has quit (Remote host closed the connection). 19:29:18 That's... actually a good name for this language 19:31:17 >_< 19:32:36 Taneb: 'The name of the language is called "Haddocks' Eyes"' hth 19:33:00 So "Haddocks' Eyes" is the name of the name of the language? 19:33:20 most certainly not 19:38:00 So, wait. It is the case that "The song is called Ways and Means" and that "The song is A-sitting on a Gate", right? So, uh... 19:38:08 Lemme think, here... 19:38:29 What is your opinion of this kind of Famicom mapper? http://wiki.nesdev.com/w/index.php/User:Zzo38/Mapper_F 19:38:31 * oerjan hides behind a rock to avoid exploding brain matter 19:38:57 So, "Ways and Means" and "A-sitting on a Gate" are both names. Using a name consists of referring to the name's referent; mentioning a name consists of referring to the name. 19:39:20 * boily shuts himself in a maple lodge 19:40:04 All right. So, the phrasing gives the strong impression that the name "Ways and Means" is mentioned, whereas the name "A-sitting on a Gate" is used. 19:40:47 i am pretty sure the white knight would disagree with you. somehow. 19:41:35 It's possible that when he says "The song is called Ways and Means", he's actually using the name "Ways and Means", and thus asserting that what the song is called is the reference of the name "Ways and Means". 19:41:52 But, assuming my initial impression is correct... 19:42:17 The White Knight refers to the song using the phrase "A-sitting on a Gate", but asserts that it is called "Ways and Means", and that its name is "The Aged Aged Man". 19:42:41 * oerjan digs a tunnel to get further away from the inevitable explosion. 19:43:11 -!- ^v has joined. 19:44:38 So when referring to the song, there are three things we could reasonably call it: "A-sitting on the Gate" (what the Knight calls it), "Ways and Means" (what the Knight asserts that it is generally called), and "The Aged Aged Man" (what the Knight asserts its proper name is). 19:45:11 I think it makes the most sense to refer to the song as "Ways and Means", since if that's what the song is generally called, then that's presumably the most recognizable thing by which to call it. 19:45:36 Then, finally, the name "Haddocks' Eyes" refers to the name "The Aged Aged Man". 19:47:36 * quintopia explodes in oerjan's tunnel 19:48:06 the chännel has become #eroteric. 19:53:00 wat. 20:02:12 `? taneb 20:02:13 Taneb is not elliott, no matter who you ask. He also isn't a rabbi although he has pretended in the past. He has at least two backup keyboards, and five genders. (See also: d-modules) 20:03:13 who invented Tanebventions 20:03:16 boily? 20:03:40 He coined the term 20:04:20 the master of chimærventions 20:12:54 Taneb has five genders, eh? 20:12:56 What are they? 20:13:00 «Isn't category theory defined as "objects and arrows"? And a monad is just the category of types (or so I read somewhere).» 20:14:05 You know, I can really only think of one name that has a name itself, and that's the tetragrammaton. 20:14:39 i hear objects are just morphisms on the category of noumenon 20:15:13 i also hear that the name of the rose is actually just "Rose". lovely woma 20:15:14 Concepts are just Kan extensions. 20:15:14 n 20:15:34 More like Tyler or like Lalonde? 20:15:43 lalonde 20:16:06 -!- tromp_ has joined. 20:17:55 i can't think of any either, other than the tetragrammaton and the one due to shakespeare 20:18:52 What's the one due to Shakespeare? 20:18:55 Macbeth? 20:19:13 a rose by any other name 20:19:16 shachaf: whatchaf 20:19:43 tswett, one of them is "male" 20:19:45 -!- conehead has joined. 20:19:49 The other four are secret 20:19:50 http://www.reddit.com/r/haskell/comments/1tr6ur/wolf_goat_cabbage_solving_simple_logic_problems/ gan 20:20:02 the article it links to is not much better 20:20:22 -!- tromp_ has quit (Ping timeout: 246 seconds). 20:21:00 oh, apparently 'the name of the rose' isn't related to shakespeare, silly me 20:21:58 -!- polytone has changed nick to monotone. 20:23:12 and also i like how everyone seems to link to http://adit.io/posts/2013-04-17-functors,_applicatives,_and_monads_in_pictures.html 20:24:00 i guess people don't usually talk about names independently of their referents enough for the use of a name rather than "[referent]'s name" to be necessary 20:24:49 does anyone know the name of the wind kthx 20:24:55 "the wind" hth 20:24:59 * kmc takes a big hit from a bong shaped like douglass hofstadter's head 20:25:17 douglass_ hofstadter 20:25:22 c.c 20:26:20 Bike: imo come up with a name which names itself 20:26:27 tom 20:26:29 done 20:26:56 THE AUTONOMEN 20:29:25 s/OMEN/YM you greek-latin mixing fiend 20:30:01 is greek-latin like pig-latin 20:30:16 oerjan meant to say "you greek–latin mixing fiend". 20:30:25 It's a really easy typo to make. 20:30:27 shachaf: onay 20:30:52 tswett meant to say «oerjan meant to say "you greek—latin mixing friend".» 20:30:59 `unidecode – 20:31:01 ​[U+2013 EN DASH] 20:31:08 `unidecode — 20:31:10 ​[U+2014 EM DASH] 20:31:15 `unidecode r 20:31:17 ​[U+0072 LATIN SMALL LETTER R] 20:31:46 shachaf: you filthy offspring of unspecified gender of a dog of unspecified gender 20:32:01 `unidecode éé 20:32:03 ​[U+00E9 LATIN SMALL LETTER E WITH ACUTE] [U+0065 LATIN SMALL LETTER E] [U+0301 COMBINING ACUTE ACCENT] 20:32:07 are these genders included in taneb's secret list 20:32:18 oerjan: how should I know? 20:32:23 I will neither confirm or deny that 20:32:28 darn 20:32:47 I'm trying to think of a word or short phrase meaning "reference upon whose resolution a piece of code will be queued to execute". 20:33:27 thunk? 20:33:44 Hmm. 20:33:56 promise? 20:34:27 "Promise" here just means "unresolved reference". 20:34:30 both of those seem backwards somehow 20:40:03 Oh yeah, "nomen" is Latin, isn't it. 20:40:13 Ye 20:40:22 noumenanome 20:43:03 Whelp, I just finished writing the semantics for my unfinished version of Gregor's Answer. 20:43:24 -!- conehead has quit (Quit: Computer has gone to sleep.). 20:44:04 `unidecode  20:44:05 ​[U+E000 DUNNO] 20:44:15 Maybe I should make a language called . 20:44:31 haha 20:44:36 `paste bin/unidecode 20:44:38 http://codu.org/projects/hackbot/fshg/index.cgi/raw-file/tip/bin/unidecode 20:44:44 awesome 20:44:46 The name of the language's name would, of course, be "Unicode private use character U+E000". 20:44:52 also for me that shows up as a penguin <3 20:44:55 a language whose name is f8ff in whatever encoding 20:45:30 How about , what does that show up as for you guys. 20:45:42 a rectangle 20:45:50 I wonder if there's a way I could copy an invalid code point to the clipboard... 20:46:10 Hmmmm. 20:46:20 øÿ 20:46:41 You know, I could probably set this text box's character encoding to Latin1. 20:47:12 for me  is a big squiggly thing that's like 5 times wider than a usual character 20:47:16 (proportional font natch) 20:48:08  is a benzene ring 20:48:19 `unidecode ÿø 20:48:21 ​[U+00FF LATIN SMALL LETTER Y WITH DIAERESIS] [U+00F8 LATIN SMALL LETTER O WITH STROKE] 20:48:24 Aww. 20:48:26  is a keyboard key icon with a GNU on it 20:49:59 penguins, flowers, italicized greek, ligatures, cantillated hebrew, strikethrough latin, gnus, hangul jamo, georgian script (??), box drawin' characters 20:50:22 why ?? 20:50:28 cause I can't identify it for sure 20:50:31 without Effort 20:50:32 oh 20:50:57 -!- w00tles has quit (Quit: quit). 20:52:32 -!- tswett_ has joined. 20:52:43 Ahoy. 20:52:51 are you a dried chicken wing 20:52:59 Who, 20:53:04 Er. 20:53:08 Who, me? 20:53:14 `unidecode ÿø 20:53:15 Traceback (most recent call last): \ File "/hackenv/bin/unidecode", line 4, in \ print u" ".join("[U+{0:04X} {1}]".format(ord(c), unicodedata.name(c, "DUNNO")) for c in " ".join(sys.argv[1:]).decode("utf-8")).encode("utf-8") \ File "/opt/python27/lib/python2.7/encodings/utf_8.py", line 16, in decode \ return codecs.utf_8_decode 20:53:27 Uh-huh. 20:53:42 `unidecode øÿ 20:53:44 Traceback (most recent call last): \ File "/hackenv/bin/unidecode", line 4, in \ print u" ".join("[U+{0:04X} {1}]".format(ord(c), unicodedata.name(c, "DUNNO")) for c in " ".join(sys.argv[1:]).decode("utf-8")).encode("utf-8") \ File "/opt/python27/lib/python2.7/encodings/utf_8.py", line 16, in decode \ return codecs.utf_8_decode 20:53:51 `unidecode øÿ 20:53:52 ​[U+00F8 LATIN SMALL LETTER O WITH STROKE] [U+00FF LATIN SMALL LETTER Y WITH DIAERESIS] 20:54:00 what is hapen 20:54:03 Sump'm wunky. 20:55:47 Lemme see here. 20:55:51 -!- tswett_ has quit (Client Quit). 20:56:23 -!- tswett_ has joined. 20:56:34 tswett: ¡olé! 20:56:59 tswett: ¡olé! 20:57:07 Yeah baby. We're in business. 20:57:22 Bike: Somebody set us up the bomb. 20:57:24 `unidecode ¡é 20:57:26 ​[U+00A1 INVERTED EXCLAMATION MARK] [U+00E9 LATIN SMALL LETTER E WITH ACUTE] 20:58:42 Now I kinda wonder, like, what if I, like... 20:58:58 smoked a bong /made out of/ hofstater's head? 20:59:28 That just gave me an error message. 21:00:39 I typed 猫 into the thing that's supposed to convert UTF-8 to Latin1. 21:00:48 Thing is, I guess that's not really possible. 21:01:07 it's not in latin1 is it 21:01:13 Nope. 21:01:13 or, in fact, latin 21:01:24 I don't think ¡ is Latin either, but it's in Latin1. 21:01:50 it's in a romance language at least. 21:02:09 How romantic. 21:02:31 `unidecode à 21:02:33 ​[U+00C3 LATIN CAPITAL LETTER A WITH TILDE] [U+0083 DUNNO] 21:02:59 `unidecode à 21:03:00 ​[U+00C3 LATIN CAPITAL LETTER A WITH TILDE] [U+0083 DUNNO] [U+00C2 LATIN CAPITAL LETTER A WITH CIRCUMFLEX] [U+0083 DUNNO] 21:03:31 -!- tswett_ has quit (Ping timeout: 260 seconds). 21:04:18 I did write a program, which can do some things including convert UTF-8 to Latin1. 21:04:42 `from-8bit 猫 21:04:44 iconv: illegal input sequence at position 0 \ iconv: conversion from `None' is not supported \ Try `iconv --help' or `iconv --usage' for more information. \ iconv: illegal input sequence at position 0 21:04:54 none encoding with left beef 21:05:41 Lessee, in raw binary, that's 11000011 01000011 11000010 01000011, but in UTF-8 that's 11000011 10000011 01000011 11000011 10000010 01000011. 21:05:59 Ah, nope, 8 is 1000, not 0100. 21:06:48 "raw" nothin, i need to see the outgoing square wave 21:07:05 back from an intense session of XML with . may I ask why are you converting cats? 21:07:27 So 11000011 is encoded as 11000011 10000011, and 10000011 is encoded as 11000010 10000011, and 11000010 is encoded as 11000011 10000010, and 10000010 is encoded as 11000010 10000010. Right? 21:07:43 Bike: on which medium? 21:08:06 twisted pair 21:08:10 also my band 21:08:46 Yeah, but which twisted pair? 21:09:24 the one from your computer to whatever 21:09:39 To my external hard drive? 21:10:06 All right, send me an oscilloscope and a spare USB Mini cable. 21:10:11 ok. asking why cats are twisted may not be the right enquiry. this conversation has drifted far away from my Earthly needs. I shall drink a glass of OJ, resume my album, and coast along. 21:11:54 µ isn't very Latin, but is also in Latin-1. 21:12:53 fizzie: Sure, but μ isn't. 21:13:43 I suppose the MICRO SIGN belongs to everyone. 21:13:48 Like space. 21:14:08 you know what sucks? µµg 21:14:09 fuck those 21:14:27 Micromicrograms? 21:14:35 yep 21:14:36 21:15:22 used by certain horrible people instead of nano- 21:15:37 or femtogram? w/e 21:16:30 Picogram, presumably. 21:17:48 -!- tromp_ has joined. 21:18:04 fungot: do you use scruples and minims? 21:18:04 boily: it is. :p))) name)) 21:18:16 fizzie: your bot. it is mocking me. 21:18:29 fungot has no scruples 21:18:30 shachaf: i'm sure that all the cps in the first hl, it seems well suited to objects, not classes, lectures 21:19:57 fungot: what are hles? 21:19:57 boily: that kinda sucks 21:20:14 fungot: be nice to boily, fungot 21:20:14 shachaf: but if you're at ip=2, the interp will be in the " strong set", you have 1 message. 21:20:25 whoa 21:20:40 fungot: you've convinced me. niceness to boily is entirely gratuitous 21:20:40 shachaf: well anyway! this is classic :) anyone know a fast algorithm in c ( because i'll already have implementations of it 21:21:04 fizzie: your bot is rather full of itself 21:21:24 What else would it be full of? 21:21:24 wait, maybe this is the setup for a joke 21:21:35 fungot: yes, i know a fast algorithm in c 21:21:36 shachaf: bye? :p. 21:21:42 :p. 21:21:45 shachaf: bleh :P 21:21:50 Let's see if my plan what I have to do next in a Dungeons&Dragons game is good enough! 21:22:19 boily: Do YOU know what it is? 21:22:35 zzo38: the plan? 21:22:57 fungot: hey, you know, I really like hanging out with you. 21:22:57 tswett: the func kylew just refered to is the first argument 21:23:02 (btw, I DMed a bout of Paranoia last Sunday. it was deadly :D) 21:25:05 boily: Yes I mean the plan. (If you don't know, I can tell you, but maybe I forgot something important too) 21:25:37 (Such as, what happens in case of something other than what I expected, or am unable to do for some reason) 21:26:13 zzo38: could you tell me the plan that is meant, and the Somethings that are Othered, the Forgotten Expectations and Everything Else? 21:26:28 OK, I can try 21:27:53 What I need to do, is find an area of plains in the middle of nowhere with nobody else around, make some cage or walls or something so that it is possible to see and hear through but not to walk through, bury the anti-magic amulet upside-down, attached to a trapdoor, hidden with grass, slightly open so that when it is stepped on it will close, ... 21:28:26 upside-down? 21:28:52 ... Put another object underneath which will support it, and enchant it with a spell allowing anyone in range who speaks the command word to retrieve it, and then force the prisoner and captain into the cage, lock it, and run away, ... 21:30:22 is that a weird analog to the Schrödingcat? 21:31:01 ... Make some barrier or something to assure that they will not step on the patch of the grass where it is hidden until we run away, and then they will step into the circle to un-mind-switch, and the captain will then say something which happens to contain the command word (but he doesn't know that is what it is). 21:31:04 boily: No. 21:31:45 oh. I was fearing it wasn't as devious as it seemed. proceed with your Terrifying Plan, then... 21:33:01 This may require some psychology to know what we expect the captain to say and to manipulate the situation into such a phrase. 21:33:08 kmc, can you tell me why this won't compile? http://lpaste.net/3941835973981110272 21:33:26 can you tell me what the error message is? 21:34:02 But before all of that, we may need to handcuff them together. I have already tied up both of them, but that isn't good enough. 21:34:13 zzo38: a traditional Batman Gambit. 21:34:14 kmc, unexpected failure 21:34:24 internal compiler error?? 21:34:25 sucks 21:34:27 Aye 21:34:39 anyway I think you want: use std::io::{stdin, ReaderUtil}; ...; stdin.read_char() 21:34:48 I think it may be because I completely misread a lot of the tutorial 21:34:57 when a function is documented as taking self or &self etc, you call it using OOP method call syntax 21:35:01 boily: Yes I suppose it is a bit like a Batman Gambit, but far more confusing. 21:35:18 and to call such a method from a trait, you need to bring the trait into scope, even though the name isn't explicitly used 21:35:20 -!- glogbackup has joined. 21:35:25 Right 21:35:33 glelllolllolllelllogbackup. 21:35:47 zzo38: and why the requirement to the handcuffs? 21:36:08 boily: So that they are forced to remain next to each other. 21:36:28 Well, now it gives me an actual error 21:36:31 zzo38: indeed. only one trap, and you wouldn't want one of them staying untrapped, eh? 21:36:42 failed to find an implementation of trait std::io::Reader for extern "Rust" fn() -> @std::io::Reader:'static 21:37:37 oh you need to call stdin() 21:37:41 to get the object which represents stdin 21:37:43 i don't remember why :/ 21:37:57 you're using the old @-ful IO stuff 21:37:58 boily: Well, I intend to set the captain free afterward if the plan works correctly. But I won't free the other guy. 21:38:03 so all this code will be scrapped when you upgrade Rust 21:38:23 Serves me right for trying to learn an indev language :) 21:38:30 ayup 21:38:39 although the /concepts/ are pretty much fixed at this point 21:38:58 and the concepts are unique enough that they require some learning 21:39:10 it's not like learning Python when you know Ruby or whatever 21:39:20 zzo38: so you need an unhandcuffer somewhere. 21:39:41 boily: That will be easily enough to do afterward, I expect. 21:40:00 Well, my code works now 21:40:03 coool! 21:40:05 congratsneb 21:40:46 (trying to solve http://rosalind.info/problems/dna/ ) 21:41:47 But there are things to consider, such as the range of the anti-magic, which is 60ft. 21:42:13 hehh, it has "Translating RNA into Protein" but the actual problem is way easier than the title makes you think 21:42:18 lol 21:42:22 yeah write a protein folding simulator 21:42:40 Taneb: would you like style criticism on your code 21:42:59 Please 21:43:01 And it may be necessary to see what is happening from remotely, somehow. This is to see who is dead and who is switched and stuff like that. 21:43:04 cool little site though 21:43:30 Bike, for practising programming I'd rate it much higher than Euler 21:43:37 loop { match my_stdin.read_char() { '\n' => break, ... } } 21:43:41 that avoids the need for buf 21:43:52 Taneb: it's true, euler involves a lot more math 21:43:53 ~eval intercalate " " . map (show . length) . group . sort $ "AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC" 21:43:55 "20 12 17 21" 21:43:58 Since there is also the possibility that the prisoner is lying and he may be able to kill the captain. But, I do have a backup plan in that case too! 21:44:08 kmc, ooh, cunning 21:44:13 :t intercalate 21:44:14 [a] -> [[a]] -> [a] 21:44:24 zzo38: 60ft radius of AM? that's more than enough. 21:44:24 Did I miss anything else important, perhaps? 21:44:27 i think that may be cheating. 21:44:37 zzo38: and what is your contingency plan? 21:44:39 i might also use a hashmap rather than 4 variables, but that's something a matter of taste 21:44:58 zzo38: eeeeh... you really need a roof over your cage. 21:45:01 kmc, with only 4 variables, it doesn't feel worth it 21:45:03 also, totally impractical for sequences of realistic length :p 21:45:04 boily: Yes I know it is more than enough, but if it is too large, that can be a problem too; the exact range will be important. 21:45:05 Any more, and I'd switch 21:45:07 zzo38: also, dig-proof your trap. 21:45:36 in master rust there is println!(..) which does the fmt! for you 21:45:40 kmc: does rust refer to things by their implementations 21:45:41 O, yes I need the roof, I suppose. 21:45:41 also the formatting language has completely changed 21:45:44 http://rosalind.info/problems/mprt/ now that's more like it 21:45:47 shachaf: there are traits too 21:45:51 but i don't remember if hashmap uses the trait 21:45:51 i mean "hashmap" 21:46:04 i mean that there is a trait for unordered containers or w/e 21:46:04 oh maybe that's what you mean 21:46:09 And, how do you mean, dig-proof? It isn't really a trap; it is supposed to be a kind of defense mechanism. 21:46:12 yes 21:46:33 hey look! de bruijn! 21:46:45 edit distance is way down there tho 21:46:49 it's now more like Python's str.format method 21:47:04 i might have to do these 21:47:08 which is p. cool 21:47:52 it's cool how close bioinformatics is to information theory stuffs 21:48:03 My backup plan is that if the prisoner kills the captain, have someone go near the cage and speak another phrase which happens to contain the command word, and then call me and the royal wizard over, to deal with it. 21:48:03 zzo38: hmm... when we D&D, we always find a way to severely compromise the physical integrity of surrounding things, whatever material they may be made of. 21:48:15 I tend to rant about how format strings should be replaced with some richer data type 21:48:23 but I realized that you'd have to re-build all the internationalization tools 21:48:36 format strings are the bread and butter of i18n, which is largely performed by non-programmers 21:48:50 boily: Can you explain more about that please? 21:48:52 zzo38: so the intent is to have the prisonner die in a discreet manner, surrounded by Green Pastures. 21:48:57 you use format strings for internationalization? 21:49:11 the syntax used by Python .format() and new Rust fmt! allows the format string to permute its arguments, which is important for i18n 21:49:18 in that case why aren't they called forinternationalization strings 21:49:21 c.c 21:49:25 i blame Gracenotes 21:49:27 boily: NO. The intent is to force him to un-mind-switch with the captain; the captain wants his body back. 21:49:31 zzo38: explosions, magical mishaps, stupid self-sacrifices with energy buildups, mutations... 21:49:34 zzo38: oh. 21:49:39 hungarian fori18ns 21:49:43 -!- tromp_ has quit (Ping timeout: 245 seconds). 21:49:55 that was a serious question i don't know about i18n 21:50:07 And in my plan I have just the only small window of magic in order to prevent other magical stuff. 21:50:09 Bike: yeah, someone has to translate all the strings used in the UI 21:50:25 and they'll often be format strings because stuff gets interpolated 21:50:33 The secondary objective is the prisoner to be dead. 21:50:44 the only thing i know about is that one C library that defines a _ macro or suchlike 21:50:50 and different languages put things in different orders sometimes 21:51:06 _(Bicycle) 21:51:11 bicyclidine 21:51:11 zzo38: AAAAAAAAAAH! sudden illumination. “mind switch.” I now understand. 21:51:27 `addquote zzo38: AAAAAAAAAAH! sudden illumination. “mind switch.” I now understand. 21:51:32 1149) zzo38: AAAAAAAAAAH! sudden illumination. “mind switch.” I now understand. 21:51:55 so you have println(_("fuck your shit")) and the _ takes care of making a list of what needs to be translated, and replacing it, or... whatever 21:52:02 squashfs is my new favorite archival format. 21:52:05 println isn't real c but, fuck it 21:52:20 #define println puts 21:52:25 yeah that one 21:52:33 #define create creat 21:52:42 kmc, final code: http://runciman.hacksoc.org/~taneb/dna.rs.txt any more tips/ 21:52:57 "apparently future rust does this nicer." i'm not sure about that :3 21:53:17 it looks good Taneb 21:53:31 :) 21:53:35 do we have a += operator? i forgot 21:53:43 :t (+=) 21:53:44 (Num a, MonadState s m) => ASetter' s a -> a -> m () 21:53:50 i think you don't need the semicolon after match { ... }; 21:53:56 cause it ends the enclosing block 21:54:21 what if during the month after february but before april, you could use march { ... } blocks 21:54:29 but it would be a syntax error otherwise 21:54:32 el oh el 21:55:03 kmc, there is a += 21:55:24 There is not a ++ 21:55:27 SCIENCE 21:55:34 i think for reasons 21:55:39 well, i mean, who likes ++ 21:55:39 hm i can't remember 21:55:43 ++-- 21:55:50 `karma ++ 21:55:54 ​++ has 0 karma. 21:56:00 (who's *crementing whom here??) 21:56:07 I do know that there was concern over letting people overload += because you might make x += y behave semantically differently from x = x + y, but you probably *do* want them to be different for efficiency 21:56:09 boily: Ah, but there is more! I will need to blindfold them at first, while arranging the area for the box in the grass. Since, we need to make them remain in the range of the anti-magic field. 21:56:25 say x and y are huge matrices, it is better to add the elements in-place if you can 21:56:43 kmc, that is still semantically equivalent, just not operationally, right? 21:57:07 but there's no way for the lang to verify that your += and + overloads are consistent 21:57:17 the C++ answer is "sucks to be you then" 21:57:28 but Rust people are less happy with that answer? 21:57:29 shrug 21:57:34 gotta go ttyl 21:58:11 zzo38: will you have to use timed, self-disintegrating blindfolds? 21:58:28 (meanwhile, disappearing toward some random movie.) 21:58:30 boily: No, removing them by hand should be OK. 21:58:43 zzo38: more reliable. 21:58:49 -!- boily has quit (Quit: HORROR CHICKEN). 21:58:52 -!- metasepia has quit (Remote host closed the connection). 21:59:11 Hopefully, do all of you others understand this plan now? 21:59:18 Or is it too confusing? 21:59:32 it makes sense to me 21:59:54 OK, good. 22:00:18 Did I miss anything, or is there another question to consider, or something else? There may be something I haven't anticipated yet. 22:00:49 -!- carado has quit (Ping timeout: 246 seconds). 22:03:08 Another program! 22:03:09 http://runciman.hacksoc.org/~taneb/rna.rs.txt 22:03:18 -!- carado has joined. 22:03:40 Please anyone make ANY criticism you can think of 22:03:58 do you not care about recieving invalid dna? 22:04:05 No 22:07:14 -!- Bike_ has joined. 22:08:21 -!- Bike has quit (Ping timeout: 246 seconds). 22:09:19 with something that simple is there much to criticize 22:09:37 Bike_, I want to make sure I'm not doing anything awful 22:09:51 I mean, in a Haskell program that long I could do like 100 awful things 22:12:25 well everything i can think of is boring stuff like 'what about lowercase letters' and CRLF handling 22:12:30 -!- Bike_ has changed nick to Bike. 22:12:37 you could skip to making more general transducers i guess 22:13:05 Bike, the input is very restricted. Not sure about crlf handling, though 22:13:44 Taneb: That looks suspiciously like Rust 22:14:01 FreeFull, there is a good reason for that 22:14:15 in my amazingly awesome experience with bio lab code, line endings are an everpresent nightmare, so be prepared?? 22:14:36 Also I've had something in my eye for like two hours 22:14:47 Taneb: Also looks suspiciously like converting DNA to RNA in a Rosalind problem 22:15:05 I would have just used tr 22:15:17 right, general transducer. 22:15:49 FreeFull, my goal is to learn rust, not to solve Rosalind problems :) 22:16:05 i feel like i shoudl complain about 'converting' there since you're totally ignoring primary transcription 22:16:07 =P 22:16:14 Taneb: Project Euler too mathy? 22:16:32 FreeFull, Project Euler I find is awful for learning a language 22:16:52 Taneb: Right now, isn't it that what breaks out of the loop is an error? 22:16:58 That's not good 22:17:13 What? 22:17:34 Well, you've got an infinite loop with a match in it 22:17:41 And then a statement after that 22:18:14 I assume you mean for that statement to be reached at some point 22:18:15 break breaks out of the loop, rather than signaling an error 22:18:30 Oh, wait 22:18:40 I didn't notice that the \n case broke out of the loop 22:18:45 Disregard me, I'm derpy >_< 22:18:58 Taneb: What happens when the loop gets EOF? 22:20:46 -!- Phantom_Hoover has joined. 22:23:10 -!- conehead has joined. 22:26:33 -!- Phantom_Hoover has quit (Ping timeout: 246 seconds). 22:28:20 -!- MindlessDrone has quit (Quit: MindlessDrone). 22:43:25 -!- pjotter has joined. 22:50:00 -!- glogbackup has quit (Remote host closed the connection). 22:51:38 FreeFull, I am not sure 22:51:55 Taneb: Try it out, pipe it a file without a newline 22:51:59 -!- AnotherTest has quit (Ping timeout: 272 seconds). 22:52:28 Taneb: You could also handle lowercase input 22:53:05 Yeah, it fails if there isn't a newline 22:53:49 Well, you could try to fix that 22:55:49 I don't know where to begin :( 22:56:20 Yes I do 22:57:28 It... sort of works now 22:57:37 $ ./rna < bad 22:57:38 UUU���� 22:57:47 perfect 22:58:13 -!- pjotter has left. 22:58:25 what's it supposed to do 22:58:36 replace t's with u's 22:58:47 http://rosalind.info/problems/rna/ 22:58:53 apparently 22:59:17 it would be more useful if it replaced rna sequences with correctly folded sequences of amino acids! :P 22:59:34 there's a later one about turing rna into primary structure yes 22:59:39 turning* 23:00:07 i wonder if there's anything about regulatory networks and/or ribozyme kinda crapola 23:00:07 quintopia, baby steps 23:00:27 Anyway, the issue is that it can't tell if it's at eof until it's tried to read 23:00:36 And it's reading in UTF32 23:00:58 So, it tries to read a character, gets nonsense 4 times 23:01:08 https://en.wikipedia.org/wiki/File:Pseudoknot.svg so easy 23:02:07 In BNF, [] denotes something optional and {} denotes something repeated zero or more times, right? 23:02:23 kmc, library documentation is lacking in places 23:02:26 :( 23:02:35 'The general problem of predicting lowest free energy structures with pseudoknots has been shown to be NP-complete.[5][6]' sonova 23:03:38 i only know the reverse process, which you can do by dumping shit in bleacch 23:03:40 fuck you physics 23:04:52 i like that this website has the same name as my grandmother 23:05:24 your grandfather's name is wikipedia? 23:05:52 oh, rosalind.info 23:05:53 FreeFull, it works now :) 23:05:59 Yay 23:06:01 Can we see? 23:06:02 i said nothing about my grandfather, plus you can't talk about him cuz he's still alive 23:06:30 http://runciman.hacksoc.org/~taneb/rna.rs.txt 23:06:56 oops 23:07:26 I guess I accidentally duplicated the eof test 23:07:27 do you need that second branch/ 23:07:31 yea 23:07:39 The first one should be removed 23:08:02 Try now 23:08:06 eh, really? i'd remove the second 23:08:13 what happens on an empty file, for one 23:08:19 Nah, because it needs to have read a character to tell if it's eof 23:08:22 Rust is weird, man 23:08:29 that... what? 23:08:38 what happens on an empty file, then? 23:08:57 http://static.rust-lang.org/doc/0.8/std/io/trait.Reader.html#fn.eof 23:09:01 Bike, empty output 23:09:20 http://esolangs.org/wiki/Gregor%27s_Answer – there, doesn't this spec suck. 23:09:45 ...ah, hm. 23:09:54 seems more like an error checkk. weird. 23:10:10 So, you can create objects, and send them messages, and such. 23:10:19 ....whiiiiich is exactly how feof works. 23:10:41 It would be nice if you could create an object representing a pair of two other objects. 23:11:11 shouldn't it just be the usual "object that understands fst and snd messages" shit 23:11:31 Bike: thing is, each object only has one method. 23:12:00 eh, so branch on message content? 23:12:12 There's no obvious way to branch. 23:13:21 tswett: needs example program 23:14:47 -!- Sgeo has joined. 23:15:11 x{hel low orl d} – sets x to an object that, when called, returns nothing. 23:15:26 Slightly, slightly more interesting: 23:15:46 x{@} – sets x to an object that, when called, returns its argument. 23:17:10 Hm, here's an idea. 23:19:16 a{ i{@} yix xi@ y } 23:19:25 When called, returns whatever it returned the last time it was called. 23:20:01 Yeah, that'll do it, if you just expand it a little bit: a{ i{@} ziy yix xi@ y }. Returns whatever it returned the penultimate time it was called. 23:20:42 A two-element queue can certainly be used as an ordered pair. 23:21:30 "True" and "false" can be implemented as objects that take one of these queues and return either its first or its second element. 23:26:30 Next one 23:26:31 http://runciman.hacksoc.org/~taneb/revc.rs.txt 23:33:00 kmc, thoughts? 23:35:25 still think you could/should write general transduction 23:36:26 Bike, baby steps 23:36:55 you've practically done it anyway 23:39:34 -!- Phantom_Hoover has joined. 23:42:15 -!- oerjan has quit (Quit: Nite). 23:45:08 http://joelgrus.com/2013/12/24/why-programming-language-x-is-unambiguously-better-than-programming-language-y/ more like loglan than klingon 23:49:41 Fiora: http://www.opticsinfobase.org/ao/abstract.cfm?uri=ao-52-27-6735 this looks coolio 23:50:43 supposedly 'outperforms' jpeg 23:50:50 whatever that means 23:53:05 JPEG-2000 outperforms JPEG. Still nobody gives a shit. 23:54:11 did you know that JPEG supports arithmetic coding but nobody uses it because \rainbow{PATENTS} 23:55:10 yaaaaay 23:55:12 rainbow patents :'( 23:55:17 next they'll patent hugs and kittens 23:55:47 shachaf: i already did. super hard to enforce tho. 23:56:09 Rainbow patents, are they like a space-efficient way of patenting huge areas of patentable things? 23:57:40 Like a four-gig rainbow patent can cover all possible software patents up to 32 pages long and so on. 23:58:16 We claim: 1. A method whereby a process is applied in a circumstance, the process having been chosen with regard to the circumstance so as to achieve a result possessing some quality. 23:58:18 i feel like there's already a form for that at the patent office 23:58:30 2. The method of claim 1, where the quality is a desirable quality. 23:58:58 3. The method of claim 3, where the circumstance is the desirability of an object. 23:59:12 4. The method of claim 3, where the process creates the desired object. 23:59:20 did claim 3 just refer to itself 23:59:22 Uh, claim 3 should refer to claim 1, not claim 3. 23:59:48 5. The method of claim 1, where the process is chosen because of its similarity to another process.