←2013-04-14 2013-04-15 2013-04-16→ ↑2013 ↑all
00:11:15 -!- DHeadshot has joined.
00:17:52 -!- augur has quit (Remote host closed the connection).
00:20:42 -!- SgeoOnLessDenseW has changed nick to Sgeo.
00:20:57 <Sgeo> If a shirt says to machine wash warm, there's no harm in machine wash cold'ing it, is there?
00:21:11 <kmc> correct
00:21:32 <kmc> except that certain stains won't come out as well on cold (but that has nothing to do with the particular fabric type)
00:21:38 <kmc> and other stains will come out better on cold
00:22:07 <kmc> i'm a simple man with simple clothes and I wash them all together on warm and it's working out p. well
00:22:34 <Sgeo> All my shirts except one say machine wash cold
00:22:41 <Sgeo> So I'll go ahead and machine wash cold
00:25:09 <mnoqy> good judgment call
00:30:17 <tswett> Huh. About 3/4 of my shirts say warm and 1/4 say cold.
00:31:17 <tswett> shachaf: I'm trying to figure out what "I,I drop shipping" might mean.
00:31:23 <zzo38> Then wash it separately.
00:31:44 <tswett> Is "drop" the verb or the noun? Is "I" the first-person singular pronoun? Is "I,I" an ordered pair?
00:32:29 <tswett> Is this "shipping" as in the conveyance of goods, or as in the... what do you call it.
00:32:45 <tswett> The imagination of relationships?
00:32:58 <oerjan> istr being told here recently that I,I means "i have nothing to say, i just like saying"
00:33:13 <oerjan> or thereabouts
00:33:17 <tswett> "I have nothing to say, I just like saying drop shipping"?
00:33:22 <oerjan> yeah
00:33:31 <tswett> Like "I just like saying 'drop shipping'"?
00:33:36 <tswett> Makes sense, I guess.
00:33:42 <oerjan> the "say" possibly was something else.
00:33:49 <oerjan> but not much more meaningful.
00:34:16 <oerjan> tswett: well the louisiana purchase _did_ look a bit like drop shipping
00:34:34 <tswett> What is drop shipping, anyway?
00:34:39 <tswett> Is it when you convey goods by dropping them?
00:35:21 <oerjan> "Drop shipping is a supply chain management technique in which the retailer does not keep goods in stock, but instead transfers customer orders and shipment details to either the manufacturer or a wholesaler, who then ships the goods directly to the customer." hth
00:36:55 <kmc> ts ts ts ts ts ts ts ts ts DROP SHIPPING WUBBBBBBBwubwubwubKZZZZZZZkzZWUBWUBWUBwubwubwub
00:37:16 <oerjan> is kmc quoting lyrics again
00:37:24 <Bike> dubstep: a lyric
00:49:26 <Sgeo> I,I I,I
00:54:30 <FreeFull> forkIO $ join . atomically $ x >>= readTVar >>= \x -> check (x==0) >> return (putStrLn "Is zero.") Either the STM implementation knows to not resume the thread until the TVar changes, or it doesn't check very often
00:54:45 <elliott> it knows
00:54:51 <FreeFull> Cool
00:54:51 <elliott> that's the essential idea of STM
00:55:02 -!- variable has changed nick to constant.
00:55:15 <FreeFull> Well, the condition is pure
00:55:17 <Bike> :t atomically
00:55:19 <lambdabot> Not in scope: `atomically'
00:55:30 <FreeFull> So there shouldn't be any reason why it shouldn't know
00:56:24 <Sgeo> Doesn't know the specific TVar under question, or does it treat all TVars touched by that time as suspect?
00:56:38 <elliott> well, it doesn't even care about "check".
00:56:44 <elliott> it cares about "readTVar"
00:57:08 <kmc> i don't know that I'd say it's the 'essential idea', but it's p. important
00:57:31 <Bike> i thought the essential idea of STM was the check state -> do transacation -> check consistency thing
00:57:34 <Bike> or something
00:57:37 <oerjan> @hoogle atomically
00:57:38 <lambdabot> GHC.Conc.Sync atomically :: STM a -> IO a
00:57:38 <lambdabot> GHC.Conc atomically :: STM a -> IO a
00:57:38 <lambdabot> Control.Monad.STM atomically :: STM a -> IO a
00:57:39 <kmc> elliott: also why are you still +o don't you know that it raises the Channel Temperature™
00:57:41 <elliott> well the "essential idea" is composition
00:57:48 <kmc> Bike: it depends on whether you mean the user's or implementor's point of view
00:57:51 <elliott> kmc: oerjan hasn't added me to the access list yet!
00:57:53 <Bike> kmc: oh you think that's dumb too huh
00:57:59 <elliott> need to be prepared for them trolls
00:58:07 <Sgeo> :o)
00:58:07 <kmc> Bike: channel temp? nah, it's probably fine advice
00:58:14 <Bike> o
00:58:41 <kmc> mainly I like it when people aren't +o all the time because then when they give themselves +o it's like WOAH SHIT JUST GOT REAL
00:58:41 <oerjan> elliott: wait i thought you were +o to handle Gregor's voice
00:58:48 <Bike> haha, true
00:58:57 <kmc> i always imagine it as the sound of a pump action shotgun being cocked
00:59:00 <Fiora> XD
00:59:09 <Bike> motherfucker you'd best step off
00:59:18 <Fiora> like a sheriff walking out from around the corner, holding his handgun
00:59:20 <Fiora> "settle down, boys"
00:59:39 <Fiora> like in a cowboy movie
01:00:37 <elliott> oerjan: yes.
01:00:44 <elliott> oerjan: consider: someone might come in and demand Gregor have an incorrect voice state.
01:00:53 <elliott> that would be rather disruptive
01:01:02 <kmc> yes
01:01:16 <oerjan> i think this is stretching things a bit.
01:01:29 <Bike> no, it's a reasonable concern
01:01:37 <elliott> oerjan: i have special domain-specific knowledge that i bring to this team
01:01:47 <elliott> kmc: i like it most when multiple ops go +o within seconds of each other
01:01:56 <elliott> and then there's the slight tension as they try to predict whether the other one will act first
01:01:59 <kmc> is that like a mexican standoff
01:02:01 <elliott> so it takes a few seconds longer for anything to happen
01:02:28 <kmc> you need less scrupulous ops
01:02:29 <Bike> kmc: it's like a mexican standoff except they're all shooting the sae guy
01:02:34 <Bike> aka a firing squad maybe
01:02:40 <kmc> yeah
01:02:42 <elliott> a nervous firing squad
01:03:15 <elliott> Nervous Firing Squad, kmc's other band
01:03:48 <Bike> kmc has a lot of bands
01:04:31 <oerjan> i recently read that quisling's firing squad had to replace one member who lost his nerves
01:06:19 <elliott> are we talking literal nerves
01:06:23 <elliott> "whoops they fell out"
01:06:34 <oerjan> i do not think so
01:06:44 <Bike> demyelinating diseases are no laughing matter
01:07:26 <oerjan> i do not think they would admit people with such a disease into the police.
01:08:00 <Bike> ableist
01:08:08 <kmc> Bike: what if I laugh in the face of death, generally speaking
01:08:33 <oerjan> and what if he then answers DO SOMETHING ABOUT YOUR HALITOSIS
01:18:16 <Phantom_Hoover> "In a February 2005 article in The Times, Julie Burchill argued that use of the word is a form of "social racism", and that such "sneering" reveals more about the shortcomings of the "chav-haters" than those of their supposed victims." -- WP:Chav
01:18:20 <Phantom_Hoover> seriously
01:18:25 <Phantom_Hoover> is that the level we're at
01:18:33 <Phantom_Hoover> that we're calling it 'social racism' now
01:18:51 <Phantom_Hoover> like, by analogy with 'gender racism'?
01:18:53 <Bike> it's like classism, except...
01:19:03 <Gregor> NOBODY GETS HURT
01:19:03 <Phantom_Hoover> and sexual orientation racism?
01:19:46 <Phantom_Hoover> or race racism
01:19:47 <Gregor> "Gay" is the best race.
01:20:00 <kmc> does 'classism' just sound too old-fashioned as a word
01:20:06 <kmc> BBC tells me that Britain has 7 classes now
01:20:08 <Bike> it sounds marxist
01:20:12 <kmc> each classier than the others
01:20:34 <Phantom_Hoover> istr there was something very stupid in that article but i forget what it was
01:20:36 <Bike> "Actually the whole point of an interpreter was portability and abstraction" talking about programming languages is suffering
01:20:48 <kmc> also I learned that the Daily Mail has a section called "Femail" which is all about condescending to women and is even worse than the regular Daily Mail
01:20:56 <Bike> that's an impressive feat
01:21:01 <kmc> i know, right?
01:21:15 <Phantom_Hoover> i'm sceptical
01:21:26 <kmc> maybe it's not really worse, because it's more vapid and pointless
01:21:34 <kmc> i dunno
01:21:40 <Phantom_Hoover> i mean the rest of the daily mail is technically responsible for the ongoing measles epidemic in swansea
01:21:44 <kmc> what
01:21:50 <Bike> well i have to check it out now
01:21:53 <Bike> Phantom_Hoover: oh?
01:21:57 <Phantom_Hoover> well they were one of the big promulgators of the mmr scare
01:22:02 <kmc> ugh
01:22:07 <kmc> anti-vacciners?
01:22:09 <Bike> mercury vaccines or something else?
01:22:13 <Phantom_Hoover> no
01:22:20 <Phantom_Hoover> mercury vaccines is an american thing
01:22:43 <Phantom_Hoover> the british version is that MMR is what gives your children autism
01:22:47 <Bike> «'I wish IVF had never been invented' It's brought joy to so many. But, as the scientist behind IVF dies, Samantha Brick says it's given her nothing but heartache...» what the heck
01:22:55 <kmc> Phantom_Hoover: that's a big thing in america too
01:23:03 <kmc> they claim the mercury causes autism somehow
01:23:14 <Bike> oh, yeah, wakefield
01:23:16 <Phantom_Hoover> yes, autism is obviously a popular choice
01:23:18 <Bike> fuck that guy
01:23:38 <Phantom_Hoover> (not dr wakefield any more, he got banned from doctoring)
01:23:42 <Fiora> and autism is as bad as hitler and it's worth subjecting your kids to dangerous diseases with a good chance of killing or cripplingn them because /at least it's not autism/
01:23:50 * Fiora fume -_-
01:23:56 <Bike> «'I've only had three boyfriends! I'm not interested in serial dating' says actress Tamsin Egerton despite rumours linking her to Singularity co-star Josh Hartnett» good lord
01:24:08 <FreeFull> Last thing I heard was that vitamin d deficiency during pregnancy causes autism
01:24:14 <kmc> i guess being a parent of an autistic kid is terrifying and heartbreaking and you'll grasp desparately for anyone to blame or any supposed cure
01:24:54 <elliott> i think autism is "heartbreaking" mainly because most people have no fucking idea what it is
01:24:55 <Phantom_Hoover> anxiety over autism scares in pregnancy causes autism
01:25:05 <Fiora> kmc: they definitely should never, like, ask the kids how they feel
01:25:18 <kmc> well at one end of the spectrum you can't right
01:25:22 <Fiora> because the true victims are the poor parents
01:25:23 <kmc> because the kids never talk, ever
01:25:23 <Bike> "YouTube star who rose to fame after hilarious drunk makeup tutorial now has more than one billion hits and 8.2 million subscribers"
01:25:27 <elliott> Fiora: um i heard autistic kids don't have emotions
01:25:29 <elliott> 100% science fact
01:25:44 <elliott> from the institute of official science
01:25:49 <kmc> i mean it's not like 'autistic' means 'kinda socially awkward guy on reddit'
01:25:56 <Bike> He loves impersonal sex, should I worry?
01:26:09 <Phantom_Hoover> impersonal sex
01:26:14 <kmc> impersonational sex
01:26:16 <Phantom_Hoover> is that like sheet with a hole sex
01:26:21 <kmc> ghost sex
01:26:22 <Fiora> sorry, I have feelings about this <_>
01:26:37 <elliott> kmc: well it's disingenuous to imply that "autism" in general refers to extreme cases
01:26:38 <Bike> ok i'm doing it i'm going to read this article
01:26:41 <Bike> or at least look at it.
01:26:55 <kmc> elliott: sure, I think we can agree that it's a spectrum and people are complicated and Blah Blah
01:27:40 <Bike> "My partner of four years often asks me to lie still in bed, as if I’m asleep, while he makes love to me. He is particularly turned on if I’m lying on my tummy.
01:27:41 <elliott> and in general it is widely interpreted as "autistic people cannot X" when what it actually means is "autistic people X differently but my perspective is too blinkered to understand it, isn't it tragic"
01:27:43 <Bike> Read more: http://www.dailymail.co.uk/femail/article-2305384/Rowan-Pellings-sex-advice-column-He-loves-impersonal-sex.html#ixzz2QUW4WnFA
01:27:49 <kmc> elliott: yeah
01:27:54 <Fiora> it doesn't even mean that
01:27:58 <kmc> all the same nerds focus on the least extreme manifestations, ime
01:27:58 <FreeFull> I know a couple of guys with aspergers
01:28:02 <Fiora> it means "some people described as autistic do X differently"
01:28:11 <Fiora> "autism" is a description, not a disease
01:28:11 <FreeFull> I think
01:28:23 <FreeFull> I'm magnetic to people with aspergers for some reason
01:28:35 <Bike> you may already be... an internet user
01:28:36 <kmc> imo most psychiatric 'diseases' are essentially 'descriptions', i'm not sure how you would distinguish them
01:28:40 <elliott> Fiora: yeah, I was generalising (I have a professional™ official™ aspergers diagnosis™)
01:28:42 <FreeFull> Also, I can't tell they have aspergers unless they tell me
01:28:47 <Fiora> http://fioraaeterna.tumblr.com/post/47935156276/hedgehoglike-this-post-is-some-personal <-- this is a good post
01:28:50 <elliott> or maybe it was one of the fancier autism diagnoses, I don't actually remember
01:28:57 <elliott> generalising, simplifying, whatever
01:28:58 <Fiora> elliott: I'm PDD-NOS, yay
01:28:59 <elliott> "same thing"
01:29:00 <Phantom_Hoover> Fiora, egotist
01:29:03 <Bike> kmc: certainly they're not something you can "cure".
01:29:21 <Bike> especially something developmental, come on people.
01:29:22 -!- Tod-Autojoined2 has changed nick to TodPunk.
01:29:22 <kmc> it depends, mostly not tho
01:29:36 <Bike> it means development is different. you can't just erase years of that.
01:30:14 <Bike> "The key thing is that you say your boyfriend is a kind, salt-of-the-earth type — not a brooding Marquis de Sade.
01:30:17 <Bike> Read more: http://www.dailymail.co.uk/femail/article-2305384/Rowan-Pellings-sex-advice-column-He-loves-impersonal-sex.html#ixzz2QUWiWiFo
01:30:20 <Bike> ugh fuck
01:30:24 <kmc> what have i done
01:30:36 <Bike> right i'm done now
01:30:39 <Bike> back to the mental
01:30:43 <Phantom_Hoover> Fiora, i like how ~the autism spectrum~ is, like, a general breakdown of human psychological traits
01:30:55 <Bike> well it is
01:31:07 <Fiora> Phantom_Hoover: that's because "autism" is a description/pathology of human psychological traits <.<
01:31:39 <Bike> or rather the point of the Pink Floyd diagram is to show how the developmental differences result in different levels for psychological traits
01:31:40 <Phantom_Hoover> it seems so hopelessly general...
01:31:54 <Bike> mental illness is like that
01:32:12 <Bike> you threaten suicide so they put you on meds that have suicidal ideation as a side effect
01:32:12 <doesthiswork> whats cool to me is that some genes reliably result in autism
01:32:15 <Bike> minds are weird
01:32:17 * Sgeo was diagnosed with Asperger's. At least, according to my dad.
01:32:27 <Sgeo> It was kept a secret from me for a long time.
01:32:30 <Fiora> I think generally "autism" is diagnosed by some more specific symptoms, rather than generalized things? like stimming and the sensitivities and so on
01:32:37 <elliott> Bike: i like how the daily mail has javascript to make people link to the daily mail when they quote them mockingly
01:32:37 <Phantom_Hoover> Sgeo, oh my god
01:32:56 <Fiora> I'm not an expert though or anything
01:33:04 <Bike> elliott: i have contributed a twentieth of a cent to their coffers ;_;
01:33:54 <mnoqy> Sgeo: ...
01:34:03 <Bike> the major thing to remember about diagnoses i think is that there's a criterion, explicit or implicit (because you wouldn't seek mental help), of "impairs normal function"
01:34:23 <Bike> if you see dancing elephants but still have a fairly normal life you might never walk to the doctor and find out
01:34:51 <elliott> Bike: sort of gets trickier when there are children involved (which i think is the case for the majority of autism diagnoses?)
01:34:53 <Phantom_Hoover> Bike, there is a rich vein of Sgeo coming to the surface
01:35:13 <Bike> diagnostic criteria aren't some kind of rubric to fulfill, they're basic guidelines for psychiatric professionals to figure out what's good for an individual patient
01:35:20 <Phantom_Hoover> suggest we focus on this
01:35:21 <Bike> elliott: oh, sure.
01:35:26 <Sgeo> 'Autism' was on ... some paperwork, and when I saw it, my parents said something about them lying to the school to make sure I had services. I thought I only had ADHD. I guess they were both lying to the school and to me...
01:35:29 <pikhq_> Autism, by merit of being a developmental disorder, tends to have much greater *impact* when you're younger.
01:35:39 <Phantom_Hoover> Sgeo.....
01:35:41 <Bike> I'm really not comfortable making fun of Sgeo for being autistic, if that's what you're alluding to.
01:35:48 <Phantom_Hoover> no, Bike
01:35:54 <Phantom_Hoover> that... is not what i am alluding to
01:35:57 <Bike> ok
01:36:04 <pikhq_> Like, now I broadly resemble normality for certain definitions thereof.
01:36:12 <pikhq_> But when I was 3 I couldn't speak. At all.
01:36:21 <Fiora> I didn't speak until I was um... about 3 and a half, I think
01:36:24 <doesthiswork> I'm comfortable making fun of Sgeo but I don't know any jokes
01:37:30 <elliott> i like how the world's largest autism charity literally wants to get rid of autistic people
01:37:37 <elliott> THX 4 THA SUPPORT
01:37:41 <Phantom_Hoover> i think i could talk when i was two but i was, like, raised by a crazy nanny from the highlands
01:37:43 <Fiora> elliott: yeah ;-;
01:37:47 <pikhq_> Yeah, those guys are assholes.
01:37:57 -!- conehead has quit (Ping timeout: 276 seconds).
01:37:58 <Fiora> and they literally have no autistic people working for them
01:38:07 <pikhq_> As a matter of policy no less.
01:38:15 <doesthiswork> wow
01:38:25 <elliott> Fiora: can't have crazies working for your serious charity obvs
01:38:26 <Sgeo> I had an aspy friend who did stuff for them, I think
01:38:40 <doesthiswork> and just for the record vaccinations have no relation to autism
01:38:45 <Fiora> of course not <_>
01:38:48 <Phantom_Hoover> thanks doesthiswork
01:38:53 <Phantom_Hoover> i wasn't sure
01:39:11 <pikhq_> doesthiswork: But but thimerosol!
01:39:28 <Phantom_Hoover> thiomersal you UNEDUCATED FUCK
01:39:33 <Sgeo> Does Autism Speaks actually promote anti-vax garbage?
01:39:39 <pikhq_> Sgeo: No.
01:39:50 <pikhq_> They're assholes, not utterly ignorant assholes. :P
01:40:20 <Bike> pikhq_: http://en.wikipedia.org/wiki/Autism_Speaks#Position_on_vaccines
01:40:22 <elliott> well, http://en.wikipedia.org/wiki/Autism_Speaks#Position_on_vaccines
01:40:29 <Bike> (they're utterly ignorant assholes)
01:40:32 <elliott> wow Bike how dare you
01:40:32 <pikhq_> Oh, never mind.
01:40:34 <elliott> stealing my link
01:40:37 <Bike> fuck off elliott
01:40:38 <doesthiswork> Phantom_Hoover: several hundred messages ago is too far to read
01:40:40 <elliott> can i kick you for that (i am asking because i am responsible)
01:40:42 <pikhq_> Well, fuck them.
01:40:50 <Bike> elliott: what's my optimal kicked status
01:40:55 <zzo38> I read about Autism Speaks somewhere, and someone made up "Neurotypical Speaks".
01:41:03 <Bike> wow, that sounds even worse!
01:41:11 <elliott> Bike: like maybe half kicked?
01:41:12 <elliott> can we achieve that.
01:41:15 <Bike> hm
01:41:17 <Sgeo> There was a parody site called ISN'T somewhere
01:41:18 <Bike> only one way to find out
01:42:20 <Fiora> Bike: woooow
01:42:23 <Fiora> they're even worse than I imagined
01:42:42 <Phantom_Hoover> http://www.sentex.net/~nexus23/naa_03.html here have a large repository of complaining about such things
01:42:44 <mnoqy> hey guys i havent been paying attention whatd i miss
01:42:56 <pikhq_> Autism and nothing but.
01:42:57 <Bike> shittiness
01:43:17 <Phantom_Hoover> hey
01:43:21 <Phantom_Hoover> the daily mail also
01:43:30 <Sgeo> Sounds more like wasting money than spreading the bad idea?
01:43:31 <Phantom_Hoover> oh wait you were here for that
01:43:33 <Bike> Phantom_Hoover: wow, i've never seen "behaviourism" used in that sense...
01:43:33 <Phantom_Hoover> n/m
01:43:52 <mnoqy> pikhq_: sounds miserable
01:44:04 <Bike> Sgeo: as it alludes to, having a big organization taking that shit seriously gives parents more cause to believe that shit.
01:44:04 <pikhq_> Perhaps we should discuss butts instead.
01:44:07 <mnoqy> even worse
01:44:12 <mnoqy> let's go back to autism :-)
01:44:20 <Bike> buttism
01:44:33 <Fiora> maybe the wonderful stereotypes, like how autistic people don't have empathy
01:44:52 <pikhq_> Oh, those are *grand*.
01:50:21 -!- Jafet has quit (Read error: Connection reset by peer).
01:50:51 <Phantom_Hoover> @ask fizzie is oklopol real
01:50:51 <lambdabot> Consider it noted.
01:51:44 -!- Jafet has joined.
01:53:03 <elliott> oklofok: hi
01:53:50 <Bike> folk??
01:54:18 <Phantom_Hoover> whoah, oklofok backwards is kofolko
01:56:39 <mnoqy> and oklopol backwards is lopolko! who'dve guessed
01:56:48 <oerjan> folk and polka
01:56:50 <Bike> blowin' my mind here
01:56:59 <FreeFull> Well, I'm stupid
01:57:13 <elliott> Bike: man have you even been around when oklofok has been active. you're missing out on so much cultural enrichment
01:57:13 <Bike> Unlikely
01:57:18 <FreeFull> How do I make a LIFO data structure in haskell?
01:57:34 <Bike> ...a stack?
01:57:40 <Bike> wait no that's backwards isn't it
01:57:41 <FreeFull> No, stacks are fifo
01:57:43 <Bike> god i hate the lifo fifo thing
01:57:58 <FreeFull> You can use lists for fifo
01:58:55 <Bike> http://cvs.haskell.org/Hugs/pages/libraries/base/Data-Sequence.html has enough for queueing, i guess
01:59:30 <kmc> yeah Seq is a fine queue
01:59:36 <Bike> i mean wouldn't it be basically the same as in any language
01:59:37 <kmc> even a fine deque
01:59:59 <kmc> Bike: well in most languages the expectation is that you'd be mutating a structure, not producing a new one
02:00:08 <Bike> yeah but past that.
02:00:19 <kmc> you can make mutating data structures in Haskell, and you can (and should) make persistent immutable data structures in other languages
02:00:23 <kmc> but the default is different
02:00:28 <elliott> Bike: ok bike. i know you're a bicycle
02:00:34 <Bike> hello
02:00:34 <elliott> but if the url has /Hugs/ in it
02:00:36 <kmc> Bike: it's a pretty deep difference
02:00:38 <elliott> you're linking to something from 2006
02:00:47 <kmc> see Okasaki, _Purely Functional Data Structures_
02:01:02 <elliott> http://hackage.haskell.org/packages/archive/containers/0.5.2.1/doc/html/Data-Sequence.html
02:01:07 <Bike> elliott: it's two seconds of googling.
02:01:30 <elliott> you should see the number of people that join #haskell and ask about why they can't find a function in some random ancient version of a package's docs :(
02:01:38 * elliott old, weary
02:01:41 <oerjan> <FreeFull> No, stacks are fifo <-- um no you _are_ getting this backwards.
02:01:44 <kmc> if you want amortized time guarantees on persistent data structures then you actually need laziness in order to avoid duplicating work between different 'timelines'
02:01:55 <kmc> it's kind of neat
02:02:16 <FreeFull> oerjan: If I push something onto a stack
02:02:17 <Bike> elliott: hello, so has glasgow university gone anywhere with that language implementation?
02:02:19 <FreeFull> And then pop
02:02:24 <FreeFull> I get exactly what I just pushed
02:02:25 <FreeFull> FIFO
02:02:31 <elliott> FreeFull: you push 1, you push 2
02:02:32 <kmc> FreeFull: try pushing two things
02:02:32 <elliott> you pop, you get 2
02:02:36 <Bike> i heard it was lazy
02:02:38 <elliott> you pop, you get 1
02:02:46 <elliott> you pushed 1 first and it came out last, hence FILO
02:03:02 <Jafet> Bike: they got sold out to microsoft at some point
02:03:04 <FreeFull> elliott: Oh, right
02:03:06 <Bike> seriously though what's the point of the fifo thing, i learned that in boringclass but i don't think it particularly helped
02:03:08 <elliott> push 1 -> push 2 -> pop (1) -> pop (2) would be FIFO, because you pushed 1 first and got it out first
02:03:10 <Bike> Jafet: micro$oft
02:03:37 <FreeFull> Bike: FIFOs are for buffers and pipes and stuff
02:03:39 <Jafet> Microdollaroft
02:04:06 <Bike> I know the point. I don't know why you'd move out that description from just general data structure everything.
02:04:07 <FreeFull> And simple caches
02:04:21 <FreeFull> Ok, so stacks are LIFOs, what's a simple FIFO
02:04:28 <Phantom_Hoover> a queue
02:04:34 <Phantom_Hoover> (ue?)
02:04:52 <Bike> qeuue
02:04:56 <Jafet> > (++"ue") `iterate` "Q"
02:04:57 <lambdabot> ["Q","Que","Queue","Queueue","Queueueue","Queueueueue","Queueueueueue","Que...
02:04:59 <kmc> q
02:06:04 <FreeFull> > iterate (++"ue") "Hue"
02:06:05 <lambdabot> ["Hue","Hueue","Hueueue","Hueueueue","Hueueueueue","Hueueueueueue","Hueueue...
02:06:19 -!- augur has joined.
02:06:24 -!- augur has quit (Remote host closed the connection).
02:06:45 <FreeFull> I mean, a cons list is a simple LIFO
02:07:04 <kmc> yes
02:07:19 <kmc> a singly linked list is basically a stack
02:07:23 <FreeFull> But I can't think of how you'd declare a datastructure that'd be a FIFO
02:07:35 <Bike> doubly linked list, keep both ends
02:07:54 <kmc> yeah, you can't make an efficient immutable structure that way though
02:07:58 <kmc> you have to copy the whole thing on each step
02:08:12 <kmc> a classic immutable/persistent queue structure is composed of two lists
02:08:17 <Bike> i haven't used enough queues to care about how to do it immutably :c
02:08:19 <FreeFull> I don't want to use a list and do two reverses each time or whatever
02:08:43 <kmc> http://stackoverflow.com/questions/69192/how-to-implement-a-queue-using-two-stacks
02:08:59 <doesthiswork> or you could fill a circular buffer
02:09:15 <kmc> that basically does an O(n) reverse only once every n operations, so it's amortized O(1)
02:09:36 <kmc> but this doesn't hold up when you're allowed to hang onto an 'old version' of the structure and use it over and over
02:09:40 <oerjan> FreeFull: the finger tree used for immutable (de)que(ues) in Data.Sequence are quite insanely clever, much more complicated than a list. but i've read they're still quite efficient.
02:09:44 <kmc> working around that is basically what Okasaki's book is about
02:09:49 <oerjan> *trees
02:09:54 <kmc> for the double list queue, then for more complicated things
02:09:58 <FreeFull> Finger trees are crazy
02:10:01 <kmc> edwardk has a good talk about finger trees
02:10:39 <elliott> i think the problem with finger trees is that they are boring
02:10:47 <kmc> they're so easy
02:10:47 <elliott> they are good at everything but they're never excitingly good at anything
02:10:56 <FreeFull> elliott: Monads are boring and look at all the hype
02:11:04 <kmc> :/
02:11:29 <kmc> elliott: dunno I think the annotated ropes in trifecta or whatever are p. exciting
02:11:44 <elliott> well i mean like from an efficiency pov
02:11:49 <kmc> finger tree sequences of big unboxed chunks of text, annotated with source positions and what not
02:13:36 <oerjan> elliott: i was surprised to read that finger trees are more efficient than that pair of lists thing
02:14:06 <elliott> for zippers?
02:14:15 <oerjan> for queues
02:14:22 <elliott> ah
02:14:33 <oerjan> but basically for anything not efficient with a single list
02:15:57 <Jafet> elliott just can't stand the numbing genericity
02:16:10 <oerjan> which means that there's basically little reason to avoid Data.Sequence
02:16:59 <oerjan> once a single list doesn't fit
02:17:10 <Sgeo> I should learn what finger trees are
02:17:12 -!- conehead has joined.
02:17:59 <elliott> Sgeo: http://apfelmus.nfshost.com/articles/monoid-fingertree.html
02:20:08 <Sgeo> apfelmus is pretty awesome
02:20:15 <Sgeo> I should read more of eir articles
02:21:13 <Bike> what's "apfelmus" mean
02:22:54 <Sgeo> what's "Bike" mean
02:23:04 <Bike> it's an abbreviation for "bicycle"
02:23:11 <Bike> so called because it has two cycling wheels
02:23:25 <Gregor> Mother of God...
02:23:27 <Sgeo> what's "monqy" mean
02:23:33 <Sgeo> what's "Sgeo" mean
02:23:41 <Bike> `? monqy
02:23:46 <Bike> dunno about no sgeos, though.
02:23:48 <HackEgo> The friendship monqy is an ancient Chinese mystery; ask itidus21 for details.
02:23:58 <kmc> haskell report says 'The results of exceptional conditions (such as overflow or underflow) on the fixed-precision numeric types are undefined; an implementation may choose error (_|_, semantically), a truncated value, or a special value such as infinity, indefinite, etc.'
02:24:03 <Bike> Gregor: did i just blow your mind
02:24:07 <kmc> does this allow actually Undefined Behavior in the C sense
02:24:12 <Bike> kmc: ieee floats are for suckas
02:24:13 <Gregor> Bike: Yup.
02:24:20 <elliott> kmc: i think that's just implementation-defined behaviour
02:24:28 <kmc> breaking type safety, preceeding code optimized out, flying monkeys out of ass, etc
02:24:33 <kmc> yeah, I think so too
02:24:39 <kmc> Haskell Report is frustratingly vague sometimes
02:24:41 <elliott> kmc: that is very interesting though -- it means Int32 can contain a value representing infinity
02:24:44 <Bike> kmc: well it has a pretty simple list there though
02:24:46 <elliott> how weird is that
02:24:54 <Bike> truncation, bottom, a special
02:25:01 <elliott> Bike: "etc."
02:25:07 <kmc> "etc"
02:25:11 <Bike> pretty sure that's referring to the special values
02:25:18 <Bike> (language lawyer GO)
02:25:22 <kmc> ianal
02:26:12 <Bike> «(slang) A promiscuous woman; from “the town bike (everybody rides her)”.» btw this is me
02:26:18 <Jafet> I, anal
02:26:19 <kmc> ^5
02:26:29 <Bike> «(Scotland, Northern England) A nest of wasps or hornets.» wait no this one
02:26:44 <elliott> a promiscuous nest of wasps
02:26:53 <Bike> yes. that is me.
02:26:54 <Bike> perfect
02:26:57 <kmc> http://orangecounty.craigslist.org/zip/3739834928.html
02:26:59 <elliott> Gregor: what do you feel your optimal voiced status is right now
02:27:18 <Bike> That's weird though, I woulda thought "bike" would come up in that 18th-century Scottish insect biology book i read
02:27:54 <Gregor> elliott: +½v
02:28:00 <elliott> Gregor: hmm
02:28:11 <elliott> Gregor: does that mean I should devoice you for a while and then turn it back on?
02:28:30 <Bike> Maybe you could find someone who's like the anti-gregor, but not entirely, and voice that personinstead of Gregor.
02:28:31 <Jafet> You could mute hackego
02:28:33 <Phantom_Hoover> set it up so blah blah blah radioactive devoices him
02:28:44 <Phantom_Hoover> then don't look at the user list for a while
02:28:51 -!- conehead_ has joined.
02:29:00 <Bike> kmc: gallons of bees.
02:30:10 <elliott> Bike: wouldn't that be -1v
02:30:19 <elliott> or something
02:30:23 <Gregor> elliott: Well, how low-quality microwaves at half power level work is by rapidly toggling between fully on and fully off.
02:30:33 -!- Koen__ has quit (Quit: The struct held his beloved integer in his strong, protecting arms, his eyes like sapphire orbs staring into her own. "W-will you... Will you union me?").
02:30:36 <elliott> Gregor: right but... we can't go too rapid
02:30:36 <Gregor> So I think my +v status should be toggling, say... oh, fifty times a second?
02:30:37 <Bike> elliott: no he's not /entirely/ anti gregor
02:30:39 <elliott> it would be a bit spammy!
02:30:44 <Bike> wait i guess you'd need to keep gregor voiced too
02:30:46 <Phantom_Hoover> voice someone who is half like gregor
02:30:48 <Bike> gosh this is hard
02:30:54 <elliott> hm
02:30:57 <elliott> who is kind of like gregor
02:30:59 -!- conehead has quit (Ping timeout: 252 seconds).
02:31:00 -!- conehead_ has changed nick to conehead.
02:31:02 <Bike> pikhq?
02:31:04 <Bike> conehead
02:31:11 <Bike> kmc
02:31:13 <oerjan> <Bike> what's "apfelmus" mean <-- mashed apples hth
02:31:14 <conehead> ?
02:31:30 <elliott> pikhq works sure
02:31:35 <elliott> who's not at all like gregor
02:31:37 <Bike> how do you feel about being voiced, conehead
02:31:51 <Bike> elliott: listofoptions
02:31:55 <Bike> (wow, /names is weird)
02:32:02 <conehead> I would find it incredibly strange
02:32:06 <Gregor> I suggest jix.
02:32:06 <elliott> hm
02:32:10 <elliott> oh good idea
02:32:12 <kmc> elliott, Phantom_Hoover: here's case law regarding employers testing for 'intelligence': http://en.wikipedia.org/wiki/Griggs_v._Duke_Power_Co.
02:32:13 -!- elliott has set channel mode: +v jix.
02:32:38 <elliott> yes, i feel peace and balance
02:32:49 <elliott> we can all breathe easy
02:32:52 <Bike> kmc: lol that quote.
02:33:08 <kmc> looks like it's a pretty narrow prohibition, only for 'artificial, arbitrary, and unnecessary barriers to employment when the barriers operate invidiously to discriminate on the basis of racial or other impermissible classification'
02:33:25 <mnoqy> `seen jix
02:33:28 <Bike> @wn invidiously
02:33:29 <lambdabot> *** "invidiously" wn "WordNet (r) 3.0 (2006)"
02:33:29 <lambdabot> invidiously
02:33:29 <lambdabot> adv 1: in a manner arousing resentment
02:33:31 <HackEgo> not lately; try `seen jix ever
02:33:34 <mnoqy> `seen jix ever
02:33:46 <HackEgo> 2012-06-29 15:54:12: <jix> zzo38: but if you keep the addition and comparision instructions (maybe with an annotation to mark them as belonging together (if llvm does support this)) you wouldn't break existing passes
02:33:57 <Bike> kmc: probably it's not that common to bother administrating IQ tests
02:34:21 <mnoqy> 2012? that's pretty long time ago.
02:34:50 <Bike> kmc: i actually like that majority opinion quite a bit
02:34:56 <kmc> it would be pretty amusing for someone to claim that e.g. algorithms / puzzle questions in programmer interviews are "artificial, arbitrary, and unnecessary"
02:35:20 <kmc> Arousing Resentment is definitely going to be the name of my next band
02:35:24 <Bike> «good intent or absence of discriminatory intent does not redeem employment procedures or testing mechanisms that operate as "built-in headwinds" for minority groups and are unrelated to measuring job capability»
02:35:24 <Phantom_Hoover> but are they invidious
02:36:12 <kmc> i do think the traditional programming interview is hostile to some underrepresented groups
02:36:16 <mnoqy> how do you measure arbitrary
02:36:21 <kmc> not sure if a legal injunction is the right remedy
02:36:29 <kmc> mnoqy: in milliarbitrons
02:36:37 <Bike> probably a culture change
02:36:44 <mnoqy> probably a programming interview is hard with no hands or mouth
02:36:45 <Bike> maybe just get employers out of their own asses?
02:37:17 <Bike> iunno i'm unemployed why would i talk about this
02:37:42 * Sgeo thinks that "it's not what you know it's who you know" should really be fixed
02:37:51 <mnoqy> is that a thing
02:37:56 <mnoqy> you're like a job expert now right
02:38:02 <kmc> it is
02:38:26 <Bike> oh it's definitely a thing.
02:38:30 <Sgeo> How many problems would go away if job interviews were conducted over a chat medium?
02:38:37 <Bike> why do you think you need to provide references?
02:38:39 <Sgeo> With no name but instead an identifier code
02:38:46 <elliott> i would like to proffer the controversial opinion that all of the ills of the world should be corrected, esp. as pertaining to globalised capitalism
02:38:51 <kmc> often some level is, but you really need to know if you can work with this person in person
02:38:57 <elliott> don't hate me for having unpopular opinions!!!
02:39:12 <Bike> elliott: do you have a newsletter i can subscribe to
02:39:25 <elliott> Bike: irc://irc.freenode.net/esoteric
02:39:34 <mnoqy> do you have a radio program
02:39:41 <Bike> Sgeo: of course that wouldn't fix the proble of people from some backgrounds not applying at all
02:40:03 <Bike> i considered making another connection to freenode but that would be a shitty joke.
02:40:05 * Sgeo ... has never thought of that
02:40:14 <mnoqy> advertize it as being a fun time for everyone? see everything has a solution
02:40:21 <Bike> Sgeo: i bet CableVision doesn't get a lot of nicaraguan applicants, you know?
02:40:26 <mnoqy> you can make, like, a mural
02:40:30 <Sgeo> Just of eliminating subconsious discrimination during the interview process
02:40:33 <elliott> chat is also not necessarily better for everyone
02:40:33 <mnoqy> representing people of every minority group
02:40:46 <elliott> just as in-person interviews with a white board are not necessarily good for everyone
02:40:50 <mnoqy> and in rainbow letters you can say
02:40:50 <mnoqy> like
02:40:54 <Bike> `rainbow DIVERSITY
02:41:07 <Bike> i have no idea how hackego works. srry
02:41:08 <kmc> Bike: re hostile to some groups, I think one problem is that programming jobs are typically advertised as "ARE YOU THE BADDEST MOTHERFUCKING HAXOR OF ALL TIME?!? WELL PROVE IT!" and this is a huge turn-off to anyone who's already dealing with impostor syndrome due to membership in a underrepresented group
02:41:18 <mnoqy> "it doesn't matter if you're weird. we love everyone."
02:41:22 <Sgeo> elliott, hmm. Was thinkng too that maybe some sort of intermediary. So that broken English, if it is still understandable, is not discriminated against
02:41:25 <HackEgo> No output.
02:41:30 <Bike> kmc: ha, ha, twenty somethings?
02:41:40 <Bike> `run echo diversity | rainbow
02:41:41 <HackEgo> diversity
02:41:46 <mnoqy> peopl;e can type perfectly broken just look at anyone ever who types broken
02:41:51 <Bike> that's pretty blue, hackego.
02:41:55 <elliott> Sgeo: do you have a perfectly spherical cow to go with your unbiased, incorruptible intermediary :P
02:41:57 <kmc> so the remedy there is both fixing the culture to remove this dumb marketing, but also fixing the educational pipeline so that confidence is more fairly distributed
02:42:31 <Bike> Sgeo: i hope you don't need to be told how negative non-prestige English can be seen, no matter how understandable
02:42:37 <elliott> kmc: i'm the baddest motherfucking haxor of all time. god damn i am bad at hacking. please hire me for sucking
02:43:02 <Sgeo> Bike, hence a person in between who fixes non-prestige English into prestige English
02:43:10 <Bike> that
02:43:10 <elliott> "fixes"
02:43:12 <Phantom_Hoover> i feel like impostor system is symptomatic of a bunch of broader cultural factors than just general equality
02:43:13 <kmc> this is one reason why i <3 OpenHatch, they organize a lot of events that are about helping new people contribute to open source, in a super welcoming environment
02:43:14 <mnoqy> but if it's not marketed for rockstars & ninjas who will we get off on making fun of
02:43:18 <kmc> https://openhatch.org/
02:43:19 <kmc> good people
02:43:22 <Bike> wow that's just a weird thing there, i don't even know how to respond to that.
02:43:26 <elliott> anyway i repeat my previous line
02:43:27 <kmc> you should all donate and get the baby penguin shirt
02:43:31 <Bike> mnoqy: imo The Masses
02:43:49 <Bike> (fuckers the lot)
02:43:52 <kmc> shachaf: you should send Sgeo that story
02:43:54 <mnoqy> hm, you may be onto something
02:43:54 <elliott> a perfectly impartial white-person-ifier to go in the middle is... not what i would call a solution
02:44:10 <elliott> especially since it's not as if all problems are going to magically go away post-interview
02:44:12 <kmc> imo just wear whiteface to job interviews, problem solved right
02:44:41 <mnoqy> send in a robot to interview for you. robots can sound white right
02:44:51 <Bike> wow that would be depressing. also i suppose it's sort of the norm, for certain values of "whiteface"
02:44:54 <kmc> stuff white robots like
02:45:05 <kmc> (btw stuff white people like is super racist, which sucks because it's funny :/)
02:45:18 <Bike> there's this tumblr blog "nasty shit white people eat"
02:45:28 <Bike> and i've seen at least four posts that are native Mexican or whatever
02:45:45 <Bike> fighting the good fight
02:46:02 <Bike> (i'm not sure if i'd eat burritos with mashed potatoes in them unprompted, though)
02:46:15 <mnoqy> internet wars about whether racism against whites is racism are pretty pathetic, imo
02:46:39 <Sgeo> kmc, what story?
02:46:49 <kmc> i don't have the link
02:46:56 <kmc> mnoqy: it's not that it's racist against whites
02:47:09 <mnoqy> racism against everyone else too
02:47:11 <kmc> it's that it's implicitly racist against non-whites by claiming that reading and culture and such are white things
02:47:14 <mnoqy> racism in the large
02:47:26 <Bike> kmc: oh my.
02:47:28 <mnoqy> oh is it one of those blogs
02:47:34 <mnoqy> see i was expecting it to be like
02:47:42 <mnoqy> (stuff white people like) picture of idk something gross
02:48:03 <elliott> its a "arent we white people so funny" thing
02:48:04 <kmc> it's really "stuff upper middle class urbanites like"
02:48:10 <mnoqy> ah
02:48:19 <mnoqy> isn't that "classist" though
02:48:23 <mnoqy> heh heh words
02:48:24 <kmc> prolly
02:48:29 <Phantom_Hoover> no mnoqy
02:48:32 <Phantom_Hoover> it's social racist
02:48:32 <Bike> can't it just be shitty. it's shitty how about that
02:48:36 <Bike> lol.
02:48:43 <Sgeo> Short of... some sort of panel doing interviews instead of a single person... actually, maybe that's a good idea?
02:48:47 -!- Phantom_Hoover has quit (Remote host closed the connection).
02:48:56 <doesthiswork> does anyone know why white people smell like dogs when they get wet? google doesn't help me here
02:48:56 <Bike> Sgeo: i believe that's the procedure for grad school
02:48:59 <Bike> "that works well, right"
02:49:13 <elliott> Sgeo: i don't really get this sole focus on the interview process
02:49:14 <mnoqy> doesthiswork: chemistry and also biology, probably
02:49:43 <Bike> doesthiswork: it's an adaptation of our savannah ancestors to drive off predators
02:49:47 <elliott> Gregor: maybe de-voice jix by now? do you think it's been long enough
02:50:00 <doesthiswork> Bike: thank you, now I know
02:50:14 <Bike> anyway the culture thing reminds me that the "[x] people lack history" is probably the racist thing that most infuriates me (as a white person this is an important opinion to have etc etc)
02:50:26 <FreeFull> Seems TChan was what I wanted all along anyway
02:50:38 <kmc> FreeFull: good choice
02:50:44 <kmc> if you want a mutable channel for use inside STM
02:50:59 <kmc> if you're not using STM then there's plain Chan
02:51:19 <kmc> if you find that every line is (atomically $ somePrimitiveTChanOperation) then consider using plain Chan
02:51:20 <FreeFull> I am using STM
02:51:23 <mnoqy> Bike: do people say that
02:51:24 <kmc> ok cool beans
02:52:01 <Bike> mnoqy: back in the colonial days it was pretty common of europeans to claim that africa had been basically the same for thousands of years and had had nothing worth writing down
02:52:10 <doesthiswork> I'm sure I'm not the first to say this but sinfest just isn't funny anymore
02:52:17 <mnoqy> what's sinfest
02:52:39 <Bike> A webcomic about a webcomic author struggling to deal with his past transgressions
02:52:40 <doesthiswork> http://www.sinfest.net/archive_page.php?comicID=1]
02:52:50 <doesthiswork> http://www.sinfest.net/archive_page.php?comicID=1
02:53:18 <elliott> thanks for... offering your opinion
02:53:22 <elliott> i think?
02:53:23 <mnoqy> when does it get funny
02:53:30 <FreeFull> doesthiswork: When was sinfest funny?
02:53:38 <Bike> mnoqy: 17
02:53:39 <mnoqy> where does "sinfest" appear
02:53:42 <doesthiswork> the first few are pretty funny
02:53:42 <mnoqy> Bike: thanks
02:54:19 <mnoqy> Bike: that wasn't funny
02:54:27 <mnoqy> were you pulling a joke on me
02:54:34 <Bike> Yes.
02:54:36 <Bike> LOL
02:54:39 <mnoqy> dang it!!!
02:54:54 <doesthiswork> bike: achebe reported an anecdote indicating that the english people still don't think africa has history.
02:55:22 <Bike> doesthiswork: yeah it's definitely still around, it was just more explicit back then (as usual with racism, i guess)
02:55:30 <kmc> as Bike pointed out, many wikipedia history articles are like "natives lived here for thousands of years AND THEN WHITE PEOPLE SHOWED UP <remainder of article about is white people>"
02:55:32 <mnoqy> so are we racisting about "these people are racist" now
02:55:50 <elliott> what
02:55:51 <mnoqy> "we" as a humanity
02:56:00 <Bike> racisting all night long, baby.
02:56:07 <doesthiswork> I've always been racist about those people
02:56:19 <mnoqy> and "people" as in like singular of "peoples"
02:56:39 <Bike> yeah i have no idea what you're saying monqy, srry
02:56:48 <mnoqy> :('
02:57:29 <doesthiswork> according the strunk the proper plural of person is persons
02:57:34 <Bike> @tell taneb you like english right http://25.media.tumblr.com/341dfc90a788592e8634c9942b186d42/tumblr_ml9yj4I2aA1qhcj5zo1_500.gif
02:57:34 <lambdabot> Consider it noted.
02:58:04 <mnoqy> what does that have to do with english
02:58:13 <Bike> his name is english.
02:58:13 <doesthiswork> lord english maybe?
02:58:15 <mnoqy> cute wiggle though
02:58:58 <Bike> "Rollership/ The revolutionary way/ evolution/ magazine empire /pirate radio/ television channel/ gallery/ encyclopedia/ library/ The Utopians Guide to the Galaxy/ encyclopedia kosmica/ sonic screwdriver of knowledge...about 10,700entries."
02:59:22 <kmc> put down the bong Bike
02:59:51 <Bike> holy shit this blog has a hit counter
03:00:09 <kmc> <Bike> holy shit this bong has a hit counter
03:00:21 <Bike> it's so high
03:00:53 <Bike> https://twitter.com/OTPGlobal/status/266077784974163968/photo/1/large i've hit the jackpot here
03:01:09 <Bike> i wrote a quick post about some leaked diplomatic cables from ulaanbaatar and now i am stoned as hell
03:01:38 <kmc> what
03:01:46 <kmc> stupid future
03:02:04 <Bike> they're even against water fluoridation
03:02:07 <mnoqy> Bike: what a picture
03:02:22 <Bike> http://25.media.tumblr.com/b60cae94c4bd65d1f61e7b8a21e60915/tumblr_ml8tlzyv3D1qkwdrko1_1280.jpg wake up sheeple
03:04:41 <elliott> i like how the swastika is on top of hitler
03:04:51 <elliott> thus combining the potent comparisons of nazism, and nazism
03:05:21 <Bike> well what if you didn't recognize him. it could be any old guy. but nope with this it's BAM nazifella
03:05:42 <mnoqy> double nazism just to be sure
03:06:32 <kmc> oh yeah the anti-flouride person who posted to the noisebridge list claimed that ALCOA was a subsidiary of I.G. Farben
03:06:41 <kmc> which would be... remarkable
03:06:58 <Sgeo> I don't know what either of those things is
03:07:05 <Bike> me neither
03:07:16 <kmc> Alcoa is a big aluminum company in the US
03:07:30 <Bike> this person had another post that said that now your potatoes could be handled by people wearing protective gear whether you like it or not which obviously tops anything else so i stopped
03:07:36 <elliott> do americans really pronounce aluminium as aloominum
03:07:46 <elliott> like i know they do in bugs bunny cartoons
03:07:49 <elliott> but like in real life?
03:07:55 <Bike> we do.
03:08:05 <elliott> goddamn.
03:08:06 <Bike> well, i do, and i am america
03:08:06 <kmc> I.G. Farben was a German chemical conglomorate that was involved in numerous crimes against humanity during the Third Reich and was disbanded by the allied occupation govt (we used their big headquarters building as the occupation hq)
03:08:22 <Bike> but i spell it "aluminium" because that's the IUPAC recommendation
03:08:27 <Bike> i'm just a shitfucker, i think
03:08:36 <elliott> kmc: i like the idea that they were disbanded just so the building could be used
03:08:39 <elliott> "alright, out"
03:08:43 <kmc> they had a bunch of chemical plants using slave labour (one down the road from Auschwitz-Birkenau)
03:09:07 <kmc> also they manufactured zyklon b
03:09:44 <Bike> I think it's "interesting" how there are like japanese health companies founded by unit 731 members, though
03:09:50 <kmc> ;_;
03:10:29 <kmc> also some of the Americans who testified at the Nuremberg Trials ended up running parts of MKULTRA and other unethical human experimentation programs
03:11:12 <kmc> victors' justice :/
03:12:44 <Sgeo> https://soundcloud.com/eutechnik/dialup
03:13:23 <kmc> Sgeo: http://windytan.blogspot.com/2012/11/the-sound-of-dialup-pictured.html
03:13:54 <Sgeo> Listen to my link anyway >.>
03:13:58 <kmc> i did
03:15:28 <Bike> dyuu dyuuty, NRRRRRRR
03:16:18 <elliott> but i don't want to do my duty bike
03:16:45 <FreeFull> If I have a transaction where I have modifyTVar count (subtract 1) followed by a blocking call, and other transactions depend on count being larger than 0, should I block before the modifyTVar or will I not get in trouble and the transaction will retry?
03:17:09 <kmc> the whole transaction happens atomically
03:17:19 <kmc> it's impossible for code outside that transaction to observe the intermediate state
03:17:29 <kmc> what do you mean by 'blocking call' though
03:17:31 <FreeFull> The blocking only occurs if count is 0
03:17:58 <FreeFull> kmc: The thread stops doing anything until something is put in a TChan
03:18:09 <kmc> that's fine though
03:18:10 <FreeFull> And count is incremented too
03:18:25 <kmc> like i said, other code can't observe the intermediate state
03:18:38 <kmc> you can think of it like, if it reaches that point and finds the TChan is empty, it aborts the transaction and retries from the beginning
03:18:40 <copumpkin> kmc: think you'll ever come back to haskell-land?
03:18:44 <kmc> except it's more efficient than that
03:18:48 <kmc> copumpkin: dunno
03:19:10 <kmc> FreeFull: and I'm not sure if this kind of operational thinking is useful, or if one should just take the guarantees of 'atomically' as given
03:19:12 <Sgeo> Why, what is kmc doing?
03:19:22 <kmc> Sgeo: I haven't done much haskelly stuff lately
03:19:23 <Bike> talking about haskell outside of #haskell?
03:19:30 <kmc> i'm probably not returning to #haskell unless it's changed a lot
03:19:31 <FreeFull> kmc: Ah, so it retries once the TChan has something, assuming another transaction doesn't make the TChan empty again
03:19:51 <kmc> not that it's necessarily horrible and nobody should go there, but, i've put in my time :)
03:20:09 <FreeFull> So I should just learn not to worry
03:20:27 <kmc> yeah, the beauty of STM :)
03:20:30 <FreeFull> and check (c > 0) is unnecessary
03:20:38 <FreeFull> I mean count
03:20:51 <Sgeo> kmc, what do you think about School of Haskell>
03:20:52 <Sgeo> ?
03:20:54 <elliott> kmc: i think #haskell is on the road to recovery a bit
03:21:09 <kmc> FreeFull: if it helps you can look at the implementation of TChan in terms of TVars: http://lambda.haskell.org/hp-tmp/docs/2011.2.0.0/packages/stm-2.2.0.1/doc/html/src/Control-Concurrent-STM-TChan.html
03:21:09 <elliott> or at least I'd like to think it is and try to make it so
03:21:13 <kmc> 'might not help tho'
03:21:15 <kmc> elliott: how so?
03:22:03 <elliott> well, my impression is that some of the common problems are recognised better and that there are people sick enough of them to try and shut them down when they appear. also, there are more active ops now
03:22:10 <kmc> cool
03:22:16 <elliott> it can still be pretty awful mind :P
03:22:16 <kmc> also you're an op
03:22:26 <elliott> yes, as I said, it can still be pretty awful
03:22:30 <kmc> elliott rules with an iron fist
03:22:49 <Bike> /cs clear users
03:22:53 <elliott> i've restrained myself from kicking like five people!!
03:22:56 <elliott> i am a zen master
03:23:06 <mnoqy> how many of them are cheater
03:23:26 <elliott> i said people, not nicks
03:23:53 <mnoqy> how many of them are the people behind cheater
03:23:57 <FreeFull> kmc: Hmm, I didn't expect TVarList
03:24:41 <kmc> it's the same deal as plain chan I think: http://lambda.haskell.org/hp-tmp/docs/2011.2.0.0/ghc-doc/libraries/base-4.3.1.0/src/Control-Concurrent-Chan.html
03:24:54 <kmc> two 'pointers' into a linked list of vars
03:25:02 <kmc> one for reading, one for writing
03:25:45 <kmc> by 'linked list of vars' i mean data ChItem a = ChItem a (MVar (ChItem a))
03:26:35 <FreeFull> I guess it's more efficient
03:26:52 <kmc> than what?
03:27:15 <FreeFull> two TVars of normal lists
03:27:31 <kmc> mm
03:27:36 <kmc> and it gives you the blocking behavior you need
03:27:42 <kmc> where reads from an empty queue block
03:28:13 <kmc> it's not always more efficient though... I know Simon Marlow profiled a bunch of different data structures for the GHC IO manager and found that an IORef holding a pure data structure was best
03:28:26 <kmc> partly due to the fact that atomicModifyIORef is a lockless pointer swap
03:28:42 <kmc> that's also why you can't really have a strict atomicModifyIORef
03:29:41 <FreeFull> You could make the blocking behaviour explicit in readTChan anyway
03:29:46 <kmc> probably, yeah
03:30:01 <FreeFull> It does have TNil -> retry
03:30:03 <kmc> it's easy in STM because you can just 'retry' whenever
03:30:04 <kmc> yeah
03:30:08 <kmc> it's harder for plain Chan i think
03:30:15 <elliott> is today americans doing their taxes day
03:30:19 <kmc> yep
03:30:20 <elliott> there seems to be a lot of that going on
03:30:28 <elliott> what's a tax. what's a taxes
03:30:38 <kmc> it has to be in the mail by the end of Monday
03:30:41 <Fiora> I finished my taxes today yay
03:30:47 <Fiora> I am an adult
03:30:49 <Fiora> I swear
03:30:59 <FreeFull> kmc: Don't MVars have blocking behaviour too
03:31:11 <kmc> yes
03:31:15 <kmc> Fiora++
03:31:30 <FreeFull> Seems to be what Chan relies on
03:31:59 <elliott> i don't even know what doing taxes entails
03:32:04 <elliott> except for lots of forms and presumably being bored
03:32:09 <elliott> i am innocent and pure
03:32:16 <FreeFull> I think I actually finished writing the code a while ago
03:32:21 <FreeFull> Let's see what ghci thinks
03:33:13 <FreeFull> Had one error
03:34:19 <kmc> elliott: it involves ticking a lot of boxes for random crap
03:34:20 <kmc> No, I did not renovate a septic system last year. No, I did not invent any medical devices. No, I did not donate more than 30% of my adjusted gross income to a cemetery.
03:34:32 <elliott> man I did ALL those things
03:34:56 <kmc> come to america then
03:34:58 <kmc> we like your kind
03:35:16 <elliott> imo i don't like your kind
03:35:25 <kmc> :<
03:35:36 <kmc> @elliott
03:35:36 <lambdabot> Unknown command, try @list
03:35:38 <Sgeo> * sucks, * -> * is better
03:36:03 <kmc> oh i get it
03:36:05 <FreeFull> Making new TChans and stuff somehow makes me uneasy inside, despite knowing the garbage collector will get rid of anything once it's inaccessible
03:36:09 <elliott> by your kind i mean generalised america i think
03:36:12 <elliott> MAKING A STATEMENT
03:36:13 <Bike> imo ??
03:36:20 <FreeFull> I blame being used to C memory alloc =P
03:36:57 <FreeFull> My brain just goes "Ooh, I'm making a new thing, gotta free it once I'm done"
03:37:03 <kmc> yeah :/
03:38:14 <FreeFull> Ok, hit only one problem =P
03:38:17 <FreeFull> Forgot to increment count
03:38:47 <FreeFull> Testing code always a good idea
03:38:48 <oerjan> you need to put count in the type system hth
03:38:57 * oerjan runs away
03:39:04 <Bike> Fiora: just got confirmation that the carry flag is used in the sbcl runtime for marking multiple values
03:39:19 <elliott> Bike talked to the sbcl officials
03:39:34 <elliott> oerjan: how will gregor's voice be maintained if my connection drops????
03:39:50 <Bike> just talked to the "wtf is going on" officials
03:39:54 <oerjan> elliott: poorly.
03:39:57 <FreeFull> Perfect, now it works
03:40:03 <elliott> oerjan: IMO this is unacceptable
03:40:36 <FreeFull> oerjan: I wonder how a type system would interact with STM
03:40:44 <Bike> I'm forced to agree with elliott, the voice status of that greg guy is fucking paramount
03:40:56 <FreeFull> Anyway, my code works now
03:42:10 <oerjan> FreeFull: it was hafajoke, although i'm not sure it's impossible
03:42:18 <coppro> who is greg
03:42:21 <coppro> and why doesn't he have voice
03:42:30 <Bike> THE PEOPLE WANT TO KNOW OERJAN
03:42:33 <Bike> http://i.minus.com/ikfmGW73AeBn0.gif this is greg
03:42:34 <FreeFull> oerjan: I would try it if I was working in idris right now
03:42:43 <FreeFull> http://dpaste.org/myaGO/ What I was working on
03:42:54 <FreeFull> Exercise from some pdf on the web
03:43:37 -!- ChanServ has set channel mode: -o elliott.
03:44:18 <oerjan> elliott: FIXED
03:45:45 <elliott> oerjan: no, this is awful. i was trying to maintain +½v harmony.
03:45:52 <elliott> now the lack of oscillation capability results in +2v.
03:46:01 <elliott> this solution was approved by Gregor himself
03:46:04 <Bike> no i like this
03:46:09 <Bike> jix should just be voiced forever
03:46:18 <oerjan> elliott: /msg chanserv access list #esoteric hth
03:46:37 <oerjan> (without the hth)
03:46:39 <Bike> oh man
03:46:44 <Bike> your beautiful
03:46:47 -!- ChanServ has set channel mode: -v jix.
03:47:07 <Bike> what
03:47:09 <Bike> elliott no
03:47:10 <Bike> NO
03:47:17 -!- ChanServ has set channel mode: +v Bike.
03:47:27 <Bike> fuck
03:47:35 <elliott> oerjan: i find this method of enforcing universal balance worryingly indirect. i may have to take drastic measures and make you a wiki admin.
03:48:07 <Bike> man i love places with different power distributions in related places
03:48:34 <kmc> that is a strangely abstract statement
03:48:43 <Bike> well
03:48:56 <kmc> are you referring to the fact that the Northeast Corridor uses 60 Hz power north of the Hell Gate Bridge and 25 Hz power south of it?
03:48:59 <Bike> like on another channel i've been forbidden from ever having ops, but i have mod status on a channel site
03:49:04 <Bike> yes that's what i meant
03:49:08 <Bike> wtf is Hell Gate.
03:49:14 <kmc> http://en.wikipedia.org/wiki/Hell_Gate_Bridge
03:49:16 <elliott> it's a gate
03:49:17 <elliott> to hell
03:49:26 <kmc> it's a narrow tidal strait in the East River in New York City in the United States
03:49:32 <Bike> uh it says bridge right there
03:49:36 <Bike> oh, is it shitty to navigate?
03:49:39 <kmc> yeah
03:49:46 <kmc> 'The name "Hell Gate" is a corruption of the Dutch phrase Hellegat, which could mean either "hell's hole" or "bright gate/passage"'
03:49:54 <kmc> slightly ambiguous
03:49:55 <Bike> i love dutch.
03:50:17 <elliott> The bridge would be the last New York City bridge to collapse if humans disappeared, taking at least a millennium to do so, according to the February 2005 issue of Discover magazine. Most other bridges would fall in about 300 years.[6]
03:50:24 <kmc> In 1851 the U.S. Army Corps of Engineers began to clear obstacles from the strait with explosives; the process would last seventy years
03:50:27 <kmc> that must be fun to watch
03:50:42 <Bike> weakass bridges
03:51:55 <kmc> [.. CSX ..]
03:52:01 <elliott> hm what do you do if you want to set a temporary ban for join/quit spam
03:52:06 <elliott> but are afraid you'll forget to remove it
03:52:16 <kmc> use a client that doesn't suck hth
03:52:21 <elliott> i use irssi
03:52:23 <elliott> sorry i failed
03:53:03 <Bike> elliott: /knockout?
03:53:30 <elliott> whoah.
03:53:43 <elliott> is there a way to do it without the kick
03:53:46 <elliott> kicks are so hostile.
03:54:06 <Bike> uhhhhh probably but i don't know it
03:54:18 <Bike> refer to previous comment about being forbbiden from ops
03:55:01 <kmc> knockout gas
03:55:13 <elliott> okay well i just set it.
03:55:14 <Bike> imo VX
03:55:22 <elliott> Bike, remind me to remove it in like half an hour.
03:55:27 <Bike> alright got it
03:55:33 <Bike> i will be your irssi
03:55:33 <kmc> fentanyl gas
03:57:48 <kmc> fentanyl gas in your ass
03:58:23 <elliott> Bike: why were you forbidden from ops
03:58:38 <elliott> i want to find out. oerjan op Bike
03:58:41 <FreeFull> Should I try to get an hour of sleep?
03:58:58 <Bike> elliott: i think i may be "the elliott" in this other channel, so to speak
03:59:22 <oerjan> shocking
03:59:28 <elliott> wow excuse me
03:59:35 <elliott> "the elliott" is a positive phrase denoting coolness & affability
03:59:41 <Bike> yes i'm those
03:59:45 <elliott> & running yer fuckin wiki for you ungrateful assholes
03:59:47 <Bike> but also inexplicably banned from ops by "the oerjan"
03:59:48 <elliott> :(
03:59:57 <elliott> i wish you could have seen the wiki before i got my hands on it, Bike!!
04:00:02 <elliott> the recent changes was like
04:00:04 <Bike> when was that?
04:00:06 <elliott> literally filled with spam deletions
04:00:08 <elliott> like
04:00:12 <elliott> it was all deleted by ais523 who is a workaholic
04:00:16 <Bike> i mean i've read esolang articles for years
04:00:23 <elliott> but the actual deletion logs clogged out everything
04:00:44 <elliott> and nobody else offered to take it over but elliott, saviour & defender of all that is good
04:00:44 <oerjan> elliott: so pretty much like now, right?
04:01:12 <elliott> oerjan: that's it.
04:01:17 <elliott> oerjan: you know what's going to happen now, don't you.
04:01:22 <oerjan> i'm afraid so.
04:01:27 <Bike> even i know what's going to happen now and i'm high
04:01:34 <Bike> on flouride
04:01:39 <coppro> I don't know
04:01:41 <elliott> oerjan: is this your secret plan to get wiki adminship
04:01:47 <coppro> what's going to happen :(
04:01:53 <oerjan> but i'm afraid i cannot really help against the block logs clogging recent changes.
04:01:54 <elliott> i'm seeing through the meta-layers here, oerjan
04:02:18 <Bike> coppro: the goat will release the fourth seal
04:02:28 <elliott> Bike: btw February 2012 apparently
04:02:30 <elliott> is when I took over
04:02:37 <Bike> mount g will erupt with the screams of demons, who will cover the earth like locusts
04:02:57 <Bike> a third of Man will die in unimaginable pain in the ensuing war
04:03:25 <oerjan> Bike: i suggest not reading revelations hth
04:03:39 <elliott> oerjan: actually i know what's going to happen. you're going to op me and i am going to kick you for that insult
04:04:03 <Bike> oerjan i bet that would h more if you were a wiki admin
04:04:13 <FreeFull> I like STM so far
04:04:18 <FreeFull> No funny in-between states
04:04:24 <oerjan> Bike: but only elliott can upgrade the wiki hth
04:05:02 -!- ChanServ has set channel mode: +v oerjan.
04:05:04 <elliott> take that.
04:05:30 * elliott master of rebellion
04:05:39 <Bike> oh damn! daaaaamn! daaaaaaaaaaaaaaamn
04:05:49 <kmc> when ops is outlawed only outlaws will have ops
04:06:13 <Bike> kmc: i believe that's the premise of ircnet
04:07:34 <FreeFull> ChanServ is the worst outlaw
04:13:24 <elliott> Bike: has it been half an hour yet
04:13:43 <Bike> no
04:14:09 <Bike> doesn't it undermine the point of me being your irssi if you have to check
04:14:34 <zzo38> On channel names starting with + no modes (including ops) are allowed.
04:15:32 <elliott> Bike: i'm anxious!!!!!!!!!
04:15:42 <zzo38> There are also channel types ! meaning that the servers add a hidden prefix to disallow takeovers due to server splits, and & meaning that the channel is local to one server and is not repeated.
04:16:28 <zzo38> Channel type # might be vulnerable to takeovers due to netsplits, but !&+ are all immune to that problem, for different reasons.
04:23:11 <Bike> elliott: ok go for it quick!!
04:27:14 <zzo38> Maybe HTTP code 418 should be defined as a more generalized than "I'm a teapot"?
04:27:31 <elliott> Bike: sorry, i'm going by whenever copumpkin removes it in -blah now
04:27:32 <elliott> you were usurped
04:27:39 <copumpkin> ?
04:27:55 <copumpkin> supdawg
04:28:08 <Bike> :(
04:28:13 -!- Bike has left.
04:28:31 <elliott> copumpkin: i was using bike as an egg timer to remove that joinquit spam ban in #haskell
04:28:40 <copumpkin> oh
04:28:44 <elliott> my slaves all serve me!!
04:31:00 <kmc> itt zzo38 is a teapot
04:52:36 <pikhq_> zzo38: Nah, it should be more specific.
04:52:44 <pikhq_> "I'm a little teapot".
04:52:46 <pikhq_> Clearly.
04:52:52 <shachaf> kmc: What story?
04:54:49 -!- Bike has joined.
04:56:18 <Fiora> Bike: that is so cool
04:56:20 -!- TeruFSX has quit (Ping timeout: 256 seconds).
04:57:04 <Bike> yeah
04:57:05 <shachaf> elliott: How come you're not an op?
04:57:17 <Bike> it's also pretty obvious from looking at disassemblies of trivial functions
04:57:22 <Bike> so, i'm dumb, etc
04:57:24 <elliott> shachaf: ask oerjan.
04:57:45 <shachaf> Is it because you were abusing op powers and also giving the wrong people voice?
04:57:45 <elliott> Fiora: Bike: ok what are you talking about
04:57:52 <shachaf> hi copumpkin
04:57:53 <elliott> shachaf: i still have voice powers
04:57:55 <Fiora> um. an sbcl thing
04:57:56 <Bike> a lisp implementaton
04:57:57 <copumpkin> hi
04:57:59 <elliott> oh that
04:58:02 <Bike> nothing interesting to you!
04:58:08 <elliott> hey i don't hate sbcl!
04:58:12 <shachaf> maybe kmc means i should send Sgeo a link to that story
04:58:15 <elliott> don't paint me as some kind of extremist!
04:58:19 <shachaf> but you haven't even read it yet
04:58:36 <Bike> some kind of sbclist
04:58:51 <Bike> hm this leads to a question
04:58:58 <Bike> is the ghc source comprehensible by mortals
04:59:02 <elliott> sure
04:59:06 <elliott> it's pretty short
04:59:12 <Bike> right i thought so
04:59:14 <elliott> the typechecker is just a few thousand lines of code or whatever
04:59:26 <elliott> the whole thing including all the ridiculous OS support twiddles and so on is 100k lines I think?
04:59:40 <elliott> but the part that does the actual compiling isn't quite as scary.
04:59:41 <pikhq_> That's rather a lot better than GCC.
04:59:42 <shachaf> Is that including the RTS?
04:59:48 <elliott> shachaf: I think so, yeah
04:59:50 <pikhq_> I'd be surprised if its C++ parser is that size.
04:59:51 <elliott> maybe includes base too
04:59:54 <shachaf> Bike: http://www.aosabook.org/en/ghc.html
05:00:09 <Bike> hm i forgot how to get line counts of directories, i suck at unix
05:00:15 <elliott> oh huh
05:00:18 <shachaf> elliott: according to that it was 140,000 compiler and 50,000 rts
05:00:20 <Bike> shachaf: i still haven't read that book :(
05:00:28 <elliott> okay fair enough
05:00:34 <elliott> but a lot of that is the code generator backends
05:00:47 <shachaf> well did those even "exist in 200111"
05:00:55 <elliott> the actual "haskell" parts are like 4k+4k+24k+7k
05:01:11 <elliott> so like 39k.
05:01:13 <elliott> let's say: 40k.
05:01:22 <Bike> in the grim darkness of glasgow
05:01:34 <elliott> "GHC has a complex build system, which today comprises about 6,000 lines of GNU make code."
05:01:40 <Bike> lol
05:01:41 <shachaf> more like wrong-cambridge
05:01:53 <Bike> does anyone actually understand makefiles anymore
05:02:04 -!- augur has joined.
05:02:22 <Bike> anyway i asked because sbcl's source code is basically incomprehensible. parts of it are older than me, it's a weird feeling
05:02:28 <pikhq_> Bike: I speak Make.
05:02:36 <Bike> ok but ur a freek
05:03:45 <elliott> Bike: well parts of GHC might be older than you.
05:03:46 <elliott> how old are you
05:04:12 <elliott> GHC is from, like, 1990.
05:04:13 <shachaf> younger than i am : " (
05:04:14 <Bike> oh ghc is like 1990 too
05:04:19 <Bike> god everything is old
05:04:25 <Bike> i should use something hip and new
05:04:25 <elliott> "Peyton Jones, as well as Simon Marlow, later moved to Microsoft Research in Cambridge, England, where they continue to be primarily responsible for developing GHC."
05:04:28 <shachaf> Bike: ur old !!!!!! !
05:04:29 <elliott> wikipedia is out of date!!!!!!
05:04:50 <shachaf> elliott: smarlow is retired and he's still primarily responsible for developing ghc
05:04:51 <Bike> peyton is a weird name
05:05:12 <Bike> marlow well he should write plays
05:05:43 <shachaf> hey who wants to know the "full name" of spj
05:05:50 <elliott> simon phaskell jones
05:05:53 <elliott> simon "phat" jones
05:06:01 <shachaf> ps it's actually slpj
05:06:27 <shachaf> answer?
05:06:27 <shachaf> Simon Loftus Peyton Jones
05:06:36 <Bike> peyton is still weirdest
05:06:44 <shachaf> you're weirder hth
05:06:55 <oerjan> a lofty name
05:07:08 <shachaf> oerjan: devoice thyself
05:07:32 <shachaf> devoerjan
05:07:33 -!- ChanServ has set channel mode: -v oerjan.
05:07:45 <oerjan> YESSIR
05:07:57 -!- ChanServ has set channel mode: +v oerjan.
05:08:01 <elliott> oh no. there are gremlins.
05:08:11 <oerjan> gremliotts
05:08:30 <elliott> oerjan: you know, all I need is +ARfiorst.
05:08:31 <shachaf> oerjan n o
05:08:40 <shachaf> mnoqy: do you need +ARfiorst
05:08:44 <oerjan> shachaf: btw i didn't really intend to deop elliott but chanserv did it automatically when i gave him the +v flag
05:08:46 <mnoqy> >???? ???
05:08:58 <elliott> oerjan: i can think of a fine way to make up for that mistake!!!
05:09:01 <shachaf> mnoqy: you're the best
05:09:10 <mnoqy> ?????? ?
05:09:24 -!- shachaf has set topic: everyone's caught on to everything you do | is mnoqy rye? 'course he is! | Underhanded C Contest: http://underhanded.xcott.com/?page_id=5 | http://codu.org/logs/_esoteric/.
05:09:54 <mnoqy> rye?
05:09:57 <shachaf> rye
05:10:31 <shachaf> does the mn in mnoqy stand for minnesota
05:10:35 <Bike> +RfiorAst
05:10:37 <shachaf> minnesota oqy
05:10:48 <mnoqy> no
05:11:20 <shachaf> oqay
05:11:25 <shachaf> hey have you considered that
05:11:30 <shachaf> /nick monqay
05:11:34 <shachaf> /nick mnoqay
05:11:48 <mnoqy> m "no" qy
05:11:48 <shachaf> maybe it needs to be sorted
05:12:02 <shachaf> mnoqy: very good mr mister! very good
05:12:49 <shachaf> elliøtt
05:12:56 <shachaf> `? ørjan
05:12:58 <HackEgo> ​Ørjan is oerjan's good twin. He's banned in the IRC RFC for being an invalid character. Sometimes he publishes papers.
05:13:17 <shachaf> oerjan: Where does Ørjan live?
05:13:52 <oerjan> i do not know
05:14:24 <oerjan> he keeps moving to escape my assassins, the impolite scoundrel
05:15:51 <shachaf> Well, there's norway he's in the same country as you.
05:16:28 <fizzie> Presumably the good Ørjan lives either in the North or South, while the wicked oerjan lives in the West or East.
05:16:29 <lambdabot> fizzie: You have 1 new message. '/msg lambdabot @messages' to read it.
05:18:11 <Bike> or both?
05:18:22 <fizzie> @tell Phantom_Hoover oklopol is real if you just believe.
05:18:22 <lambdabot> Consider it noted.
05:18:37 <elliott> fizzie: i have been stripped of my rightful Gregor-neutralising powers
05:18:53 <fizzie> Terrible.
05:19:12 -!- ChanServ has set channel mode: +v fizzie.
05:19:18 <elliott> it truly is.
05:19:32 <elliott> thankfully, oerjan = sqrt(fizzie) + Gregor / i.
05:19:37 <elliott> so balance is temporarily kept.
05:19:47 <fizzie> ChanServ: Why do you keep DOING it.
05:19:50 <elliott> (this is the mathematics of universal balance.)
05:20:02 <coppro> whoa
05:20:05 <coppro> that equation is deep
05:20:23 <coppro> euler's formula has nothing on that
05:20:26 * Bike counts on his fingers
05:20:31 <coppro> elliott, what should I call that wonderful formula?
05:20:41 <Bike> that means like... what does that mean
05:20:44 <Bike> i think there's a one
05:20:53 <elliott> coppro: the truth
05:20:58 <coppro> elliott: deep, man
05:27:33 <shachaf> Hmm, people actually say "god bless you" when you sneeze?
05:27:45 <shachaf> I don't know that I've heard the three-word version before.
05:28:10 <Bike> saint francis of assissi bless you
05:37:02 <oerjan> fizzie: happy birthday!
05:37:21 <shachaf> It's fizzie++ ?
05:37:26 <elliott> is fizzie 30 now
05:37:45 <oerjan> assuming he didn't lie in the logs yesterday
05:38:20 <oerjan> and everyone knows fizzie never lies
05:39:50 -!- doesthiswork has left.
05:40:09 <oerjan> i don't know how many years he is, though
05:41:35 <elliott> i shall celebrate by making oerjan a wiki admin
05:41:56 <shachaf> how about celebrating by making me a wiki dictator
05:43:35 -!- oerjan has quit (Quit: Wikiwiki).
05:48:12 <shachaf> @wiki oerjan
05:48:13 <lambdabot> http://www.haskell.org/haskellwiki/oerjan
05:48:34 <elliott> so wikipedia's favicon changed.
05:48:41 <Bike> the fucking apocalypse
05:49:02 <shachaf> Bike: wait, is *that* how the world ends?
05:49:13 <shachaf> i thought i heard something about fire and/or ice
05:49:57 <Bike> not with a bang but with a favicon
05:50:49 <kmc> haha
05:51:23 <kmc> http://www.marxists.org/favicon.ico
05:51:43 <Bike> is it bad that i'm used to that one
05:52:41 <Sgeo> What's the deal with everyone using .ico format?
05:52:47 <Sgeo> I thought that was a Windows thing
05:53:07 <zzo38> I never use favicons so I won't care
05:53:09 <kmc> some browsers (cough cough IE) only accept .ico format for favicons
05:53:28 <zzo38> But yes .ico is mainly Windows
05:53:29 <shachaf> even ie v. 9
05:53:34 <shachaf> ??
05:53:36 <kmc> Sgeo: and originally you could only specify one by putting it at /favicon.ico
05:53:44 <shachaf> ?? ?? ?? ?? ?? ?? ?where quonochrom
05:53:45 <lambdabot> monochrom says: There are truths, damn truths, and Kripke structures.
05:53:47 <kmc> but now there's a <link> tag for it, and you can use any format with most browsers
05:54:02 <shachaf> kmc: are you going to icfp 2013
05:54:10 <elliott> ?where quonochrom
05:54:10 <lambdabot> ?quote monochrom
05:54:11 <kmc> nah
05:54:17 <elliott> @where quonochrom
05:54:17 <lambdabot> ?quote monochrom
05:54:19 <elliott> disappointed.
05:54:37 <shachaf> are you doing icfpcontest 2013
05:55:02 <kmc> prob not
05:55:07 <kmc> i haven't done one yet
05:55:38 -!- FreeFull has quit (Quit: Cya later).
05:56:07 -!- Bike has quit (Ping timeout: 256 seconds).
05:56:17 <kmc> ~freefull@defocus/sausage-lover
05:56:28 <kmc> the sausage king of Chicago
05:57:32 -!- Bike has joined.
05:57:59 <Bike> http://www.teapartyinspace.org/ y'all ready for this
05:59:36 <elliott> god dammit Bike
05:59:40 <elliott> i am trying to go to sleep
06:00:22 <Bike> maybe you should have told me to tell you to sleep first
06:00:33 <shachaf> instead of that how would you like to read comments of the worst commenter on reddit
06:00:47 <Bike> that's a pretty bad commenter
06:00:50 <shachaf> (the sad part is that he's not the worst commenter on reddit)
06:00:51 <Bike> i'm actually curious
06:00:54 <Bike> oh
06:01:08 <Bike> ok Part Two is this a programming/haskell thing or more broad, badcommenter-wise
06:01:19 <shachaf> yes and yes
06:01:34 <Bike> how ambiguous.
06:02:50 -!- Bike_ has joined.
06:06:06 -!- Bike has quit (Ping timeout: 264 seconds).
06:13:22 -!- Bike_ has changed nick to Bike.
06:14:38 <fizzie> @tell oerjan TANK U
06:14:38 <lambdabot> Consider it noted.
06:14:46 <fizzie> (And 30 is right.)
06:15:26 <fizzie> (Maybe "right" is not the right word. "Correct.")
06:15:44 <shachaf> @hug fizzie
06:15:44 <lambdabot> http://hackage.haskell.org/trac/ghc/newticket?type=bug
06:16:07 <fizzie> Nice command.
06:16:10 <elliott> fizzie: you know what makes you feel youthful? making other people ops. science fact.
06:16:34 <shachaf> fizzie: Happy fizzie++ !
06:18:00 <fizzie> Yay!
06:18:09 <Fiora> oh, it's your birthday? :o
06:18:11 <Fiora> happy birthday!
06:18:26 <elliott> fizzie: i have an alternate request: make it not quarter past seven.
06:18:32 <elliott> fizzie: choose whichever you prefer
06:18:35 <fizzie> Fiora: It's why I started looking at all those birth-date coincidencies in the first place.
06:18:47 <fizzie> elliott: Okay, it's now quarter past nine. (Here.)
06:18:51 <kmc> happy fizzie day
06:18:52 <Fiora> ohhhhh!
06:18:54 <Fiora> happy fizzie day :3
06:19:20 <elliott> fizzie: THAT IS THE WRONG WAY
06:19:22 <fizzie> I know there's all kind of crisises supposed to happen at even years, does 30 have one of them?
06:19:43 <kmc> prolly
06:20:13 <fizzie> I don't know what the signs are, though.
06:20:24 <elliott> crisis: you discover you are a speech recognition researcher
06:20:36 <fizzie> Well, "check."
06:20:45 <shachaf> oh no speech recognition
06:20:49 <shachaf> `quote speech recognition
06:20:51 <HackEgo> 672) <shachaf> fizzie: What kind of speech recognition do you do? <shachaf> If you only need to recognize famous speeches, like Churchill or something, it should be pretty easy.
06:21:23 <Bike> that made me laugh a lot, weirdly
06:21:33 <fizzie> I'm going to celebrate fizzie day by having an old man put scissors in my mouth, it sounds like the best. (They're removing some stitches.)
06:21:35 <mnoqy> thanks shachaf, for the good times & laughter
06:21:45 <shachaf> `run quote monqy | shuf
06:21:47 <HackEgo> 427) <monqy> itidus20: i saw a dancing cgi skeleton named malaria. i danced and played with him. \ 508) <CakeProphet> monqy: help how do I use lambdabot to send messages to people. [...around half an hour later...] <CakeProphet> @messages <lambdabot> quicksilver said 1y 2m 18d 19h 54m 29s ago: you use @tell \ 385) <monqy> it was a wonderful dream
06:21:57 <shachaf> `run quote shachaf | shuf
06:21:58 <HackEgo> 697) <shachaf> elliott: Anyway, if you wrote a Haskell book, I would read it and possibly provide classical criticism. <shachaf> That is to say, non-constructive. \ 942) <kmc> shachaf: LC_ALL=de_DE.utf-8 errno -l <kmc> Veraltete NFS-Dateizugriffsnummer <kmc> Eingabe-/Ausgabefehler <kmc> "Unterbrechung während des Betriebssystemaufrufs" i thin
06:22:10 <shachaf> ?
06:22:12 <shachaf> `quote 942
06:22:13 <HackEgo> 942) <kmc> shachaf: LC_ALL=de_DE.utf-8 errno -l <kmc> Veraltete NFS-Dateizugriffsnummer <kmc> Eingabe-/Ausgabefehler <kmc> "Unterbrechung während des Betriebssystemaufrufs" i think that was in the Ring Cycle
06:22:27 <shachaf> Oh, it has "shachaf:"
06:22:29 <Bike> for some reason it reminds me of this book of Famous Speeches at biztown
06:22:35 <shachaf> `run quote shachaf | shuf
06:22:37 <HackEgo> 628) <shachaf> You should get kmc in this channel. kmc has good quotes. <shachaf> `quote kmc <HackEgo> 686) <kmc> COCKS [...] <kmc> truly cocks <shachaf> Well, in theory. \ 889) <olsner> shachaf: contrary to common belief, #esoteric is not really "a channel for crazy people", but has (ostensibly) a topic... is beaky from finland? \ 865) <sgeo> G
06:22:48 <shachaf> `run quote Bike | shuf
06:22:49 <kmc> shufchaf
06:22:50 <HackEgo> 857) <Bike> "damn, my port of ghc to php isn't properly taking javascript booleans into account" \ 1006) <shachaf> Bike: I think you're ready to learn about lens. <Bike> oh god <Bike> fiora help somebody help <Bike> anybody \ 917) <shachaf> Taneb: STOP TRYING TO GET LENS INTO EVERYTHING <shachaf> Bike: You should use lens! <Taneb> NEVER <Bike
06:23:06 <fizzie> "You should get kmc in this channel" oh if only we had known!
06:23:10 <Bike> eventually it transpires that i am lens
06:23:23 <Fiora> fizzie: isn't the rule that like, the even ones are good, the odd ones are bad
06:24:22 <fizzie> Fiora: I don't think I've heard of that one. I suppose it means the actual birth is one of the good ones.
06:24:32 <kmc> i'm only here because of cheater really
06:24:33 * Fiora was making a bad joke, sorry
06:24:37 <ion> The Look Around You episode about Lens was great.
06:24:41 <Bike> was that a star trek joke fiora
06:24:47 <Fiora> .... <.<
06:24:50 <Bike> if not: i'm sorry that i'm apparently a trekkie
06:24:58 <Fiora> DONT BE SORRY
06:25:04 <fizzie> Ohhh, I also know the Star Trek joke.
06:25:09 <fizzie> For some reason, I just didn't connect.
06:25:21 <shachaf> Fiora: you're not allowed to tell people to not be sorry
06:25:25 <fizzie> It sounded so plausible as a real rule.
06:25:27 <shachaf> Fiora: you apologisze too much for that
06:25:29 <Fiora> but people tell me not to be sorry
06:25:38 <shachaf> Fiora: yes but you apologisze too much
06:25:59 -!- doesthiswork has joined.
06:26:44 <Fiora> >_<
06:26:46 <elliott> i would like to go on the record as not caring whether people are sorry
06:27:16 <shachaf> `run echo '<elliott> i would like to go on the record as not caring whether people are sorry' >> record
06:27:20 <HackEgo> No output.
06:27:25 <elliott> `rm record
06:27:27 <elliott> it's an imaginary record
06:27:28 <HackEgo> No output.
06:27:34 <elliott> like the kind you put music on
06:27:41 <shachaf> um those aren't imaginary
06:27:44 <Fiora> I guess you could say it's now a broken record
06:28:14 <elliott> that was so bad I think it broke my kidneys.
06:28:17 <elliott> who knew they were so sensitive to jokes
06:29:04 <Bike> my kidneys for one are all about jokes.
06:30:16 <Bike> fiora just apologized for something someone else did, elsewhere
06:30:21 <Bike> you're dropping the ball here fiora
06:30:26 <Fiora> I'm sorryyyyy
06:30:33 <shachaf> Fiora.................................................
06:30:44 <Fiora> what >_<
06:30:45 <shachaf> also didn't you read the no compete when you joined this channel
06:30:48 <shachaf> you can't be in any other channel
06:30:57 <Fiora> s-sorry...
06:30:57 <Bike> dropping the very apologetic ball
06:31:06 <Fiora> I guess I can leave if it bothers you...
06:31:20 <Bike> no, you have to stay.
06:31:28 <shachaf> you gotta stay
06:31:35 <shachaf> this channel is now about you
06:31:38 <Bike> it's the rules.
06:31:45 <kmc> eeeek
06:31:45 <shachaf> without you it would collapse around itself
06:31:50 <Fiora> I don't understand...
06:31:56 <kmc> in which #esoteric becomes a bad trip
06:32:03 <kmc> don't scare off Fiora.............
06:32:08 <Bike> Fiora: basically it's cool
06:32:13 <Bike> you're cool. it's all good.
06:32:17 <shachaf> Fiora: sorry, sorry
06:32:18 -!- ChanServ has set channel mode: +v kmc.
06:32:19 <shachaf> don't leave
06:32:21 <Fiora> um. ???
06:32:40 <kmc> why am i voiced
06:32:48 <shachaf> kmc: see window 1 for explanation
06:32:52 <elliott> kmc: nobody knows
06:33:00 <elliott> it just happens without explanation.
06:33:14 <Bike> elliott's gone made with power
06:33:16 <elliott> next thing you know clog will be voiced.
06:33:21 -!- ChanServ has set channel mode: +v glogbot.
06:33:55 <kmc> Bike: would you say he's a made man
06:34:06 <Bike> i uh, i don't get it.
06:34:11 <Bike> so i probably would not say that.
06:34:16 <Jafet> Does clog log clog
06:34:26 <shachaf> Bike: the joke is that you said made
06:34:35 <Bike> oh hey i did
06:34:35 <coppro> Jafet: I believe it clogs the clog log
06:34:38 <Bike> wow i'm good at typing
06:35:14 <Bike> http://24.media.tumblr.com/5d10cd5263f612c74b6a3d974f031091/tumblr_ml98evQd7s1r4kgqlo2_1280.png
06:35:39 <kmc> welp
06:35:41 <fizzie> Soon, everyone is voiced, after which being unvoiced will probably start being the cool thing.
06:36:03 <elliott> fizzie: no. being opped will be the cool thing
06:36:05 <shachaf> fizzie: hey i read a book about that
06:36:06 <elliott> or maybe.......
06:36:07 <elliott> being a wiki admin
06:36:13 <ion> Being unvoiced was always cooler than being voiced.
06:36:23 -!- ChanServ has set channel mode: +v ion.
06:36:26 <ion> A number of channels use +v as the idiot flag.
06:36:27 <fizzie> HA HA
06:36:29 <ion> :-)
06:36:37 <Bike> anyway one of the authors of this paper is named "Rafal Czajkowski" holy shit
06:36:44 <Bike> czajkowski people
06:36:46 <shachaf> elliott: hey got any "wisecracks" for us
06:36:52 <Bike> i don't know how poland ever had problems with names like that
06:36:57 <elliott> i didn't even voice ion
06:36:58 <elliott> it's spreading
06:37:00 <Bike> is that a polish name i don't even know
06:37:02 <elliott> fizzie: imo op me
06:37:20 <shachaf> Wait, elliott has chanserv mode +v now?
06:37:23 <Bike> wow it really is polish
06:37:24 <fizzie> elliott: Sorry, that's more of an oerjan thing. :/
06:37:25 <shachaf> What does that mean?
06:37:41 <elliott> fizzie: no no. oerjan just ops me *temporarily*. I didn't mean anything like that.
06:37:51 <Bike> shachaf: it means he's gone made with voice-/devoice- related power.
06:37:53 <fizzie> shachaf: It means one can /chanserv voice/devoice #esoteric dude, I think.
06:38:03 <Bike> wow that wasn't even intentional that time
06:38:17 <Bike> it wasn't the first time either, but i mean, still
06:38:27 <Bike> " Zbigniew Czajkowski, Polish fencing master; known as "father of the Polish School of Fencing" and coach of champions"
06:39:59 <fizzie> Any relation with Rafal?
06:40:00 <mnoqy> coach of champions, what a title
06:40:26 <shachaf> coach of coaches of champions
06:40:32 <Bike> is copolishness a relation
06:40:39 <fizzie> The Couch of Champions.
06:40:42 <shachaf> what about reverse polishness
06:41:09 <Bike> 'inverse polish' is probably illegal
06:42:26 <elliott> fizzie: consider this: when lament comes a-knocking and the kids are asleep, who will re-ban dbelange...??????
06:42:33 <elliott> who will make sure Gregor stays voiced
06:42:44 <elliott> imagine the national catastrophe (natastrophe) that could occur
06:42:47 <Bike> who the hell is lament and: why
06:42:51 <shachaf> Gregor doesn't need voice
06:43:34 <elliott> Bike: well do you remember lmt
06:43:37 <elliott> from a few weeks ago or whatever
06:43:38 <ion> ENOTSUP 95 Operation not supported
06:43:40 <ion> SUP?
06:44:09 <Bike> um... a bit
06:44:31 <Jafet> `quote lament
06:44:33 <HackEgo> 66) <Sgeo|web> Where's the link to the log? <lament> THERE'S NO LOG. YOUR REQUEST IS SUSPICIOUS AND HAS BEEN LOGGED. \ 276) <lament> elliott: well what i would do if i were omniscient and omnipotent would be to create an immortal woman with perfect tits and bang her for the rest of eternity
06:44:52 <elliott> Bike: he unbanned dbelange and then invited him. and also was generally lament
06:44:59 <Bike> oh! i talked with that person about salvia
06:45:01 <zzo38> This is the message of 'pataprogramming (linked from Wikipedia): http://www.illposed.com/philosophy/pataprogramming.html
06:45:02 <elliott> right yes
06:45:06 <mnoqy> mmmm lots of new user accounts on thew iki today(its still the 14th....:])
06:45:08 <elliott> he is an old channel op who has spent the past years hating #esoteric and only coming back to kick a lot of people and stuff
06:45:14 <elliott> p great
06:45:36 <Bike> awesome
06:45:37 <fizzie> ion: EL2HLT 51 Learn to halt, man
06:45:38 <mnoqy> plenty of accounts yesterday too
06:45:39 <Bike> i love history..
06:45:44 <Bike> ....
06:46:04 -!- ChanServ has set channel mode: +v Bike.
06:46:05 <mnoqy> whoa, someone made a brainfuck derivative derivative
06:46:13 <mnoqy> is that a record
06:46:18 <shachaf> mnoqy: is "derivative" contravariant........................
06:46:22 <Bike> is it a good one?
06:46:28 <Bike> haha j/k but seriously i wanna see it.
06:46:36 <shachaf> mnoqy: arguably almost every bf derivative is a derivative of the original bf derivative . . . . . . . .
06:46:44 <mnoqy> http://esolangs.org/wiki/Noodle_Soup
06:46:59 -!- carado has joined.
06:47:02 <Bike> good old transitive property.
06:47:14 <shachaf> transitive property of derivatives
06:47:16 <elliott> jesus fucking christ it's almost 8 am
06:47:30 <Bike> that's... not what multiprogramming means, is it
06:47:41 <Jafet> That Jesus F. Christ
06:47:44 <shachaf> hey someone should make a "bf derivative" as in bf options or something
06:48:04 <Bike> i guess multiple interpretations of the same code could be kind of interesting if it wasn't dum
06:48:07 * Fiora buys bf call options
06:48:13 <shachaf> or as in differentiation but i don't know how to differentiate a language
06:48:19 <Bike> ok the wiki says that is what multiprogramming means.
06:48:22 <Bike> shachaf: parser combinators
06:48:25 <ion> EDOTDOT 73 http://youtu.be/4Z2Z23SAFVA
06:48:31 <shachaf> Fiora: why are they called call option instead of buying-options
06:48:44 <Fiora> ummmm maybe ask wikipedia
06:49:15 <pikhq_> shachaf: Tricky. Main problem is, derivatives are continuous while languages are discrete.
06:49:21 <mnoqy> http://esolangs.org/wiki/Revolution_9 why does this exist
06:49:29 <shachaf> pikhq_: um, derivatives don't have to be continuous.........
06:49:36 <Jafet> Noodle Soup looks like a derivative of ROP
06:49:37 <shachaf> pikhq_: like derivatives of types!!
06:49:48 <shachaf> pikhq_: https://en.wikipedia.org/wiki/Derivation_(abstract_algebra)
06:49:51 <Jafet> Languages don't have to be discrete
06:50:17 <pikhq_> shachaf: I wasassuming you meant "as per the calculus of derivatives and integrals"; excuse me.
06:50:21 <shachaf> Fiora: okay from now on i'm calling them buying-options and selling-options
06:50:34 <mnoqy> elliott: you're a wiki admin right. -> http://esolangs.org/wiki/Revolution_9 <- check it
06:50:41 <Bike> pikhq_: as usual in math it's pretty common to make shit up notice it's pretty similar and call it the same thing
06:50:47 <Bike> the same fucking thing
06:50:50 <elliott> mnoqy: already chequed it
06:50:59 <Bike> turn me on, dead man
06:51:20 <shachaf> elliott elliott "ur being overly british" "its written check even in britainland.."
06:51:38 <Bike> office of the exchecker
06:51:39 <shachaf> you gotta watch those biritihisihims
06:52:11 <mnoqy> who remembers http://esolangs.org/wiki/FiM%2B%2B from october
06:52:15 <mnoqy> apparently it has its own wiki now
06:53:02 <Bike> wh- oh, tv show
06:53:15 <mnoqy> i hear people like it?
06:53:16 <Bike> after being unable to find pre-existing programming language based on My Little Pony.
06:53:22 <mnoqy> never seen it, myself
06:54:05 <shachaf> mnoqy can i have your autograph
06:54:08 <mnoqy> um
06:54:30 <mnoqy> how--oh i guess i have a tablet i can just plug it in -untangle-
06:54:38 <shachaf> hang on hang on
06:54:50 <shachaf> if you're plugging in your tablet i want a self portrait of something
06:55:13 <mnoqy> ok uhh
06:55:22 <mnoqy> how about one for bike
06:55:28 <shachaf> ooh good one
06:55:33 <shachaf> draw a self portrait of Bike
06:55:42 <elliott> draw me an op campaign poster please
06:55:45 <shachaf> Bike: You're in for a treat.
06:55:52 <shachaf> elliott: no be quiet it's self self portrait time
06:55:59 <mnoqy> bike's never seen a self-portrait has he
06:56:10 <mnoqy> i can draw a self-portrait of elliott's op campaign
06:56:11 <Bike> well, i have
06:56:15 <Bike> er wait
06:56:20 <Bike> am i monqy?
06:56:26 <shachaf> mnoqy: no don't do that
06:56:33 <shachaf> mnoqy: elliott must never become op
06:56:41 <mnoqy> ok
06:56:44 <shachaf> Bike: i hope not
06:57:03 <Bike> yeah me too, he's cooler than I.
06:57:23 <shachaf> mnoqy is the terminal object in the poset category of coolness
06:57:25 <elliott> mnoqy: i want that self portrait
06:57:30 <elliott> i don't care what shachaf says
07:00:47 <shachaf> monqy ARE WE GETTING THAT SELF PORTRAIT OR NOT
07:01:01 <shachaf> sorry for shouting and/or yelling
07:01:03 <shachaf> im so anxious
07:01:10 <mnoqy> sorry sorry gimp's just being awful
07:01:15 <mnoqy> it used to be so much less bad!
07:01:29 <Bike> gimp was always gimp was always bad
07:01:53 <ion> mnoqy: Your nick reminds me of the scroll labeled MNOSOI SHIT i got in crawl once.
07:01:53 <mnoqy> well have you seen it's new pen and pencil tools it's impossible to get them working right all the options are funky
07:02:25 <mnoqy> ion: thanks
07:02:45 <shachaf> mnoqy: i believe in you
07:02:47 <elliott> that one is in ``fuk da sac'' right
07:02:52 <ion> elliott: yeah
07:03:09 <shachaf> mnoqy: you can do anything if you put your mind to it!!
07:04:16 <ion> elliott: I disapprove of your choice of quotation characters.
07:04:25 <elliott> it encodes a specific meaning
07:04:43 <mnoqy> ion: you‘re the “stupid quotes„ guy right
07:05:57 <Bike> coughs
07:06:07 -!- ChanServ has set channel mode: -v Bike.
07:06:37 <shachaf> mnoqy: hey do you still have that self portrait of me
07:06:52 <mnoqy> yeah i have all of them i'll rev the links up
07:07:02 <shachaf> oh here it is
07:07:04 <elliott> no stop i'm trying to sleep
07:07:04 <shachaf> http://dl.dropboxusercontent.com/u/13786158/shachaf.png
07:07:34 <mnoqy> oh nuts i dont have them all in a directory i have to fix that
07:07:40 <shachaf> http://dl.dropboxusercontent.com/u/13786158/monqy.png
07:07:58 <mnoqy> dont forget http://dl.dropboxusercontent.com/u/13786158/eliot.png
07:08:15 <FireFly> shəchef
07:08:23 <elliott> need to revise monqy.png to be misspelled now
07:08:55 <Bike> these are good.
07:09:19 <shachaf> elliott: um shachaf.png isn't misspelled
07:09:23 <mnoqy> ive moved all of them into the portraits directory
07:09:24 <shachaf> so why should monqy.png be
07:09:43 <mnoqy> e.g. https://dl.dropboxusercontent.com/u/13786158/portraits/monqy.png
07:09:53 <shachaf> e.g. http://dl.dropboxusercontent.com/u/13786158/portraits/shachaf.png
07:09:56 <mnoqy> "now organized"
07:10:06 <mnoqy> and i got a good "dynamics" set up in gimp
07:10:14 <mnoqy> now i just have to remember how to draw
07:12:08 <fizzie> Do you have a “workflow”?
07:12:18 <mnoqy> totes
07:12:19 <fizzie> (Those are some amazing portraits.)
07:14:05 <elliott> fizzie: doesn't eliot.png look like the face of someone you can trust
07:14:24 <shachaf> someone i can trust to ruin the channel hth
07:14:40 <fizzie> elliott: Well, yes, but I don't trust myself to make sensible decisions.
07:14:58 <fizzie> (What sort of email reply subject line prefix is "AW:" supposed to be?)
07:15:02 <elliott> fizzie: I do! I believe in you.
07:15:08 <elliott> fizzie: believe that you can believe in me.
07:15:25 <shachaf> fizzie: You should op me.
07:15:52 <fizzie> Oh, "Antwort".
07:16:00 <impomatic> German?
07:16:03 <fizzie> Yes.
07:16:16 <fizzie> Well, it was from Switzerland, but they do a kind of German there.
07:16:48 <impomatic> I thought proper German?
07:17:19 <impomatic> The big three are called DACH or something for Germany, Austria and Switzerland
07:18:09 <fizzie> I am under the impression that "Swiss German" is somewhat dialecty.
07:18:37 -!- ChanServ has set channel mode: -v glogbot.
07:18:39 -!- ChanServ has set channel mode: -v ion.
07:18:40 -!- ChanServ has set channel mode: -v kmc.
07:18:43 <elliott> it is time for austerity.
07:18:57 <Bike> the swiss are all about the dialectic
07:19:43 <fizzie> The Swiss are very dielectric. (It's all that mountain air.)
07:19:44 * impomatic has a website in German. Unfortunately I only speak a bit of German. Fine for email, not so good when people phone :-(
07:27:14 -!- epicmonkey has joined.
07:27:52 <mnoqy> https://dl.dropboxusercontent.com/u/13786158/portraits/bike.png
07:28:27 <Bike> i shall treasure it
07:28:30 <Bike> thank you very much
07:28:39 <shachaf> @hug mnoqy
07:28:40 <lambdabot> http://hackage.haskell.org/trac/ghc/newticket?type=bug
07:28:47 <shachaf> mnoqy: you are the best
07:33:35 <impomatic> Isn't that a Trike?
07:33:46 <mnoqy> isn;t that what Bike is
07:33:48 <Bike> (1) no (2) don't ruin the moment
07:33:54 <shachaf> ==Bike
07:34:22 <impomatic> Sorry, my mistake. Definitely a Bike :-)
07:34:23 <Bike> that circle on the left isn't even connected how could it be a wheel
07:40:43 <shachaf> Fiora: ?
07:43:24 <mnoqy> elliott: https://dl.dropboxusercontent.com/u/13786158/portraits/el-op.png
07:43:55 <shachaf> mnoqy++
07:45:03 <Bike> elliott's op campaign is a talented artist
07:45:14 <shachaf> elliott for nethack player
07:45:17 <shachaf> and/or crawl player
07:48:42 <shachaf> `welcome FireFly
07:48:47 <HackEgo> FireFly: Welcome to the international hub for esoteric programming language design and deployment! For more information, check out our wiki: http://esolangs.org/wiki/Main_Page. (For the other kind of esoterica, try #esoteric on irc.dal.net.)
07:49:05 <FireFly> wrong channel....
07:49:10 -!- epicmonkey has quit (Ping timeout: 245 seconds).
07:49:22 <FireFly> but thanks
07:49:23 <shachaf> Well, this is the channel with the `welcome bot.
07:49:29 <FireFly> Fair
07:53:25 -!- mnoqy has quit (Quit: hello).
08:16:14 -!- doesthiswork has quit (Quit: Leaving.).
08:44:22 -!- DHeadshot has quit (Ping timeout: 258 seconds).
08:50:08 -!- Bike has quit (Ping timeout: 260 seconds).
08:50:50 -!- Koen_ has joined.
08:57:06 <shachaf> ion: hion
08:57:41 <ion> shachaf: hachaf
08:57:52 <shachaf> Isn't #-blah bad?
08:58:18 <ion> #-badh
09:05:10 -!- hogeyui has quit (Quit: Tiarra 0.1+svn-36726: SIGTERM received; exit).
09:08:05 -!- epicmonkey has joined.
09:08:39 -!- hogeyui has joined.
09:09:10 <shachaf> ion ion ion ion
09:10:28 <ion> (unwords . replicate 4) "shachaf"
09:10:53 <shachaf> > replicateM 4 "ion"
09:10:55 <lambdabot> ["iiii","iiio","iiin","iioi","iioo","iion","iini","iino","iinn","ioii","ioi...
09:22:27 <fizzie> fi:ioni == en:ion.
09:22:48 <shachaf> fizzie: how about you op me for a little bit
09:24:22 <fizzie> You'd just kickban everyone, make the topic a link of your for-profit porn site, set up a ritual sacrifice altar in the middle of the channel, I know that.
09:24:26 <fizzie> (As opposed to your non-profit porn site.)
09:34:20 <shachaf> No, I already said what I'd do.
09:34:24 <shachaf> Op me and see!
09:35:12 <fizzie> I did not read that, I'm on a laggy mobile internet.
09:35:52 <shachaf> It was yesterday.
09:38:06 <fizzie> Still, opping all kinds of random "plebs" is more of an oerjan thing, isn't it?
09:38:09 <fizzie> I get a bad rash if I touch the privilege controls.
09:38:43 <shachaf> Don't worry, I'd deop myself within a minute.
09:40:42 <fizzie> Could you recap (in ten words or so) what you were going to do, first? I forgot what it was, if ever I knew.
09:40:56 <shachaf> I was going to: deop myself (but first deop elliott)
09:41:55 <fizzie> Well, I guess that's safe enough, and pointless enough to be accepted by the Spirit of #esoteric.
09:41:59 -!- ChanServ has set channel mode: +o shachaf.
09:42:05 -!- shachaf has set channel mode: -o elliott.
09:42:07 -!- shachaf has set channel mode: -o shachaf.
09:42:12 <shachaf> Thanks.
09:44:45 <shachaf> Hmm,I should've done it in one go.
09:44:54 <shachaf> -oo elliott shachaf
09:44:57 <shachaf> Oh well.
09:55:32 <shachaf> fizzie: Did you hear the new name of this channel?
09:55:36 <shachaf> esoteirc
09:55:43 <shachaf> Because it's esoteric, but it's irc.
09:56:02 <fizzie> That I heard.
09:56:27 <shachaf> fizzie: How should I learn Finnish?
09:57:13 <fizzie> I've heard there's a tutorial-kind of book called "Learn You a Finnish for Great Good!", it's got an elephant on the cover. (I may be mixing things up.)
09:57:47 <shachaf> Hmm. I think you are.
09:57:57 <shachaf> But have no fears. We may still be able to get something useful out of this.
09:57:58 -!- hagb4rd2 has quit (Ping timeout: 258 seconds).
09:58:01 <shachaf> fizzie: How should I learn Haskell?
09:59:36 <zzo38> Learn Haskell by practice; that is best way.
09:59:45 <fizzie> shachaf: Well, I've heard one way is to go live among native Haskell speakers for a while, but that's of course kind of boring. My (Finnish) friend's Chinese wife goes to some sort of daily Haskell course. But I don't really know these things.
09:59:48 <shachaf> zzo38: (Shh. I actually want to learn Finnish.)
10:00:14 <zzo38> Maybe you should also learn Finnish by practice too, then.
10:01:04 <shachaf> `run ls wisdom | grep oe
10:01:06 <HackEgo> No output.
10:01:17 <shachaf> `run ls wisdom | grep ''
10:01:19 <HackEgo> As the wisdom directory contains many files named after nicks, listing it in public annoys people. Try `pastewisdom instead.
10:01:32 <shachaf> `run /bin/ls wisdom | grep oe
10:01:34 <HackEgo> doesthiswork \ oerjan
10:01:41 <shachaf> `? doesthiswork
10:01:43 <HackEgo> no
10:01:57 <shachaf> `run echo yes > wisdom/døsthiswork
10:02:00 <HackEgo> No output.
10:02:17 <shachaf> `? oerjan
10:02:19 <HackEgo> Your evil overlord oerjan is a lazy expert in future computation. Also a lying Norwegian who hates Roald Dahl.
10:02:20 <shachaf> `? Ørjan
10:02:22 <HackEgo> ​Ørjan is oerjan's good twin. He's banned in the IRC RFC for being an invalid character. Sometimes he publishes papers.
10:03:30 <shachaf> `? groups
10:03:31 <HackEgo> groups? ¯\(°_o)/¯
10:03:34 <shachaf> `? group
10:03:36 <HackEgo> group? ¯\(°_o)/¯
10:03:51 -!- hagb4rd has joined.
10:05:17 -!- conehead has quit (Quit: Computer has gone to sleep.).
10:05:57 <fizzie> Grüp theory.
10:07:38 <shachaf> `? œrjan
10:07:40 <HackEgo> ​œrjan? ¯\(°_o)/¯
10:10:03 <fizzie> `run echo 'oerjan øerjan œrjan' | iconv -t ascii//translit
10:10:05 <HackEgo> oerjan ?erjan oerjan
10:10:07 <fizzie> Aw.
10:10:26 <fizzie> (Also, "øerjan"...)
10:24:48 -!- ais523 has joined.
10:25:00 <ais523> @messages?
10:25:01 <lambdabot> Sorry, no messages today.
10:25:09 <ais523> checking for messages helps keep them away
10:28:40 <shachaf> hi ais523
10:28:43 <shachaf> Any exciting news?
10:28:59 <ais523> hmm
10:29:04 <ais523> does it have to be recent news?
10:29:13 <shachaf> I suppose not.
10:29:17 <ais523> I'm sure things have happened, and some people consider them exciting
10:29:25 <shachaf> Answer as you see fit.
10:29:37 <ais523> the further back you go, the more likely you are to find things that are very exciting, to a lot of people
10:29:41 <shachaf> I will allow you to use your good judgment.
10:29:44 <ais523> but hmm
10:30:04 <ais523> I've been having quite a good night/day so far, but the details are reasonably mundane from most people's point of view
10:30:06 <zzo38> It is possible to treat the standard genetic code as a programming language; the following translates to the peptide HELLQWQRLD. TACGTACTTAATAATGTTACCGTTGCAAATCTAATC Can this be modified to code pyrrolysine somehow?
10:30:09 <ais523> I got a lot of writing done
10:30:27 <ais523> and I made some changes to my Pokémon team that have been performing better than expected
10:30:32 <ais523> (although now I have to learn how to play it again)
10:32:32 <zzo38> (This was found on Wikipedia, except for my question)
10:34:36 <zzo38> It says pyrrolysine is usually interpreted as stop codons. Do you know how to fix it so that it does not do so, and can therefore make "HELLOWORLD" instead of "HELLQWQRLD", or are there other problems with that too?
10:36:09 -!- Zerker has joined.
10:43:07 -!- copumpkin has quit (Ping timeout: 252 seconds).
10:43:47 -!- copumpkin has joined.
10:48:05 <fizzie> A @message a day keeps the doctor away.
10:49:21 -!- Zerker has quit (Remote host closed the connection).
10:50:04 -!- Zerker has joined.
10:51:02 <zzo38> See http://en.wikipedia.org/wiki/User:DanielCristofani/Hello_world_program_in_esoteric_languages2
10:55:45 <fizzie> Sometimes I wonder why none of the Befunge Hello Worlds one sees ever use the canonical printing idiom >:#,_ but instead a loop that "looks like" a loop. (I guess it's to illustrate that part of the language.)
10:56:45 <Koen_> what's the point of a befunge Hello World! program if the loop doesn't look like a loop
10:56:51 <Koen_> IT'S BEFUNGE, MATE
10:57:13 <Deewiant> If it works in Unefunge it's not a good illustration of Befunge
10:58:09 <fizzie> But it's the IDIOT. I mean, idiom.
11:00:44 <ais523> fizzie: http://www.quote-egnufeb-quote-greaterthan-colon-hash-comma-underscore-at.info/ uses a oneliner
11:00:58 <ais523> possibly because it'd be hard to parse if it had to use -newline- too
11:24:28 <Zerker> ais523: You're the guy that thought up Checkout right? Are there any available graphics cards for which it can be assembled, or would there need to be a compiler to GLSL/CUDA or similar convolution?
11:25:02 <ais523> Zerker: GPU asm tends to be proprietary, although I think Intel would be happy to give you a reference manual for theirs
11:25:08 <ais523> I'm surprised Checkout gets so much attention, really
11:25:27 <ais523> compiling to CUDA or OpenCL or something would probably make the most sense, though
11:25:31 <ais523> it'd be more portbale
11:25:33 <ais523> *portable
11:25:38 <Zerker> GPGPU is
11:26:00 <ais523> back when I was working on GPU computation a few years ago, the tools weren't very mature
11:26:06 <Zerker> cool, and checkout promises efficiency ^-^
11:26:32 <ais523> OpenCL was pretty rudimentary; CUDA's proprietary tools were good but going backwards
11:26:54 <ais523> they used to include a simulator to emulate the GPU on the CPU so you could debug it
11:27:00 <ais523> but they removed it when they added on-GPU debugging
11:27:39 <ais523> the problem is, turns out you can't put a debugger on the GPU when it's trying to handle rendering the desktop at the same time
11:28:07 <Zerker> haha, I see why that may be problematic
11:28:24 <Zerker> Run all dev tools on a remote X server?
11:28:55 <ais523> we did the reverse, in the end
11:29:02 <ais523> put the graphics card in the server and ssh'd in
11:30:15 <Zerker> Ah, so the debugger was sane enough not to attempt to draw itself
11:30:43 <ais523> that possibility hadn't even occured to me
11:30:57 <ais523> and even now you've mentioned it, I'm having problems visualising it
11:31:21 <Zerker> (as a window in aforementioned "desktop" environment)
11:32:05 <ais523> well what would be saner would be to just have the debugger take over the entire screen
11:32:06 <Zerker> Though directly could be fun too
11:32:09 <ais523> like full-screen games do
11:32:19 <ais523> that way the GPU isn't trying to handle two things at once while stuck at a breakpoint
11:33:22 <Zerker> Except it would still have to draw the debugger. While freezing all the registers etc. you're looking at…parallelism is neat :P
11:33:39 <ais523> yeah
11:33:51 <ais523> now, GPUs can run multiple completely unrelated tasks in parallel
11:33:58 <ais523> that's how the GPGPU stuff works in the first place
11:34:10 <ais523> just when we were working on it, they couldn't do that in debug mode, for whatever reason
11:34:50 <ais523> presumably because breakpointing the GPU can't stop just one equivalent-of-process (I've forgotten the word for it), it has to stop the whole GPU
11:35:09 <Fiora> kernels?
11:35:58 <Zerker> So the Checkout "in parallel, do the same exact thing except with one varying integer" is no longer an accurate representation?
11:36:00 <ais523> Fiora: that's it
11:36:11 <ais523> Zerker: that is accurate, at the lowest levels
11:36:16 <ais523> GPUs are parallel on multiple levels
11:36:23 <ais523> thus the multiple tiers of Checkout
11:36:58 <Zerker> So how hard is it to get to these lower levels on e.g. an RPi? >:D
11:37:12 <ais523> kernels are like level 5 units; the one varying integer thing is a warp, at level 1
11:37:28 <Fiora> I thought only some times could you actually run multiple kernels?
11:37:29 <ais523> err, level 2 is a warp
11:37:31 <ais523> level 1 is a thread
11:37:31 <Fiora> I think it was CUDA 2.0 or something
11:37:38 <ais523> Fiora: that's computational kernels
11:37:42 <Fiora> ah
11:37:49 <ais523> the ones doing rendering have always been able to run in parallel with that
11:38:05 <ais523> because NVidia's customers would complain if they had to use a serial console to run their CUDA programs
11:40:42 <Zerker> And if you can, why would you instead compile to a higher-level language that would just get expanded back out?
11:42:16 <ais523> well compiling to subsets of a higher-level language can be one way to get portability without sacrificing speed
11:42:18 <ais523> have you seen asm.js?
11:43:44 -!- impomatic has quit (Ping timeout: 260 seconds).
11:44:22 -!- Snowyowl has joined.
11:49:06 <Zerker> Reminds me of a lisp VM implemented for PIC controllers, how aggressively can it be optimized though?
11:49:26 <ais523> well the idea of asm.js is a bit of an abstraction inversion
11:49:38 <ais523> it's basically asm compiled to JavaScript in a particularly mechanical way
11:49:48 <ais523> the idea being that JavaScript interpreters can recognise it and compile it back to asm
11:50:00 <ais523> and even the ones that don't recognise it are likely to do a good job of optimising it
11:50:15 <ais523> you could potentially use a similar technique for Checkout, compiling it to OpenCL
11:50:26 <ais523> and then having the OpenCL compiled to platform-specific GPU asm that's similar to the original
11:52:28 <Zerker> How good are the platform-specific GPUs at optimizing OpenCL?
11:53:03 <ais523> I don't know
11:53:16 <ais523> in general, GPU optimization seems very random sometimes
11:53:27 <ais523> one of my favourite GPU stories is a scheduler bug
11:53:43 <ais523> basically, if you asked for 256 threads to run, it ran them in 8 warps of 32
11:53:52 <ais523> if you asked for 257 threads to run, it ran them in 257 warps of 1
11:54:03 <Zerker> eeee
11:54:11 <ais523> because it couldn't make the number of threads in a warp differ from warp to warp
11:54:21 <ais523> also it had to be a power of 2
11:55:01 * Zerker stops checking for primeness
11:55:08 <Snowyowl> it's prime
11:55:36 <ais523> it is indeed prime
11:55:40 <ais523> `factor 257
11:55:40 <Snowyowl> I don't understand enough about GPUs to know why this is a bug.
11:55:41 <HackEgo> 257: 257
11:56:05 <ais523> Snowyowl: imagine you have a dualcore processor, and if you have an even number of processes, it uses both cores
11:56:08 <Zerker> I'm guessing 8x32, and then 1, would have worked better?
11:56:11 <ais523> but if you have an odd number, it only uses one
11:56:13 <ais523> Zerker: yes
11:56:41 <Snowyowl> ah
11:57:24 <Zerker> Is there even any situation where it shouldn't basically step through the binary representation of <number of threads>?
11:57:26 <ais523> Zerker: anyway that bug is fixed on more recent GPUs, it was fixed on the newer ones we tested, just not the older ones
11:57:49 <ais523> so different computers in the lab gave completely different results when drawing a block size vs. performance graph
12:00:54 <Jafet> `factor 11111111111111111111111111111111111111111111111111111111111111111111111
12:00:55 <HackEgo> factor: `11111111111111111111111111111111111111111111111111111111111111111111111' is too large
12:01:06 <Snowyowl> `factor 0
12:01:08 <HackEgo> 0:
12:01:21 <Snowyowl> nonsense, that's the prime factorisation of 1
12:01:27 <Snowyowl> `factor 1
12:01:28 <HackEgo> 1:
12:01:42 * Snowyowl fumes
12:02:45 * Zerker is amused by 0: emoticon
12:03:49 <Snowyowl> 3: 3 is a nicer emoticon
12:04:19 <Fiora> :3
12:05:23 <Zerker> Certainly, but unfortunately isn't recognized as such by my IRC client; however, https://www.dropbox.com/s/nj2nhkln011suny/2013-04-15%2005.02.46.png
12:15:17 <Snowyowl> `quotes
12:15:18 <HackEgo> 753) <elliott> gah <elliott> this language is of the devil <elliott> oklopol: you're meant to use your powers for _good_
12:23:25 -!- carado_ has joined.
12:23:28 -!- Zerker has quit (Remote host closed the connection).
12:24:13 <Snowyowl> !roll 2d6
12:25:32 -!- Phantom_Hoover has joined.
12:31:23 -!- TeruFSX has joined.
12:33:21 <ais523> `quote
12:33:22 <HackEgo> 998) <zzo38> In this timezone is Good Friday today. <zzo38> (It is good because you don't have to go to work)
12:34:05 <Snowyowl> `quote 455
12:34:06 <HackEgo> 455) <ais523> it's probably the same people who were trying to organise gangs of shoplifters as some sort of complex protest against the government's economic policy
12:34:16 <Phantom_Hoover> `quote
12:34:17 <lambdabot> Phantom_Hoover: You have 1 new message. '/msg lambdabot @messages' to read it.
12:34:18 <HackEgo> 973) <Phantom_Hoover> Sgeo_, are you just trying to post kmcbait... * Fiora imagines a cardboard box propped up by a stick with a pile of monads inside. <elliott> Fiora: that is actually what Haskell is.
12:34:38 <Snowyowl> `quote 55
12:34:40 <HackEgo> 55) <oklopol> if a girl is that cute, i don't care how many penises she has
12:34:57 -!- copumpkin has quit (Ping timeout: 252 seconds).
12:35:02 <Phantom_Hoover> `quote
12:35:03 <HackEgo> 361) <coppro> elliott: actually, it's worse right now, I'm in the USA <coppro> where the solution to counterfeiting problems is "add more ink" <coppro> eventually all US bills will just be solid green
12:35:36 -!- copumpkin has joined.
12:37:06 -!- TeruFSX has quit (Ping timeout: 252 seconds).
12:40:27 <Snowyowl> `quote
12:41:04 <HackEgo> 574) <fungot> Ngevd:. i'm so kind, even to assholes! anmaster no not markov anmaster no not markov anmaster no not markov anmaster no not markov anmaster no not markov
12:42:30 <Jafet> fungot, acknowledge your master markov
12:42:30 <fungot> Jafet: no problem. i have started to agree with bradd, here. might be dangerous :) ashinn really believe him or her. what kind of crap is what drives me mad :) which helps in this community
12:48:26 -!- boily has joined.
12:48:27 -!- boily has quit (Client Quit).
12:48:40 -!- boily has joined.
12:48:49 -!- metasepia has joined.
12:49:05 <boily> good morning all! bixi 2013 season is open! WOOHOO!
12:49:42 <Snowyowl> does that mean we get to shoot you? I'm OK with that.
12:50:05 <boily> only if you can catch me, cause I'm on a BICYCLE!
12:58:49 <Phantom_Hoover> `quote
12:58:50 <HackEgo> 951) <fungot> Áis523ÎkËÇÏ52Í¿ÉnÐffjliated/ais523: ever tried reading while confused?
12:59:05 <Phantom_Hoover> `quote
12:59:06 <HackEgo> 155) <ais523> syntax is the least important part of a programming language <ais523> other than Python
12:59:10 <Phantom_Hoover> `quote
12:59:11 <HackEgo> 248) <zzo38> However is probably better to have both queen/king and government in case one does bad thing, the other side can argue to them
12:59:15 <Phantom_Hoover> `quote
12:59:17 <Phantom_Hoover> `quote
12:59:17 <HackEgo> 36) <fizzie> Seconds. 30 of them. Did I forget the word?
12:59:18 <HackEgo> 861) <elliott> Deewiant: um???? You've forgotten axiom 1 of everything: everything sucks
13:01:01 <Snowyowl> `quote
13:01:03 <HackEgo> 692) <fungot> elliott: but, there are imps around, the pad. it's hard to remember though your cross-hairs would never settle on an innocent little girl. chokes up now imagine she's white.
13:01:08 <Snowyowl> `quote
13:01:10 <HackEgo> 634) <Sgeo> I guess only gay people fuck?
13:01:15 <Snowyowl> `quote
13:01:17 <HackEgo> 43) <oklopol> GregorR: are you talking about ehird's virginity or your soda beer?
13:07:21 -!- Snowyowl has quit (Quit: Page closed).
13:13:14 -!- carado has quit (Quit: Leaving).
13:16:59 -!- ThatOtherPerson has joined.
13:24:12 -!- ogrom has joined.
13:36:56 <fizzie> That's a lot of quoting.
14:08:00 -!- Taneb has joined.
14:09:07 <Phantom_Hoover> `quote quoting
14:09:08 <HackEgo> 256) <cpressey> addquoting yourself? isn't that like commenting on your own facebook status? <Gregor> Yup, but I'm JUST THAT AWESOME. \ 799) * oerjan makes a brainfuck derivative for quoting xkcds
14:10:09 <fizzie> `quote zucchini
14:10:10 <HackEgo> No output.
14:10:19 <fizzie> Oh? Curious.
14:13:13 <ThatOtherPerson> `quote cucumber
14:13:15 <HackEgo> No output.
14:15:06 <boily> `help
14:15:06 <HackEgo> Runs arbitrary code in GNU/Linux. Type "`<command>", or "`run <command>" for full shell commands. "`fetch <URL>" downloads files. Files saved to $PWD are persistent, and $PWD/bin is in $PATH. $PWD is a mercurial repository, "`revert <rev>" can be used to revert to a revision. See http://codu.org/projects/hackbot/fshg/
14:15:19 <boily> `pastquote zucchini
14:15:21 <HackEgo> ​/home/hackbot/hackbot.hg/multibot_cmds/lib/limits: line 5: exec: pastquote: not found
14:15:36 <boily> `pastlog zuchini
14:15:49 <HackEgo> No output.
14:15:56 <boily> `pastlog zucchini
14:16:03 <HackEgo> 2006-08-04.txt:22:02:12: <GregorR-W> These are the voyages ... of the starship zucchini.
14:16:17 <boily> not quite what I had in mind, but it'll do.
14:27:05 <ThatOtherPerson> `quote ThatOtherPerson
14:27:06 <HackEgo> 1022) <ThatOtherPerson> Do you have a girlfriend, fungot? <fungot> ThatOtherPerson: there's two.
14:27:50 <boily> ah, I recall that. lucky fungot.
14:27:51 <fungot> boily: and -o1 fnord calls turns it on :) 19:10 tagy se on ihan tossa vieressä! fnord.!. see srfi 1's take
14:58:52 -!- ais523 has quit (Ping timeout: 258 seconds).
14:59:05 -!- FreeFull has joined.
15:02:24 -!- ThatOtherPerson has quit (Quit: Leaving).
15:02:50 <Phantom_Hoover> MEANWHILE ON TWITTER: https://twitter.com/CharlieShrem/status/323792771745984512
15:13:44 <kmc> Boris Johnson wants to build a statue of Thatcher in Trafalgar Square?
15:13:45 <kmc> really?
15:15:24 <Taneb> He is very Tory
15:16:34 <FreeFull> I'd rather have a statue of Gordon Brown than Margaret Thatcher
15:17:09 <Taneb> I wouldn't care for either.
15:17:31 <FreeFull> I mean, if I had to choose between the two
15:17:42 <kmc> i'd rather have a statue of boris johnson
15:17:48 <Taneb> I'm with kmc here
15:17:52 <kmc> because then it would just be a joke and not a slap in the face
15:17:54 <Phantom_Hoover> i really don't get the hate for brown tbh
15:18:27 <Phantom_Hoover> it seems like his main crime as a leader was not being photogenic enough
15:19:27 <FreeFull> I think people think he slacked off too much
15:20:41 -!- ThatOtherPerson has joined.
15:22:44 <Taneb> I think he was more of an unpopular chancellor of the exchequer
15:29:13 -!- carado_ has quit (Ping timeout: 246 seconds).
15:34:41 <kmc> gah i thought 8GB of RAM would be enough for this laptop
15:34:46 <kmc> since the previous one only had 3GB
15:35:24 -!- impomatic has joined.
16:13:31 -!- nooodl has joined.
16:13:36 -!- ais523 has joined.
16:17:44 -!- carado has joined.
16:27:18 -!- conehead has joined.
16:28:50 -!- AnotherTest has joined.
16:36:05 -!- augur has quit (Remote host closed the connection).
16:39:38 -!- Koen_ has quit (Read error: Operation timed out).
16:41:00 -!- Koen_ has joined.
17:07:44 -!- Bike_ has joined.
17:09:05 -!- Bike_ has changed nick to Bike.
17:10:03 -!- sebbu has quit (Read error: Connection reset by peer).
17:10:26 -!- sebbu has joined.
17:11:03 -!- sebbu has quit (Changing host).
17:11:03 -!- sebbu has joined.
17:17:34 -!- sirdancealo2 has quit (Read error: Operation timed out).
17:21:49 -!- augur has joined.
17:23:00 <ThatOtherPerson> I can't help but notice that people seem to be finding their voices.
17:23:36 <Koen_> do you mean like the little mermaid?
17:24:01 <ThatOtherPerson> Well, also fizzie and Gregor
17:24:19 <Bike> pretty sure gregor's a mermaid.
17:24:19 <lambdabot> Bike: You have 1 new message. '/msg lambdabot @messages' to read it.
17:25:08 * Gregor searches him/herself for sexual organs.
17:26:35 <Bike> a merman
17:32:53 -!- sirdancealo2 has joined.
17:33:26 -!- ais523 has quit.
17:33:39 -!- ThatOtherPerson has quit (Quit: Leaving).
17:36:31 <Jafet> Merfish. Oh wait.
17:37:26 <fizzie> Are merpeople werefish?
17:37:47 <fizzie> Or the other way around.
17:40:12 <pikhq_> Hmm. "Were" is Old English for a male human.
17:40:17 <pikhq_> Are there wyfwolfs?
17:43:08 * Phantom_Hoover remembers that when he quit last night Sgeo was explaining how to fix racism
17:43:14 * Phantom_Hoover logreads
17:45:00 <Taneb> I just got 100% on Guitar Hero 3 Medium Difficulty Knights of Cydonia
17:45:25 <boily> quick wiqui question: what the liquid brimstone is that revolution 9 page?
17:46:03 <elliott> fizzie: i would like you to see https://dl.dropboxusercontent.com/u/13786158/portraits/el-op.png
17:48:18 <elliott> boily: it is what we have to expect more of if Gregor ever gets devoiced inappropriately.
17:51:04 <coppro> why can't I be devoiced inappropriately?
17:53:28 -!- ChanServ has set channel mode: -v coppro.
17:56:18 <coppro> elliott: that was clearly appropriate
17:57:01 <elliott> it's not appropriate to devoice someone without voice
17:57:33 <kmc> Taneb: congratst
17:57:59 <Taneb> kmc, I've been trying to do that for ages
18:09:23 -!- epicmonkey has quit (Ping timeout: 258 seconds).
18:10:08 <Phantom_Hoover> elliott, oh my god
18:10:14 <Phantom_Hoover> your handwriting is the girliest ever
18:10:56 <Taneb> I presume "eliot" is my imaginary second middle name
18:11:35 <elliott> Phantom_Hoover: wtf
18:11:37 <elliott> it's monqy's handwriting
18:11:40 <elliott> come on
18:12:37 <Bike> i thought it was elliott's op campaign's handwriting
18:15:21 -!- pib2013 has quit (Remote host closed the connection).
18:19:59 -!- mnoqy has joined.
18:20:01 <Phantom_Hoover> oh
18:20:12 <Phantom_Hoover> mnoqy, you have the girliest handwriting ever
18:20:19 <mnoqy> hi
18:20:51 <shachaf> mnoqy: you should draw a self portrait of Phantom_Hoover
18:21:01 <mnoqy> shachaf: sure
18:21:06 <mnoqy> im eating brunch now though
18:21:25 <boily> shachaf: how can you self-portrait of somebody else?
18:22:14 <shachaf> boily: um, by drawing it?
18:22:24 <shachaf> boily: i didn't say a *self* self-portrait
18:23:29 <boily> oh, my mistake.
18:24:29 -!- ThatOtherPerson has joined.
18:30:58 <ThatOtherPerson> If mnoqy's rye, I'm barley.
18:31:26 <mnoqy> hi
18:31:36 <Taneb> barley legal?
18:31:38 <boily> corn I be a cereal too? I ear that it's a-maize-ing.
18:32:41 <Taneb> The good ol' boys were drinking Whisky in mnoqy
18:53:57 -!- augur has quit (Read error: Connection reset by peer).
18:54:26 -!- augur has joined.
19:15:02 -!- sirdancealo2 has quit (Ping timeout: 245 seconds).
19:19:01 -!- sirdancealo2 has joined.
19:19:01 -!- epicmonkey has joined.
19:19:34 -!- AnotherTest has quit (Quit: Leaving.).
19:20:12 -!- constant has changed nick to function.
19:30:40 -!- ThatOtherPerson has quit (Quit: Leaving).
19:40:20 * impomatic pops in quickly to see if anyone's talking about esoteric programming...
19:41:18 -!- augur has quit (Remote host closed the connection).
19:42:56 <kmc> hi impomatic
19:45:21 <impomatic> Hi kmc :-)
19:45:43 -!- augur has joined.
19:57:01 <Taneb> Phantom_Hoover, help
19:57:09 <Taneb> People on Facebook are talking about bitcoin
19:57:10 <Taneb> Well
19:57:17 <Taneb> Person on Facebook is talking about bitcoin
20:01:09 -!- Taneb has quit (Quit: Leaving).
20:07:15 <kmc> my twitter feed is all bitcoin all the time
20:07:27 <kmc> except that today it's all about bombs that went off at the boston marathon :/
20:08:04 <impomatic> Hmmm... I missed that.
20:08:09 * impomatic goes to read the news
20:08:16 <kmc> pretty fucked up
20:08:22 <kmc> i think everyone I know is safe
20:11:04 <kmc> copumpkin: you're in CT these days right?
20:11:11 -!- mnoqy has quit (Quit: hello).
20:11:39 <kmc> sounds like your colleages in back bay might have been evacuated, hope nothing worse than that
20:13:47 -!- ogrom has quit (Quit: Left).
20:17:10 <Phantom_Hoover> wait
20:17:16 <Phantom_Hoover> why is taneb asking me for help
20:17:25 <Phantom_Hoover> am i like the designated expert on making fun of bitcoin
20:17:27 <Bike> you're The Bitcoin Person now
20:17:28 <Bike> sorry
20:18:50 <boily> I wonder which is worse: being the canadian person, or the bitcoin person.
20:19:58 <Phantom_Hoover> bitcoin person
20:20:05 <FireFly> Prboably being the Canadian bitcoin person
20:20:53 <Phantom_Hoover> also: fuck, watching four lions is going to be even more uncomfortable now
20:23:42 <boily> ~duck four lions
20:23:43 <metasepia> Four Lions (2010) is a British dark comedy film.
20:25:01 -!- bengt_ has quit (Ping timeout: 245 seconds).
20:25:06 <Bike> apparently "jihad satire" is a genre
20:25:39 <Bike> "According to Psychology Today," blugh
20:27:19 -!- bengt_ has joined.
20:32:55 -!- zzo38 has quit (Remote host closed the connection).
20:35:38 -!- Bike_ has joined.
20:36:30 -!- Bike has quit (Disconnected by services).
20:36:31 -!- Bike_ has changed nick to Bike.
20:37:12 -!- Nisstyre has quit (Quit: Leaving).
20:37:51 <Phantom_Hoover> Bike, it's a very good film actually.
20:38:07 <Bike> cool
20:40:03 -!- pib1978 has joined.
20:41:41 -!- bengt_ has quit (Ping timeout: 245 seconds).
20:43:20 -!- bengt_ has joined.
20:47:19 -!- copumpkin has quit (Ping timeout: 252 seconds).
20:47:59 -!- copumpkin has joined.
21:06:41 -!- quintopia has quit (Read error: Operation timed out).
21:06:49 -!- quintopia has joined.
21:10:01 -!- bengt_ has quit (Ping timeout: 245 seconds).
21:11:59 -!- augur has quit (Remote host closed the connection).
21:14:49 -!- bengt_ has joined.
21:20:46 -!- TeruFSX has joined.
21:27:10 -!- epicmonkey has quit (Ping timeout: 258 seconds).
21:32:35 <Phantom_Hoover> http://en.wikipedia.org/wiki/File:Eminent_Domain_50_States.jpg
21:32:40 <Phantom_Hoover> loving that description
21:32:47 <Phantom_Hoover> i guess npov doesn't extend to images
21:32:56 -!- bengt_ has quit (Ping timeout: 245 seconds).
21:33:17 <kmc> heh
21:33:31 <Phantom_Hoover> also loving that it's a jpeg
21:33:50 -!- bengt_ has joined.
21:34:15 <kmc> Phantom_Hoover: http://commons.wikimedia.org/w/index.php?title=File:SIR_448_at_Great_Kills_Station.jpg&oldid=61691747
21:34:22 <Bike> would it being taken down for copyright be ironic
21:34:38 <Phantom_Hoover> ...yes
21:34:40 <Phantom_Hoover> yes it would
21:35:04 <Bike> kmc: holy shit
21:36:26 <kmc> it's not false, it's just not an accurate description of the picture
21:37:34 <kmc> also yes there's a stop on the line named Great Kills
21:37:39 <kmc> blame the dutch
21:37:48 <Phantom_Hoover> fucking dutch
21:37:52 <kmc> New Dorp
21:37:53 <Phantom_Hoover> almost as bad as the swedes
21:38:08 <kmc> low countries more like blow countries
21:38:28 <Phantom_Hoover> amsterdam more like hamsterspam
21:38:34 -!- epicmonkey has joined.
21:42:09 -!- calamari has joined.
21:48:35 -!- function has changed nick to trout.
21:48:42 <boily> :t trout
21:48:44 <lambdabot> Not in scope: `trout'
21:48:52 <trout> boily: ?
21:49:23 <boily> you were a function, therefore you had a type. ischiomorphism seems to have destroyed it, sadly.
21:50:43 <kmc> i want a haskell library for ichthyomorphisms
21:51:26 <Bike> Control.Monad.Blowfish
21:51:56 <boily> ~duck ichtyology
21:51:57 <metasepia> Ichthyology is the branch of zoology devoted to the study of fish.
21:52:13 <kmc> cryptoichthyology
21:52:14 <boily> s/ischio/ichtyo/
21:52:53 <Bike> i guess nessie isn't technically a fish
21:52:57 <boily> with a fish operator: >~)))°>
21:53:54 <kmc> what is it then
21:54:01 <kmc> amphibian?
21:54:21 <Phantom_Hoover> monster
21:54:46 <kmc> monster is not a kingdom
21:54:48 <Bike> a dinosaur
21:55:15 <Phantom_Hoover> monstriae
21:55:18 <Bike> huh, i didn't know dinosauria was actually a clade
21:55:34 <Phantom_Hoover> also: neither is amphibian
21:55:43 <kmc> yeah
21:56:10 <Bike> it's not like a billion different genera names don't mean "monster" or "monstrous" anyway
21:56:32 <Bike> genus that's the singular get it together bike
22:03:21 -!- bengt_ has quit (Ping timeout: 245 seconds).
22:04:31 -!- augur has joined.
22:06:51 -!- bengt_ has joined.
22:12:28 -!- EgoBot has quit (Read error: Connection reset by peer).
22:13:21 -!- bengt_ has quit (Ping timeout: 245 seconds).
22:13:28 -!- EgoBot has joined.
22:14:03 -!- calamari has quit (Quit: Bye).
22:14:23 -!- bengt_ has joined.
22:18:46 -!- bengt_ has quit (Ping timeout: 245 seconds).
22:21:52 -!- bengt_ has joined.
22:22:55 -!- boily has quit (Quit: Poulet!).
22:22:59 -!- metasepia has quit (Remote host closed the connection).
22:32:52 -!- ChanServ has set channel mode: -v fizzie.
22:33:17 <fizzie> It hasn't been fizzie day here for a while, I think I can get rid of the "idiot flag".
22:37:12 <olsner> is that another name for the bozo bit?
22:38:46 -!- bengt_ has quit (Ping timeout: 245 seconds).
22:39:15 <shachaf> What is "the bozo bit"?
22:40:24 -!- ChanServ has set channel mode: +v fizzie.
22:41:20 -!- bengt_ has joined.
22:42:52 -!- carado has quit (Ping timeout: 246 seconds).
22:43:47 <elliott> oh nice
22:43:50 -!- epicmonkey has quit (Ping timeout: 258 seconds).
22:43:56 <elliott> linode credit card numbers have leaked
22:43:58 <elliott> wooooooo
22:44:02 <elliott> maybe i should find another vps provider
22:44:30 <Phantom_Hoover> do you even
22:44:33 <fizzie> I'm at tilaa.com now, because they had such a nonsense explanation for the name.
22:44:34 <Phantom_Hoover> have a credit card
22:44:49 <fizzie> And esp. for the logo.
22:45:09 <Phantom_Hoover> why are they called tilaa
22:46:34 <fizzie> Because it's the Finnish word (more or less) for "space". (Like, empty space; not space space.)
22:46:52 <fizzie> And their logo is a wolf, because the wolf is the king of wide open spaces.
22:46:57 <elliott> Phantom_Hoover: well it might be a debit card thing
22:46:58 <fizzie> Or something like that.
22:46:58 <elliott> i don't know
22:47:07 <elliott> all i know is it's a piece of plastic and used as a credit card for linode
22:47:10 <fizzie> (They're not a Finnish company or anything.)
22:47:27 <elliott> fizzie: you used prgmr previously right?
22:47:32 <fizzie> Yes.
22:48:21 <fizzie> https://support.tilaa.com/entries/22447921-What-does-Tilaa-mean- https://support.tilaa.com/entries/22467097-What-does-the-wolf-in-your-logo-have-to-do-with-Tilaa-
22:48:21 -!- bengt_ has quit (Ping timeout: 245 seconds).
22:48:36 <fizzie> "In Finland, the wolf is the ruler of the open space."
22:48:45 <fizzie> It is kind of "what."
22:49:24 <fizzie> I don't even know if they have any Finnish employees.
22:49:42 <fizzie> Maybe they just randomly picked Finland to mock.
22:49:51 -!- bengt_ has joined.
22:50:21 -!- Bike has quit (Ping timeout: 252 seconds).
22:52:08 -!- Bike has joined.
22:56:16 -!- bengt_ has quit (Ping timeout: 245 seconds).
22:57:50 -!- bengt_ has joined.
22:57:58 -!- Nisstyre-laptop has joined.
23:05:28 -!- nooodl has quit (Ping timeout: 256 seconds).
23:27:56 -!- TeruFSX has quit (Ping timeout: 245 seconds).
23:35:10 <Sgeo> Is there any good reason for forms to be able to POST to other domains?
23:35:51 <Bike> free speech
23:47:57 <kmc> Sgeo: have you read The Tangled Web?
23:48:00 <kmc> really good book on websec
23:48:07 <kmc> i don't know if it has the answer to that question
23:48:12 <kmc> but it's informative and quite entertaining
23:48:45 <Sgeo> Remind me to buy that next week when I have money
23:48:50 -!- btiffin has joined.
23:49:31 <sirdancealo2> form is just a gui to make a http request
23:50:43 <Sgeo> But it doesn't obey same origin policy the way XMLHttpRequest does
23:50:49 <Lumpio-> Same origin policy is so inconsistent .-.
23:50:55 <Lumpio-> Forms existed befor same origin policy did.
23:51:05 <Lumpio-> And they can't possibly remove stuff because then things would break.
23:51:29 <sirdancealo2> telnet doesnt obey same origin policy
23:53:24 <kmc> yeah
23:53:33 <kmc> also cookies don't follow SOP, they have their own slightly different policy
23:54:01 <sirdancealo2> the crunchiness policy
23:54:25 <kmc> just don't get pickles in your cookies
23:54:36 <kmc> websec slash cooking advice
23:54:41 <kmc> don't put pickles in your cookies
23:54:44 <kmc> always salt your hash
23:55:09 <kmc> Sgeo: do you know about CSRF and how to prevent it?
23:55:56 <Sgeo> I know of one way that's supposed to prevent it... a token given to any page that needs to POST stuff, and the token needs to be given back
23:56:11 <kmc> yeah
23:56:21 <kmc> but typically, the server doesn't know or care what the 'right' token is
23:56:23 <Sgeo> But wouldn't requiring something like X-Requested-With: blah or requiring Content-Type to be application/json work?
23:56:38 <kmc> it just verifies that the token submitted as part of the form matches the token in a cookie
23:56:58 <kmc> a CSRF attacker controls the former, and the latter is part of the ambient authority that they're trying to exploit but can't use directly
23:57:04 <kmc> can't see directly, anyway
23:58:08 <kmc> yeah, sometimes you put the token in a custom header instead of a field element
23:58:19 <kmc> but either way it has to match that cookie
23:58:37 <kmc> this gives rise to a sort of variation on a session fixation attack, call it a csrf token fixation attack
23:59:02 <kmc> say that lolbutts.github.com is controlled by an attacker
23:59:15 <kmc> they can set a cookie for *.github.com that contains a csrf token of their choice
23:59:34 <kmc> then use it to CSR-forge requests to the main github app
23:59:45 <Sgeo> How do you CSR-forge a custom header anyway?
←2013-04-14 2013-04-15 2013-04-16→ ↑2013 ↑all